The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025707	Escherichia coli strain YDC107 chromosome, complete genome	5198311	155	75407	5198311	tail,transposase,head,lysis,capsid,portal,terminase,integrase	Escherichia_phage(44.44%)	101	45318:45333	61544:61559
AUO32241.1|155_437_+|tail	phage tail assembly protein T	tail	A0A2R9YJK0	Escherichia_phage	100.0	1.0e-32
AUO32242.1|790_2041_+|tail	prophage tail length tape measure family protein	tail	A0A2R9YJM8	Escherichia_phage	100.0	6.4e-204
AUO32243.1|2051_3005_+|tail	phage tail tape measure protein, lambda family	tail	A0A2R9YJM8	Escherichia_phage	99.7	1.9e-160
AUO32244.1|2949_3330_+|tail	phage minor tail family protein	tail	A0A2R9YJM0	Escherichia_phage	96.7	3.3e-47
AUO32245.1|3329_3533_+|tail	phage minor tail L family protein	tail	A0A0K2FJ01	Enterobacteria_phage	87.3	6.6e-26
AUO32246.1|3586_4156_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.3	4.8e-74
AUO32247.1|4437_4641_+	nlpC/P60 family protein	NA	K7PLW1	Enterobacteria_phage	98.4	5.0e-34
AUO32248.1|4774_5080_+|tail	bacteriophage lambda tail assembly I family protein	tail	A0A2R9YJH6	Escherichia_phage	98.9	2.8e-44
AUO32249.1|5049_5346_+|tail	putative tail assembly protein I	tail	A0A291AWV5	Escherichia_phage	85.1	1.3e-35
AUO32250.1|5407_5689_+|tail	putative phage tail fiber /phage host specificity protein J	tail	A0A2I6TCW5	Escherichia_phage	98.6	7.7e-33
AUO32251.1|5685_6102_+	putative host specificity protein	NA	A0A2I6TCW5	Escherichia_phage	99.2	6.4e-68
AUO32252.1|6487_6763_+|tail	phage tail family protein	tail	A0A2I6TCW5	Escherichia_phage	98.7	3.2e-39
AUO32253.1|6826_6985_+	hypothetical protein	NA	A5LH43	Enterobacteria_phage	95.3	1.4e-15
AUO32254.1|7007_7250_+	phage host specificity domain protein	NA	A5LH43	Enterobacteria_phage	70.5	1.4e-22
AUO32255.1|7780_8338_+	hypothetical protein	NA	A0A0P0ZEQ8	Stx2-converting_phage	97.1	1.5e-91
AUO32256.1|8953_9076_+	enterobacterial Ail/Lom family protein	NA	Q9LA63	Enterobacterial_phage	100.0	1.2e-11
AUO32257.1|9148_9553_+	outer membrane beta-barrel domain protein	NA	H6WZM8	Escherichia_phage	96.3	4.6e-71
AUO32258.1|9651_9879_+|tail	prophage tail fiber N-terminal family protein	tail	A0A2D1UII2	Escherichia_phage	90.6	1.0e-19
AUO32259.1|9909_11064_+	hypothetical protein	NA	A0A1X7QGG5	Escherichia_phage	71.7	5.1e-38
AUO32260.1|11087_11462_+|tail	putative tail fiber domain protein	tail	A0A0E3M194	Enterobacteria_phage	58.0	9.6e-31
AUO32261.1|11994_12276_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	51.1	1.4e-18
AUO32262.1|12597_12975_+	hypothetical protein	NA	A0A0E3M4A9	Enterobacteria_phage	72.9	2.1e-46
AUO32263.1|12989_13322_+	chaperone of endosialidase family protein	NA	A0A0E3M4A9	Enterobacteria_phage	80.4	2.3e-36
AUO32264.1|13364_13652_+	hypothetical protein	NA	NA	NA	NA	NA
AUO32265.1|13955_14687_-	protein SopB	NA	O64340	Escherichia_phage	80.6	1.1e-107
AUO32266.1|14683_15853_-	cobQ/CobB/MinD/ParA nucleotide binding domain protein	NA	O03951	Escherichia_phage	93.3	8.9e-216
AUO32267.1|16766_17936_+	cobQ/CobB/MinD/ParA nucleotide binding domain protein	NA	O03951	Escherichia_phage	93.3	8.9e-216
AUO32268.1|17932_18922_+	protein SopB	NA	Q6UAV8	Klebsiella_phage	74.4	1.9e-134
AUO32269.1|18970_19258_-	hypothetical protein	NA	NA	NA	NA	NA
AUO32270.1|19300_20341_-	chaperone of endosialidase family protein	NA	A0A0E3M4A9	Enterobacteria_phage	66.4	5.1e-122
AUO32271.1|20350_20632_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	51.1	1.4e-18
AUO32272.1|20631_23010_-	carboxypeptidase regulatory-like domain protein	NA	A0A1X7QGG5	Escherichia_phage	69.7	1.8e-170
AUO32273.1|23074_23674_-	outer membrane beta-barrel domain protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
AUO32274.1|23741_27221_-	hypothetical protein	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
AUO32275.1|27281_27854_-|tail	bacteriophage lambda tail assembly I family protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	3.0e-84
AUO32276.1|27850_28594_-	nlpC/P60 family protein	NA	K7PLW1	Enterobacteria_phage	97.2	5.9e-149
AUO32277.1|28599_29298_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	1.6e-132
AUO32278.1|29297_29627_-|tail	phage minor tail family protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
AUO32279.1|29623_32203_-|tail	phage tail tape measure protein, lambda family	tail	A0A2R9YJM8	Escherichia_phage	100.0	0.0e+00
AUO32280.1|32195_32630_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
AUO32281.1|32611_33025_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	93.6	5.4e-67
AUO32282.1|33040_33523_-|tail	major tail protein V	tail	A0A2I6TC77	Escherichia_phage	100.0	2.5e-79
AUO32283.1|33645_33780_-|tail	major tail V domain protein	tail	A0A2I6TC77	Escherichia_phage	100.0	8.7e-11
AUO32284.1|33787_34183_-|tail	minor tail protein U	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
AUO32285.1|34179_34758_-|tail	prophage minor tail Z family protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
AUO32286.1|34738_35011_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.6	7.9e-35
AUO32287.1|35132_35402_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	74.4	1.2e-19
AUO32288.1|35600_35900_-|capsid	phage major capsid E family protein	capsid	C6ZCY2	Enterobacteria_phage	98.9	5.5e-45
AUO32289.1|35868_36591_-|capsid	phage major capsid E family protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	3.2e-107
AUO32290.1|36645_36978_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AUO32291.1|36987_38307_-	peptidase S49 family protein	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
AUO32292.1|38287_39889_-|portal	phage portal protein, lambda family	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.4e-309
AUO32293.1|39885_40092_-|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AUO32294.1|40088_42014_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
AUO32295.1|41988_42534_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AUO32296.1|43213_43624_+	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AUO32297.1|43775_43949_-	gnsA/GnsB family protein	NA	NA	NA	NA	NA
AUO32298.1|44622_44835_-	cold shock-like protein CspG	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AUO32299.1|45197_45680_-	hypothetical protein	NA	A0A291LBG9	Klebsiella_phage	29.9	2.8e-06
45318:45333	attL	CATGTTGGTGAGCATT	NA	NA	NA	NA
AUO32300.1|45691_46225_-	phage lysozyme family protein	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AUO32301.1|46221_46533_-	hypothetical protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AUO32302.1|46537_46744_-|lysis	lysis S family protein	lysis	A5LH82	Enterobacteria_phage	94.1	4.5e-30
AUO32303.1|46785_46905_+	hypothetical protein	NA	NA	NA	NA	NA
AUO32304.1|47506_47722_-	cold shock protein CspA	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AUO32305.1|48022_48235_+	cold shock-like protein CspG	NA	NA	NA	NA	NA
AUO32306.1|48962_49409_-	antitermination family protein	NA	Q8SBE4	Shigella_phage	93.9	1.9e-73
AUO32307.1|49422_50472_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
AUO32308.1|50818_51070_-	hypothetical protein	NA	NA	NA	NA	NA
AUO32309.1|51286_51442_-	hok/gef family protein	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AUO32310.1|51513_51801_-	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AUO32311.1|51800_52040_-	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AUO32312.1|52572_52905_+	flxA-like family protein	NA	NA	NA	NA	NA
AUO32313.1|53341_54655_-|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
AUO32314.1|54832_55015_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
AUO32315.1|54989_55169_-	putative membrane protein	NA	NA	NA	NA	NA
AUO32316.1|55932_56337_+|transposase	transposase family protein	transposase	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
AUO32317.1|56333_56681_+|transposase	putative transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AUO32318.1|56729_58265_+|transposase	transposase C of IS166 homeodomain protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
AUO32319.1|58784_59141_-	methyltransferase domain protein	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
AUO32320.1|59137_59560_-	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
AUO32321.1|59600_60566_-	putative ybl78	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
AUO32322.1|60546_61068_-	hypothetical protein	NA	NA	NA	NA	NA
AUO32323.1|61051_61282_-	putative division inhibitor repressor protein DicB	NA	NA	NA	NA	NA
AUO32324.1|61365_61773_+	helix-turn-helix domain protein	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
61544:61559	attR	AATGCTCACCAACATG	NA	NA	NA	NA
AUO32325.1|61939_62095_+	hypothetical protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AUO32326.1|62096_62225_+	hypothetical protein	NA	NA	NA	NA	NA
AUO32327.1|62254_62473_+	hypothetical protein	NA	NA	NA	NA	NA
AUO32328.1|62476_62641_-	hypothetical protein	NA	NA	NA	NA	NA
AUO32329.1|63040_63229_+	dicB family protein	NA	NA	NA	NA	NA
AUO32330.1|63225_63417_+	hypothetical protein	NA	NA	NA	NA	NA
AUO32331.1|63509_65981_+	putative exonuclease VIII	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
AUO32332.1|66068_66305_+	hypothetical protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
AUO32333.1|66339_67620_+|integrase	phage integrase family protein	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
AUO32334.1|67807_68827_-	zinc-binding dehydrogenase family protein	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AUO32335.1|68838_70053_-	mandelate racemase / muconate lactonizing enzyme, C-terminal domain protein	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AUO32336.1|70258_70585_-	hypothetical protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
AUO32337.1|70719_71061_+	hypothetical protein	NA	NA	NA	NA	NA
AUO32338.1|71095_71656_+	spermidine N(1)-acetyltransferase	NA	NA	NA	NA	NA
AUO32339.1|71658_72405_-	hypothetical protein	NA	NA	NA	NA	NA
AUO32340.1|72476_72782_+	hypothetical protein	NA	NA	NA	NA	NA
AUO32341.1|72980_75407_+	anaerobic dimethyl sulfoxide reductase, A subunit, DmsA/YnfE family protein	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
>prophage 2
CP025707	Escherichia coli strain YDC107 chromosome, complete genome	5198311	445880	513332	5198311	integrase,transposase	Bacillus_phage(25.0%)	50	444980:444996	497354:497370
444980:444996	attL	GCGCTCAGCCAGCAGGT	NA	NA	NA	NA
AUO32706.1|445880_446174_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	92.8	8.3e-46
AUO32707.1|446222_446918_+	molecular chaperone Hsp31 and glyoxalase 3	NA	NA	NA	NA	NA
AUO32708.1|447025_448384_-	putative sensor-like histidine kinase YedV	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
AUO32709.1|448383_449055_-	putative transcriptional regulatory protein YedW	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
AUO32710.1|449187_449601_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AUO32711.1|449709_450714_+	sulfoxide reductase catalytic subunit YedY	NA	NA	NA	NA	NA
AUO32712.1|450714_451350_+	ferric reductase like transmembrane component family protein	NA	NA	NA	NA	NA
AUO32713.1|451606_452257_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AUO32714.1|453109_453907_+	protein MtfA	NA	NA	NA	NA	NA
AUO32715.1|454244_454406_+	hypothetical protein	NA	A7X7X0	Dichelobacter_phage	51.3	1.7e-05
AUO32716.1|454410_455160_+|integrase	phage integrase family protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.0	1.6e-40
AUO32717.1|455353_456658_-	salicylate synthase	NA	NA	NA	NA	NA
AUO32718.1|456685_457966_-	major Facilitator Superfamily protein	NA	NA	NA	NA	NA
AUO32719.1|457958_459761_-	ABC transporter family protein	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
AUO32720.1|459747_461550_-	ABC transporter family protein	NA	W8CYL7	Bacillus_phage	27.6	1.4e-31
AUO32721.1|461716_462676_+	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AUO32722.1|462866_468974_+	amino acid adenylation domain protein	NA	A0A2K9L3I8	Tupanvirus	27.3	4.0e-33
AUO32723.1|469061_478553_+	methyltransferase family protein	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
AUO32724.1|478549_479650_+	yersiniabactin biosynthetic protein YbtU	NA	NA	NA	NA	NA
AUO32725.1|479646_480450_+	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
AUO32726.1|480453_482031_+	AMP-binding enzyme family protein	NA	NA	NA	NA	NA
AUO32727.1|482161_484183_+	pesticin receptor	NA	NA	NA	NA	NA
AUO32728.1|484874_485585_+	hypothetical protein	NA	NA	NA	NA	NA
AUO32729.1|485819_487547_+	carboxypeptidase regulatory-like domain protein	NA	NA	NA	NA	NA
AUO32730.1|487802_488855_-	glycosyltransferase 9 family protein	NA	NA	NA	NA	NA
AUO32731.1|489169_490486_+	H+ symporter family protein	NA	NA	NA	NA	NA
AUO32732.1|490587_492042_+	AMP nucleosidase	NA	NA	NA	NA	NA
AUO32733.1|492384_493101_+	putative transcriptional regulatory protein YeeN	NA	NA	NA	NA	NA
AUO32734.1|493729_495184_-	MATE efflux family protein	NA	NA	NA	NA	NA
AUO32735.1|495490_496441_-	HTH-type transcriptional regulator cbl	NA	NA	NA	NA	NA
AUO32736.1|496542_497460_-	lysR substrate binding domain protein	NA	NA	NA	NA	NA
497354:497370	attR	ACCTGCTGGCTGAGCGC	NA	NA	NA	NA
AUO32737.1|497917_498850_-	putative L,D-transpeptidase ErfK/SrfK	NA	NA	NA	NA	NA
AUO32738.1|498914_499994_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
AUO32739.1|500005_500749_-	cobalamin 5'-phosphate synthase	NA	NA	NA	NA	NA
AUO32740.1|500745_501288_-	bifunctional adenosylcobalamin biosynthesis protein CobU	NA	NA	NA	NA	NA
AUO32741.1|503029_503146_+|transposase	putative transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	71.4	1.2e-08
AUO32742.1|503341_503785_+	HTH domain protein	NA	NA	NA	NA	NA
AUO32743.1|503829_504555_+	pfkB carbohydrate kinase family protein	NA	NA	NA	NA	NA
AUO32744.1|504568_504706_+	hypothetical protein	NA	NA	NA	NA	NA
AUO32745.1|504732_505326_+	hypothetical protein	NA	NA	NA	NA	NA
AUO32746.1|505382_505991_+	hypothetical protein	NA	NA	NA	NA	NA
AUO32747.1|506084_506348_+	hypothetical protein	NA	NA	NA	NA	NA
AUO32748.1|506350_507385_+	putative phosphotriesterase	NA	NA	NA	NA	NA
AUO32749.1|508036_508894_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AUO32750.1|509699_510107_-	hypothetical protein	NA	NA	NA	NA	NA
AUO32751.1|510094_510496_-	hypothetical protein	NA	NA	NA	NA	NA
AUO32752.1|510755_511325_-	hypothetical protein	NA	NA	NA	NA	NA
AUO32753.1|511524_511722_+	hypothetical protein	NA	NA	NA	NA	NA
AUO32754.1|512559_512985_+|transposase	transposase family protein	transposase	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AUO32755.1|512981_513332_+|transposase	putative transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
>prophage 3
CP025707	Escherichia coli strain YDC107 chromosome, complete genome	5198311	562462	569980	5198311		Escherichia_phage(42.86%)	7	NA	NA
AUO32805.1|562462_563011_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
AUO32806.1|563015_563894_-	glucose-1-phosphate thymidylyltransferase	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
AUO32807.1|563951_564851_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
AUO32808.1|564850_565936_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
AUO32809.1|566307_567201_-	regulatory protein GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AUO32810.1|567432_568428_-	3-beta hydroxysteroid dehydrogenase/isomerase family protein	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
AUO32811.1|568585_569980_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	9.8e-20
>prophage 4
CP025707	Escherichia coli strain YDC107 chromosome, complete genome	5198311	660321	669764	5198311		Enterobacteria_phage(85.71%)	10	NA	NA
AUO32883.1|660321_661458_+	VWA domain containing CoxE-like family protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
AUO32884.1|661454_663455_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AUO32885.1|663579_664041_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AUO32886.1|664082_664553_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AUO32887.1|664599_665319_-	response regulator	NA	NA	NA	NA	NA
AUO32888.1|665315_667001_-	putative sensor-like histidine kinase YehU	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
AUO32889.1|667222_667954_+	merR regulatory family protein	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
AUO32890.1|668013_668121_+	hypothetical protein	NA	NA	NA	NA	NA
AUO32891.1|668101_668833_-	putative osmoprotectant uptake system permease protein YehW	NA	NA	NA	NA	NA
AUO32892.1|668837_669764_-	ABC transporter family protein	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 5
CP025707	Escherichia coli strain YDC107 chromosome, complete genome	5198311	1073086	1116165	5198311	protease,tail,head,terminase,integrase	Escherichia_phage(61.11%)	55	1074925:1074941	1113051:1113067
AUO33250.1|1073086_1073239_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
AUO33251.1|1073274_1073448_+	hypothetical protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
AUO33252.1|1073761_1074277_+	glycine zipper 2TM domain protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
AUO33253.1|1074292_1074832_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	96.6	1.6e-42
1074925:1074941	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
AUO33254.1|1075051_1075534_-	hypothetical protein	NA	A0A2R9YJI7	Escherichia_phage	100.0	5.5e-79
AUO33255.1|1075530_1076160_-	chitinase class I family protein	NA	G9L6E8	Escherichia_phage	96.2	1.2e-113
AUO33256.1|1076149_1076458_-	hypothetical protein	NA	G9L6E7	Escherichia_phage	91.2	8.7e-46
AUO33257.1|1076444_1076849_-	putative membrane protein	NA	G9L6E6	Escherichia_phage	97.0	2.7e-63
AUO33258.1|1077255_1080231_-	putative endo-N-acetylneuraminidase	NA	A0A2L0HPI4	Escherichia_phage	72.0	0.0e+00
AUO33259.1|1080426_1080684_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	3.4e-43
AUO33260.1|1080715_1081012_-	putative membrane protein	NA	A0A2R9YJP3	Escherichia_phage	100.0	2.5e-50
AUO33261.1|1081207_1083682_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.4	0.0e+00
AUO33262.1|1083687_1085490_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.8	0.0e+00
AUO33263.1|1085486_1088000_-	putative prophage MuMc02, structural protein P5	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	99.6	0.0e+00
AUO33264.1|1087999_1088545_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	100.0	9.8e-93
AUO33265.1|1088544_1089009_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	98.7	2.4e-84
AUO33266.1|1089008_1091480_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.1	0.0e+00
AUO33267.1|1091479_1092085_-	hypothetical protein	NA	G9L6C9	Escherichia_phage	100.0	2.8e-112
AUO33268.1|1092084_1092408_-	putative bbp20	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	97.2	1.7e-52
AUO33269.1|1092458_1092794_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
AUO33270.1|1092804_1093242_-	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	95.9	3.8e-71
AUO33271.1|1093293_1094280_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
AUO33272.1|1094294_1094990_-|protease	putative protease	protease	G9L6C4	Escherichia_phage	95.2	2.2e-89
AUO33273.1|1094992_1095289_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	99.0	1.1e-45
AUO33274.1|1095285_1096965_-|head,tail	bacteriophage head to tail connecting family protein	head,tail	G9L6C2	Escherichia_phage	99.3	1.8e-302
AUO33275.1|1096979_1097186_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
AUO33276.1|1097619_1097871_-	hypothetical protein	NA	G9L6C0	Escherichia_phage	100.0	1.6e-42
AUO33277.1|1097888_1098263_+	phage family protein	NA	Q716B1	Shigella_phage	74.6	1.4e-42
AUO33278.1|1098353_1099829_-|terminase	putative terminase large subunit protein	terminase	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.4	9.9e-297
AUO33279.1|1099825_1100419_-|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	100.0	1.2e-104
AUO33280.1|1100540_1100879_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	98.2	2.4e-57
AUO33281.1|1101158_1101914_-	hypothetical protein	NA	S4TSR6	Salmonella_phage	58.1	4.4e-51
AUO33282.1|1101910_1102120_-	putative phage protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	94.2	8.8e-34
AUO33283.1|1102121_1102484_-	putative P22 EaA protein	NA	A0A2I6PID2	Escherichia_phage	93.0	4.2e-39
AUO33284.1|1102485_1102677_-	hypothetical protein	NA	A0A2I6TD51	Escherichia_phage	100.0	2.1e-26
AUO33285.1|1102678_1103494_-	ead/Ea22-like family protein	NA	A0A2I6TD51	Escherichia_phage	100.0	1.6e-147
AUO33286.1|1103480_1103798_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	92.0	1.8e-46
AUO33287.1|1103794_1104244_-	hypothetical protein	NA	A0A2I6TCH0	Escherichia_phage	98.7	9.3e-73
AUO33288.1|1104305_1104650_-	hypothetical protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	99.1	1.3e-61
AUO33289.1|1104767_1105553_-	replication P family protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	100.0	9.3e-153
AUO33290.1|1105549_1106365_-	helix-turn-helix domain protein	NA	Q286X4	Escherichia_phage	96.4	2.4e-119
AUO33291.1|1106380_1106581_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
AUO33292.1|1106731_1106962_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	97.4	2.2e-38
AUO33293.1|1107116_1107701_+	helix-turn-helix family protein	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
AUO33294.1|1107854_1108007_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	100.0	5.4e-25
AUO33295.1|1108009_1108309_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	98.0	1.4e-45
AUO33296.1|1108305_1109127_+	hypothetical protein	NA	A0A2R9YJH7	Escherichia_phage	100.0	1.2e-163
AUO33297.1|1109123_1110065_+	recT family protein	NA	A0A2R9YJJ1	Escherichia_phage	100.0	4.5e-178
AUO33298.1|1110114_1110363_+	prophage CP4-57 regulatory family protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
AUO33299.1|1110472_1110772_+	perC transcriptional activator family protein	NA	A0A2R9YJK3	Escherichia_phage	100.0	4.3e-50
AUO33300.1|1110764_1111415_+	MT-A70 family protein	NA	A0A2R9YJG0	Escherichia_phage	100.0	5.0e-128
AUO33301.1|1111411_1111606_+	hypothetical protein	NA	A0A0F6R7M7	Escherichia_coli_O157_typing_phage	96.9	2.2e-26
AUO33302.1|1111609_1112860_-|integrase	phage integrase family protein	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.5	3.6e-239
AUO33303.1|1113052_1114630_-	GMP synthase [glutamine-hydrolyzing]	NA	NA	NA	NA	NA
1113051:1113067	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
AUO33304.1|1114698_1116165_-	inosine-5'-monophosphate dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
>prophage 6
CP025707	Escherichia coli strain YDC107 chromosome, complete genome	5198311	1332587	1339727	5198311		Escherichia_phage(83.33%)	6	NA	NA
AUO33493.1|1332587_1335149_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
AUO33494.1|1335254_1335911_+	serine/threonine-protein phosphatase 2	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
AUO33495.1|1335961_1336729_-	HTH domain protein	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
AUO33496.1|1336924_1337833_+	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain protein	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
AUO33497.1|1337829_1339092_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	61.2	1.4e-134
AUO33498.1|1339088_1339727_+	class II Aldolase and Adducin N-terminal domain protein	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 7
CP025707	Escherichia coli strain YDC107 chromosome, complete genome	5198311	1607987	1691362	5198311	integrase,tRNA,protease,transposase	Enterobacteria_phage(28.12%)	84	1657440:1657487	1688180:1688227
AUO33748.1|1607987_1608905_+|transposase	transposase DDE domain protein	transposase	A0A1V0E8E1	Vibrio_phage	59.2	2.2e-100
AUO33749.1|1608901_1609723_-	hypothetical protein	NA	NA	NA	NA	NA
AUO33750.1|1609839_1610886_-	L-asparaginase 2	NA	NA	NA	NA	NA
AUO33751.1|1611061_1611781_-	hypothetical protein	NA	NA	NA	NA	NA
AUO33752.1|1611964_1612291_-	hypothetical protein	NA	NA	NA	NA	NA
AUO33753.1|1612290_1613010_-|tRNA	tRNA (guanine-N(7)-)-methyltransferase	tRNA	NA	NA	NA	NA
AUO33754.1|1613170_1614223_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AUO33755.1|1614250_1614526_+	putative Fe(2+)-trafficking protein	NA	NA	NA	NA	NA
AUO33756.1|1614589_1615669_+	transglycosylase SLT domain protein	NA	NA	NA	NA	NA
AUO33757.1|1615870_1617127_+	nucleoside transporter family protein	NA	NA	NA	NA	NA
AUO33758.1|1617172_1619308_-	ornithine decarboxylase, constitutive	NA	NA	NA	NA	NA
AUO33759.1|1619705_1620413_+	hypothetical protein	NA	NA	NA	NA	NA
AUO33760.1|1620791_1622057_+|integrase	phage integrase family protein	integrase	Q7M297	Enterobacteria_phage	38.1	1.3e-76
AUO33761.1|1622312_1623356_+	anaphase-promoting complex, cyclosome, subunit 3 family protein	NA	NA	NA	NA	NA
AUO33762.1|1623885_1624161_+	insA N-terminal domain protein	NA	Q71TE9	Escherichia_phage	97.8	3.8e-45
AUO33763.1|1625051_1625552_-	marR family protein	NA	NA	NA	NA	NA
AUO33764.1|1625769_1626009_-|integrase	integrase core domain protein	integrase	Q716C2	Shigella_phage	58.9	7.2e-16
AUO33765.1|1626617_1626869_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AUO33766.1|1627073_1627673_-	fimbrial adhesin PapG	NA	NA	NA	NA	NA
AUO33767.1|1628123_1628627_-	minor pilin subunit PapF	NA	NA	NA	NA	NA
AUO33768.1|1628701_1629223_-	fimbrial protein PapE	NA	NA	NA	NA	NA
AUO33769.1|1629277_1629655_-|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	99.2	1.1e-66
AUO33770.1|1629699_1629975_-	insA N-terminal domain protein	NA	Q71TE9	Escherichia_phage	97.8	3.8e-45
AUO33771.1|1630003_1630273_-	pap fimbrial major pilin protein	NA	NA	NA	NA	NA
AUO33772.1|1630256_1630574_-	pap fimbrial major pilin protein	NA	NA	NA	NA	NA
AUO33773.1|1631511_1631733_+	P fimbrial regulatory protein KS71A	NA	NA	NA	NA	NA
AUO33774.1|1632383_1632944_-|integrase	integrase core domain protein	integrase	A0A0N7C1X7	Escherichia_phage	96.8	2.3e-97
AUO33775.1|1633160_1634333_+|integrase	integrase core domain protein	integrase	U5N3F9	Enterobacteria_phage	99.5	3.5e-228
AUO33776.1|1634332_1635130_+	istB-like ATP binding family protein	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
AUO33777.1|1635425_1635644_-|transposase	transposase family protein	transposase	B6ETC4	Enterobacteria_phage	98.3	2.6e-28
AUO33778.1|1636383_1637130_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AUO33779.1|1637681_1637942_+	hypothetical protein	NA	NA	NA	NA	NA
AUO33780.1|1637983_1638544_+	bacterial regulatory, tetR family protein	NA	NA	NA	NA	NA
AUO33781.1|1638583_1639012_+	hypothetical protein	NA	NA	NA	NA	NA
AUO33782.1|1639720_1640086_+|transposase	transposase family protein	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
AUO33783.1|1640043_1640949_+	HTH-like domain protein	NA	Q9ZXG3	Shigella_phage	95.0	6.3e-169
AUO33784.1|1641448_1643539_+	outer membrane insertion C-terminal signal domain protein	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
AUO33785.1|1644052_1644172_-	hypothetical protein	NA	NA	NA	NA	NA
AUO33786.1|1644400_1644643_+	hypothetical protein	NA	NA	NA	NA	NA
AUO33787.1|1644933_1645302_+	hypothetical protein	NA	NA	NA	NA	NA
AUO33788.1|1645305_1645521_+	hypothetical protein	NA	NA	NA	NA	NA
AUO33789.1|1645517_1645790_+	putative neurotensin receptor R8	NA	NA	NA	NA	NA
AUO33790.1|1646630_1646930_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AUO33791.1|1647658_1647790_-	hypothetical protein	NA	NA	NA	NA	NA
AUO33792.1|1648126_1649014_+	L-lactate permease family protein	NA	NA	NA	NA	NA
AUO33793.1|1648957_1649992_-|integrase	integrase core domain protein	integrase	A0A1B1P773	Bacillus_phage	35.7	8.5e-45
AUO33794.1|1650028_1650490_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AUO33795.1|1650849_1651215_+|transposase	transposase family protein	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
AUO33796.1|1651172_1652078_+|integrase	integrase core domain protein	integrase	Q9ZXG3	Shigella_phage	97.0	4.2e-173
AUO33797.1|1652241_1652823_-	hypothetical protein	NA	NA	NA	NA	NA
AUO33798.1|1652869_1656757_-|protease	serine protease sat autotransporter	protease	Q9LA58	Enterobacterial_phage	38.9	1.5e-227
1657440:1657487	attL	CTCTCAGGAATTTCAGGATCTGCCAGACGGTGCTGAGACGACGCTTAC	NA	NA	NA	NA
AUO33799.1|1657701_1659801_-	ferric aerobactin receptor	NA	NA	NA	NA	NA
AUO33800.1|1659902_1661240_-	L-lysine N6-monooxygenase	NA	NA	NA	NA	NA
AUO33801.1|1661236_1662979_-	aerobactin synthase	NA	NA	NA	NA	NA
AUO33802.1|1662978_1663926_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
AUO33803.1|1663926_1665651_-	N(2)-citryl-N(6)-acetyl-N(6)-hydroxylysine synthase	NA	NA	NA	NA	NA
AUO33804.1|1665786_1666980_+	major Facilitator Superfamily protein	NA	NA	NA	NA	NA
AUO33805.1|1667371_1667806_+|transposase	transposase family protein	transposase	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
AUO33806.1|1667802_1668153_+|transposase	putative transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
AUO33807.1|1668183_1668738_+|transposase	transposase C of IS166 homeodomain protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.9	6.6e-28
AUO33808.1|1668752_1669178_+|transposase	transposase family protein	transposase	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AUO33809.1|1669174_1669309_+|transposase	putative transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	80.8	4.2e-05
AUO33810.1|1669314_1669641_+|transposase	putative transposase	transposase	Q6H9S4	Enterobacteria_phage	97.2	1.8e-54
AUO33811.1|1669640_1670528_+|integrase	integrase core domain protein	integrase	Q6H9S3	Enterobacteria_phage	100.0	4.7e-169
AUO33812.1|1670409_1671198_-|transposase	transposase family protein	transposase	Q9EYF6	Enterobacteria_phage	89.8	4.0e-26
AUO33813.1|1671362_1671671_-	hypothetical protein	NA	NA	NA	NA	NA
AUO33814.1|1671667_1672051_-	hypothetical protein	NA	NA	NA	NA	NA
AUO33815.1|1672216_1672786_-	hypothetical protein	NA	NA	NA	NA	NA
AUO33816.1|1674625_1674778_+	prophage CP4-57 regulatory family protein	NA	NA	NA	NA	NA
AUO33817.1|1674916_1675489_+	hypothetical protein	NA	NA	NA	NA	NA
AUO33818.1|1675609_1677100_-	hypothetical protein	NA	NA	NA	NA	NA
AUO33819.1|1678431_1679304_+	miro-like family protein	NA	NA	NA	NA	NA
AUO33820.1|1679675_1682522_+	extended Signal Peptide of Type V secretion system family protein	NA	NA	NA	NA	NA
AUO33821.1|1682642_1685159_+	putative membrane protein	NA	NA	NA	NA	NA
AUO33822.1|1685235_1685691_+	putative aec69	NA	NA	NA	NA	NA
AUO33823.1|1685810_1687349_-|transposase	transposase IS66 family protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.2	5.0e-291
AUO33824.1|1687397_1687745_-|transposase	putative transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	99.1	7.5e-62
AUO33825.1|1687741_1688146_-|transposase	transposase family protein	transposase	A0A0P0ZCV4	Stx2-converting_phage	99.3	8.7e-70
AUO33826.1|1688564_1689383_+	hypothetical protein	NA	A0A2C9CX26	Yersinia_phage	37.9	2.0e-44
1688180:1688227	attR	CTCTCAGGAATTTCAGGATCTGCCAGACGGTGCTGAGACGACGCTTAC	NA	NA	NA	NA
AUO33827.1|1689437_1689923_+	antirestriction family protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
AUO33828.1|1689938_1690415_+	DNA repair RadC family protein	NA	NA	NA	NA	NA
AUO33829.1|1690477_1690699_+	hypothetical protein	NA	A0A142F0X9	Klebsiella_phage	47.9	8.5e-11
AUO33830.1|1690717_1690861_+	hypothetical protein	NA	NA	NA	NA	NA
AUO33831.1|1690918_1691362_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	35.2	1.2e-19
>prophage 8
CP025707	Escherichia coli strain YDC107 chromosome, complete genome	5198311	3122637	3182013	5198311	integrase,transposase,tRNA,holin	Shigella_phage(25.0%)	57	3152274:3152288	3168238:3168252
AUO35135.1|3122637_3125493_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
AUO35136.1|3125492_3125936_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AUO35137.1|3126289_3127801_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AUO35138.1|3128160_3129168_+	lipopolysaccharide export system permease protein LptF	NA	NA	NA	NA	NA
AUO35139.1|3129167_3130250_+	lipopolysaccharide export system permease protein LptG	NA	NA	NA	NA	NA
AUO35140.1|3130410_3131913_-	AAA-like domain protein	NA	A0A248XCZ8	Klebsiella_phage	43.9	1.8e-83
AUO35141.1|3131990_3132989_-	periplasmic binding and sugar binding domain of LacI family protein	NA	NA	NA	NA	NA
AUO35142.1|3133055_3134375_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
AUO35143.1|3134437_3135202_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
AUO35144.1|3135225_3136257_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
AUO35145.1|3136473_3137037_+	carbohydrate kinase, thermoresistant glucokinase family protein	NA	NA	NA	NA	NA
AUO35146.1|3137040_3138060_-	zinc-binding dehydrogenase family protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
AUO35147.1|3138377_3138572_+	putative su+6 (supP) amber suppressor transfer RNA-Leu	NA	NA	NA	NA	NA
AUO35148.1|3138600_3139791_+|integrase	phage integrase family protein	integrase	B7SYF8	Stenotrophomonas_phage	40.1	9.4e-72
AUO35149.1|3140557_3140989_-	sulfatase family protein	NA	NA	NA	NA	NA
AUO35150.1|3140946_3141294_-	putative lipoprotein	NA	NA	NA	NA	NA
AUO35151.1|3142617_3143946_-|transposase	insertion element 4 transposase N-terminal family protein	transposase	NA	NA	NA	NA
AUO35152.1|3144572_3145790_+	sugar (and other) transporter family protein	NA	NA	NA	NA	NA
AUO35153.1|3145801_3146920_+	oxidoreductase family, C-terminal alpha/beta domain protein	NA	NA	NA	NA	NA
AUO35154.1|3146962_3147088_+	hypothetical protein	NA	NA	NA	NA	NA
AUO35155.1|3147140_3147491_-	putative yjhD protein	NA	NA	NA	NA	NA
AUO35156.1|3147711_3147984_+|transposase	transposase family protein	transposase	Q716C1	Shigella_phage	97.7	1.0e-37
AUO35157.1|3148225_3148879_+	DDE domain protein	NA	Q716C2	Shigella_phage	99.5	1.1e-130
AUO35158.1|3148813_3149227_-	hypothetical protein	NA	NA	NA	NA	NA
AUO35159.1|3149186_3149345_-	hypothetical protein	NA	NA	NA	NA	NA
AUO35160.1|3149289_3151287_-|holin	transporter, betaine/carnitine/choline transporter family protein	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
AUO35161.1|3151440_3152259_-	HTH-like domain protein	NA	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
3152274:3152288	attL	ATTGTTGTCGCCATT	NA	NA	NA	NA
AUO35162.1|3152294_3152597_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AUO35163.1|3152795_3153209_+|integrase	integrase core domain protein	integrase	Q716C2	Shigella_phage	97.4	1.0e-62
AUO35164.1|3153205_3153448_+|integrase	integrase core domain protein	integrase	Q716C2	Shigella_phage	92.4	4.7e-39
AUO35165.1|3153530_3153788_+	hypothetical protein	NA	NA	NA	NA	NA
AUO35166.1|3154418_3155111_-	ABC transporter family protein	NA	G3M9Y6	Bacillus_virus	24.8	5.7e-13
AUO35167.1|3155111_3156068_-	fe(3+) dicitrate transport system permease protein FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	2.4e-17
AUO35168.1|3156064_3157063_-	ABC 3 transport family protein	NA	NA	NA	NA	NA
AUO35169.1|3157059_3157962_-	periplasmic binding family protein	NA	NA	NA	NA	NA
AUO35170.1|3158006_3160331_-	fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
AUO35171.1|3160417_3161371_-	fecR family protein	NA	NA	NA	NA	NA
AUO35172.1|3161367_3161889_-	putative RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AUO35173.1|3162668_3162878_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	98.6	2.2e-32
AUO35174.1|3163638_3163896_+	biofilm development YmgB/AriR family protein	NA	NA	NA	NA	NA
AUO35175.1|3164646_3166005_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
AUO35176.1|3166243_3167629_-|transposase	transposase IS66 family protein	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	7.7e-259
AUO35177.1|3167678_3168026_-|transposase	putative transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AUO35178.1|3168022_3168403_-|transposase	transposase family protein	transposase	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
3168238:3168252	attR	ATTGTTGTCGCCATT	NA	NA	NA	NA
AUO35179.1|3168521_3168758_-	hypothetical protein	NA	NA	NA	NA	NA
AUO35180.1|3168757_3169192_-	hypothetical protein	NA	NA	NA	NA	NA
AUO35181.1|3169179_3169581_-	hypothetical protein	NA	NA	NA	NA	NA
AUO35182.1|3169840_3170410_-	hypothetical protein	NA	NA	NA	NA	NA
AUO35183.1|3170609_3170810_+	hypothetical protein	NA	NA	NA	NA	NA
AUO35184.1|3171933_3172140_+	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AUO35185.1|3172234_3172837_+	hypothetical protein	NA	NA	NA	NA	NA
AUO35186.1|3173158_3174643_-	hypothetical protein	NA	NA	NA	NA	NA
AUO35187.1|3175873_3176746_+	miro-like family protein	NA	NA	NA	NA	NA
AUO35188.1|3177118_3179515_+	extended Signal Peptide of Type V secretion system family protein	NA	NA	NA	NA	NA
AUO35189.1|3179596_3180022_+|transposase	transposase family protein	transposase	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AUO35190.1|3180018_3180369_+|transposase	putative transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AUO35191.1|3180399_3182013_+|transposase	transposase C of IS166 homeodomain protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 9
CP025707	Escherichia coli strain YDC107 chromosome, complete genome	5198311	3276751	3358529	5198311	protease,tail,transposase,head,lysis,capsid,portal,terminase,integrase	Enterobacteria_phage(38.1%)	95	3296056:3296071	3347912:3347927
AUO35283.1|3276751_3277975_+|integrase	phage integrase family protein	integrase	A5LH57	Enterobacteria_phage	98.0	3.4e-234
AUO35284.1|3278260_3278980_+	hypothetical protein	NA	NA	NA	NA	NA
AUO35285.1|3279450_3280071_-	hypothetical protein	NA	A5LH60	Enterobacteria_phage	89.8	1.2e-110
AUO35286.1|3280070_3280433_-	putative phage protein	NA	K7PH61	Enterobacteria_phage	98.3	7.5e-65
AUO35287.1|3280423_3280960_-	hypothetical protein	NA	K7PKJ9	Enterobacteria_phage	98.9	1.4e-99
AUO35288.1|3281087_3281912_-	hypothetical protein	NA	Q8SBF9	Shigella_phage	98.9	3.9e-149
AUO35289.1|3281977_3282340_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AUO35290.1|3283008_3283683_-	peptidase S24-like family protein	NA	U5P0T5	Shigella_phage	99.6	6.0e-132
AUO35291.1|3283773_3283974_+	hypothetical protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
AUO35292.1|3284017_3284569_+	putative dNA-binding transcriptional regulator	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
AUO35293.1|3284565_3285402_+	ash family protein	NA	Q8SBF3	Shigella_phage	90.3	4.2e-135
AUO35294.1|3285394_3285631_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	97.4	1.3e-38
AUO35295.1|3285627_3286446_+	helix-turn-helix domain protein	NA	A5LH71	Enterobacteria_phage	87.8	6.2e-123
AUO35296.1|3286448_3286937_+	perC transcriptional activator family protein	NA	A0A291AWV6	Escherichia_phage	97.5	3.6e-86
AUO35297.1|3286936_3287590_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	2.8e-126
AUO35298.1|3287586_3287913_+	lexA DNA binding domain protein	NA	U5P451	Shigella_phage	100.0	9.2e-54
AUO35299.1|3287909_3288305_+	endodeoxyribonuclease RusA family protein	NA	A0A0P0ZD39	Stx2-converting_phage	97.6	4.8e-65
AUO35300.1|3288467_3289283_+	kilA-N domain protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
AUO35301.1|3289290_3290280_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
AUO35302.1|3290293_3291046_+	antitermination family protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
AUO35303.1|3291582_3291693_+	hypothetical protein	NA	NA	NA	NA	NA
AUO35304.1|3291980_3292196_+	cold shock protein CspA	NA	A0A1W6JNX5	Morganella_phage	75.0	5.9e-25
AUO35305.1|3292957_3293164_+|lysis	lysis S family protein	lysis	A5LH82	Enterobacteria_phage	92.6	5.8e-30
AUO35306.1|3293168_3293720_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	50.6	1.1e-35
AUO35307.1|3293667_3293928_-	hypothetical protein	NA	NA	NA	NA	NA
AUO35308.1|3294041_3294575_+	phage lysozyme family protein	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
AUO35309.1|3294571_3295069_+	hypothetical protein	NA	NA	NA	NA	NA
AUO35310.1|3295430_3295646_+	cold shock-like protein CspG	NA	A0A1W6JNX5	Morganella_phage	74.3	1.6e-22
3296056:3296071	attL	CTGACCGGAGATCATA	NA	NA	NA	NA
AUO35311.1|3296320_3296494_+	gnsA/GnsB family protein	NA	NA	NA	NA	NA
AUO35312.1|3296789_3296996_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	80.9	2.6e-22
AUO35313.1|3297246_3297714_-	hypothetical protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	4.7e-27
AUO35314.1|3297829_3298375_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AUO35315.1|3298349_3300275_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
AUO35316.1|3300271_3300478_+|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AUO35317.1|3300474_3302076_+|portal	phage portal protein, lambda family	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	8.5e-310
AUO35318.1|3302056_3303388_+|protease	clp protease family protein	protease	A0A2I6TC87	Escherichia_phage	96.3	8.2e-226
AUO35319.1|3303397_3303730_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
AUO35320.1|3303785_3304811_+|capsid	phage major capsid E family protein	capsid	C6ZCY2	Enterobacteria_phage	96.2	6.4e-186
AUO35321.1|3304852_3305251_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	4.0e-59
AUO35322.1|3305262_3305616_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
AUO35323.1|3305627_3306206_+|tail	prophage minor tail Z family protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	3.5e-80
AUO35324.1|3306202_3306598_+|tail	minor tail protein U	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
AUO35325.1|3306605_3307346_+|tail	major tail protein V	tail	A0A2I6TC77	Escherichia_phage	98.0	1.2e-130
AUO35326.1|3307361_3307784_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	1.5e-72
AUO35327.1|3307765_3308200_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	5.8e-64
AUO35328.1|3308192_3310754_+|tail	phage tail tape measure protein, lambda family	tail	A0A0K2FI43	Enterobacteria_phage	89.6	0.0e+00
AUO35329.1|3310750_3311080_+|tail	phage minor tail family protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	1.5e-56
AUO35330.1|3311079_3311778_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.0	1.2e-130
AUO35331.1|3311926_3312526_+	nlpC/P60 family protein	NA	K7PLW1	Enterobacteria_phage	94.0	1.8e-116
AUO35332.1|3312522_3313095_+|tail	bacteriophage lambda tail assembly I family protein	tail	A0A0K2FJB0	Escherichia_phage	98.9	6.7e-84
AUO35333.1|3313155_3316635_+	fibronectin type III family protein	NA	A5LH43	Enterobacteria_phage	88.9	0.0e+00
AUO35334.1|3316702_3317302_+	outer membrane beta-barrel domain protein	NA	Q9EV15	Enterobacteria_phage	92.0	1.5e-102
AUO35335.1|3317366_3319742_+	carboxypeptidase regulatory-like domain protein	NA	A0A1X7QGG5	Escherichia_phage	69.5	4.3e-169
AUO35336.1|3319741_3320023_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	9.1e-18
AUO35337.1|3320032_3321073_+	chaperone of endosialidase family protein	NA	A0A0E3M4A9	Enterobacteria_phage	67.6	6.4e-125
AUO35338.1|3321115_3321409_+	hypothetical protein	NA	NA	NA	NA	NA
AUO35339.1|3321636_3322227_-	putative DNA-invertase from lambdoid prophage Rac	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AUO35340.1|3322607_3322841_-	putative dNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	87.0	1.9e-32
AUO35341.1|3323449_3323698_-	dinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
AUO35342.1|3323917_3325504_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
AUO35343.1|3325896_3326502_+	osmotically-inducible protein Y	NA	NA	NA	NA	NA
AUO35344.1|3326628_3326790_+	hypothetical protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
AUO35345.1|3326911_3327985_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
AUO35346.1|3327981_3328761_+	hypothetical protein	NA	NA	NA	NA	NA
AUO35347.1|3328877_3329741_-	4Fe-4S binding domain protein	NA	NA	NA	NA	NA
AUO35348.1|3329712_3331263_-	hypothetical protein	NA	NA	NA	NA	NA
AUO35349.1|3331520_3332300_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
AUO35350.1|3332377_3333700_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
AUO35351.1|3333751_3334975_+	phosphopentomutase	NA	NA	NA	NA	NA
AUO35352.1|3335031_3335751_+	purine nucleoside phosphorylase	NA	NA	NA	NA	NA
AUO35353.1|3335911_3336175_-	helix-turn-helix family protein	NA	NA	NA	NA	NA
AUO35354.1|3336206_3337223_-	lipoate-protein ligase A	NA	NA	NA	NA	NA
AUO35355.1|3337250_3337892_-	bacterial virulence factor hemolysin family protein	NA	NA	NA	NA	NA
AUO35356.1|3337997_3338966_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
AUO35357.1|3339014_3340397_+	DNA repair protein RadA	NA	NA	NA	NA	NA
AUO35358.1|3340417_3341650_+	trifunctional NAD biosynthesis/regulator protein NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
AUO35359.1|3342110_3342323_-	hypothetical protein	NA	NA	NA	NA	NA
AUO35360.1|3342480_3342897_-	polyketide cyclase / dehydrase and lipid transport family protein	NA	NA	NA	NA	NA
AUO35361.1|3342922_3343720_-	NADH(P)-binding family protein	NA	NA	NA	NA	NA
AUO35362.1|3343739_3344750_-	aldo/keto reductase family protein	NA	NA	NA	NA	NA
AUO35363.1|3344882_3345770_+	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AUO35364.1|3345950_3346472_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AUO35365.1|3346696_3347299_+|integrase	integrase core domain protein	integrase	A0A1B1P773	Bacillus_phage	56.8	1.3e-61
AUO35366.1|3347255_3347360_-	hypothetical protein	NA	NA	NA	NA	NA
AUO35367.1|3347359_3349027_-	heme ABC exporter, ATP-binding protein CcmA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
3347912:3347927	attR	CTGACCGGAGATCATA	NA	NA	NA	NA
AUO35368.1|3349237_3351175_+	soluble lytic murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
AUO35369.1|3351294_3351591_+	trp operon repressor	NA	NA	NA	NA	NA
AUO35370.1|3351584_3352100_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
AUO35371.1|3352151_3352799_+	histidine phosphatase super family protein	NA	NA	NA	NA	NA
AUO35372.1|3352795_3353665_-	right origin-binding protein	NA	NA	NA	NA	NA
AUO35373.1|3353875_3354349_+	creA family protein	NA	NA	NA	NA	NA
AUO35374.1|3354361_3355051_+	transcriptional regulatory protein CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
AUO35375.1|3355050_3356475_+	sensor protein CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	4.2e-10
AUO35376.1|3356532_3357885_+	inner membrane protein CreD	NA	NA	NA	NA	NA
AUO35377.1|3358070_3358529_+|transposase	transposase IS200 like family protein	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
>prophage 10
CP025707	Escherichia coli strain YDC107 chromosome, complete genome	5198311	4633818	4697183	5198311	tail,tRNA,transposase,head,lysis,capsid,portal,terminase,integrase	Escherichia_phage(38.18%)	76	4624733:4624748	4643559:4643574
4624733:4624748	attL	CATACCACGAAATAAA	NA	NA	NA	NA
AUO36505.1|4633818_4634937_-|integrase	phage integrase family protein	integrase	Q77Z04	Phage_21	44.2	7.7e-84
AUO36506.1|4634905_4635175_-	excisionase-like family protein	NA	NA	NA	NA	NA
AUO36507.1|4635236_4637675_-	enterobacterial exodeoxyribonuclease VIII family protein	NA	V5UQJ3	Shigella_phage	45.0	2.3e-112
AUO36508.1|4637767_4637956_-	hypothetical protein	NA	NA	NA	NA	NA
AUO36509.1|4637952_4638141_-	dicB family protein	NA	NA	NA	NA	NA
AUO36510.1|4638681_4639056_-	hypothetical protein	NA	NA	NA	NA	NA
AUO36511.1|4639078_4639297_-	hypothetical protein	NA	NA	NA	NA	NA
AUO36512.1|4639326_4639455_-	hypothetical protein	NA	NA	NA	NA	NA
AUO36513.1|4639456_4639693_-	hypothetical protein	NA	M4QQ57	Salicola_phage	51.1	1.4e-06
AUO36514.1|4639884_4640601_-	helix-turn-helix domain protein	NA	H9C160	Pectobacterium_phage	42.0	1.0e-52
AUO36515.1|4640650_4640866_+	regulatory protein cro	NA	NA	NA	NA	NA
AUO36516.1|4640862_4641288_+	hypothetical protein	NA	NA	NA	NA	NA
AUO36517.1|4641310_4642273_+	helix-turn-helix domain protein	NA	S5FM81	Shigella_phage	56.4	1.9e-70
AUO36518.1|4642313_4642736_+	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.0e-64
AUO36519.1|4642732_4642987_+	putative dNA ligase	NA	A0A0U2RK51	Escherichia_phage	90.5	7.7e-40
AUO36520.1|4642979_4643291_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	96.1	3.4e-58
AUO36521.1|4643419_4643602_+	putative phage protein	NA	A0A2R2Z308	Escherichia_phage	98.3	9.1e-27
4643559:4643574	attR	CATACCACGAAATAAA	NA	NA	NA	NA
AUO36522.1|4643594_4643771_+	putative yheA protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	3.3e-26
AUO36523.1|4643767_4644127_+	putative prophage protein	NA	A0A076GCN9	Escherichia_phage	76.5	9.2e-39
AUO36524.1|4644129_4644621_+	hypothetical protein	NA	G9L661	Escherichia_phage	93.3	2.0e-84
AUO36525.1|4644622_4644886_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	2.0e-30
AUO36526.1|4644896_4645799_+	hypothetical protein	NA	A0A1U9AJ59	Stx1_converting_phage	57.6	1.8e-78
AUO36527.1|4646033_4646246_+	protein HokC	NA	A0A0U2QV81	Escherichia_phage	93.8	7.6e-25
AUO36528.1|4646687_4647734_+	hypothetical protein	NA	U5P0K4	Shigella_phage	54.5	1.1e-108
AUO36529.1|4647746_4648121_+	endodeoxyribonuclease RusA family protein	NA	V5URS4	Shigella_phage	61.8	5.4e-34
AUO36530.1|4648117_4648939_+	antitermination family protein	NA	K7P7B9	Enterobacteria_phage	60.8	7.6e-81
AUO36531.1|4649165_4649363_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
AUO36532.1|4649513_4650563_+	DNA methylase family protein	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	1.2e-198
AUO36533.1|4651748_4653605_+	hypothetical protein	NA	H6WZJ9	Escherichia_phage	89.6	0.0e+00
AUO36534.1|4653755_4653971_+|lysis	lysis S family protein	lysis	G9L6J5	Escherichia_phage	100.0	9.0e-34
AUO36535.1|4653975_4654320_+	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.4	7.2e-57
AUO36536.1|4654370_4654904_+	phage lysozyme family protein	NA	Q6H9V6	Enterobacteria_phage	96.0	7.4e-101
AUO36537.1|4655063_4655201_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	97.8	1.3e-17
AUO36538.1|4655202_4655670_+|lysis	bacteriophage lysis family protein	lysis	Q7AYI6	Enterobacteria_phage	77.9	7.0e-55
AUO36539.1|4656118_4656628_+	phage DNA packaging Nu1 family protein	NA	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AUO36540.1|4656599_4658528_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.4e-261
AUO36541.1|4658511_4658718_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	55.4	3.0e-10
AUO36542.1|4658714_4660307_+|portal	phage portal protein, lambda family	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
AUO36543.1|4660296_4661745_+	peptidase S49 family protein	NA	A0A2I6TC87	Escherichia_phage	53.1	2.2e-99
AUO36544.1|4661781_4662129_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
AUO36545.1|4662186_4663215_+|capsid	phage major capsid E family protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.4e-116
AUO36546.1|4663266_4663641_+	DNA packaging FI family protein	NA	NA	NA	NA	NA
AUO36547.1|4663633_4663987_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
AUO36548.1|4664002_4664536_+|tail	prophage minor tail Z family protein	tail	A0A2R9YJK4	Escherichia_phage	64.6	2.5e-56
AUO36549.1|4664532_4664928_+|tail	minor tail protein U	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AUO36550.1|4664935_4665685_+|tail	phage tail family protein	tail	Q687F6	Enterobacteria_phage	93.8	2.7e-125
AUO36551.1|4665703_4666135_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	7.4e-43
AUO36552.1|4666161_4666575_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	4.6e-42
AUO36553.1|4666555_4669117_+|tail	phage tail tape measure protein, lambda family	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
AUO36554.1|4669113_4669443_+|tail	phage minor tail family protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AUO36555.1|4669442_4670141_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.6	3.2e-128
AUO36556.1|4670151_4670895_+	nlpC/P60 family protein	NA	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
AUO36557.1|4670891_4671473_+|tail	bacteriophage lambda tail assembly I family protein	tail	H6WZM5	Escherichia_phage	96.9	4.0e-92
AUO36558.1|4671816_4675509_+	hypothetical protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.9	0.0e+00
AUO36559.1|4675576_4676176_+	outer membrane beta-barrel domain protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
AUO36560.1|4676327_4679354_+|tail	phage tail fiber repeat family protein	tail	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
AUO36561.1|4679353_4679938_+|tail	caudovirales tail fiber assembly family protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
AUO36562.1|4679992_4680649_-	methyltransferase small domain protein	NA	NA	NA	NA	NA
AUO36563.1|4680717_4680984_+|tail	caudovirales tail fiber assembly family protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
AUO36564.1|4681215_4682079_-	binding-protein-dependent transport system inner membrane component family protein	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AUO36565.1|4682062_4683199_-	spermidine/putrescine import ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
AUO36566.1|4683448_4684675_+	peptidase T	NA	NA	NA	NA	NA
AUO36567.1|4684723_4685845_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AUO36568.1|4685920_4687381_-	sensor protein PhoQ	NA	NA	NA	NA	NA
AUO36569.1|4687380_4688052_-	transcriptional regulatory protein PhoP	NA	NA	NA	NA	NA
AUO36570.1|4688221_4689592_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
AUO36571.1|4689595_4690237_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
AUO36572.1|4690272_4691379_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase	tRNA	NA	NA	NA	NA
AUO36573.1|4691432_4691894_-	phosphatase NudJ	NA	NA	NA	NA	NA
AUO36574.1|4691903_4692437_-	pseudouridine synthase family protein	NA	NA	NA	NA	NA
AUO36575.1|4692874_4693210_-	hypothetical protein	NA	NA	NA	NA	NA
AUO36576.1|4693209_4693659_-	putative membrane protein	NA	NA	NA	NA	NA
AUO36577.1|4693692_4693806_-	hypothetical protein	NA	NA	NA	NA	NA
AUO36578.1|4694241_4695492_+	isocitrate dehydrogenase, NADP-dependent	NA	Q77Z09	Phage_21	98.1	6.5e-23
AUO36579.1|4696485_4696761_+	insA N-terminal domain protein	NA	Q71TE9	Escherichia_phage	98.9	2.0e-46
AUO36580.1|4696805_4697183_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	100.0	1.3e-67
>prophage 11
CP025707	Escherichia coli strain YDC107 chromosome, complete genome	5198311	4916496	5023856	5198311	tail,tRNA,transposase,lysis,terminase,coat,integrase,holin	Escherichia_phage(47.46%)	108	4915947:4915963	4996393:4996409
4915947:4915963	attL	GTTTTTTGCGCTGATAA	NA	NA	NA	NA
AUO36783.1|4916496_4916790_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	92.8	8.3e-46
AUO36784.1|4916724_4917105_-	putative diguanylate cyclase with PAS/PAC sensor	NA	A0A2L1IV26	Escherichia_phage	96.3	5.8e-07
AUO36785.1|4917359_4918343_+	zinc transport protein ZntB	NA	NA	NA	NA	NA
AUO36786.1|4918617_4918791_+	hypothetical protein	NA	NA	NA	NA	NA
AUO36787.1|4918820_4920194_+	ATP-independent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AUO36788.1|4920322_4921258_-|tRNA	tRNA 2-thiocytidine biosynthesis protein TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AUO36789.1|4921309_4922545_-|integrase	phage integrase family protein	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
AUO36790.1|4922546_4922762_-	putative excisionase	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AUO36791.1|4922861_4923050_-	double-strand break reduction protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
AUO36792.1|4923292_4924102_-	protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
AUO36793.1|4924094_4926695_-	exodeoxyribonuclease 8	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
AUO36794.1|4926796_4927072_-	putative phage protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
AUO36795.1|4927146_4927317_-	prokaryotic metallothionein family protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AUO36796.1|4927316_4927538_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
AUO36797.1|4927856_4928468_+	superinfection exclusion B family protein	NA	NA	NA	NA	NA
AUO36798.1|4928464_4928620_-	hypothetical protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AUO36799.1|4929052_4929472_-	helix-turn-helix family protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
AUO36800.1|4929551_4929806_+	putative 8.4 kDa cro protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
AUO36801.1|4929802_4930225_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
AUO36802.1|4930302_4931091_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
AUO36803.1|4931097_4931844_+	istB-like ATP binding family protein	NA	V5UQI5	Shigella_phage	78.5	1.1e-110
AUO36804.1|4931866_4932628_+	feoC like transcriptional regulator family protein	NA	A0A0U2SAW4	Escherichia_phage	87.4	3.4e-115
AUO36805.1|4932643_4933066_+	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	7.4e-64
AUO36806.1|4933227_4933731_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	39.7	4.3e-18
AUO36807.1|4933851_4934625_-	kilA-N domain protein	NA	A0A1L2BWW1	Bacteriophage	42.6	9.6e-09
AUO36808.1|4935355_4935697_-	tellurite resistance protein B	NA	NA	NA	NA	NA
AUO36809.1|4936564_4937164_+	hypothetical protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
AUO36810.1|4937163_4937454_+	hypothetical protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
AUO36811.1|4937450_4937993_+	hypothetical protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
AUO36812.1|4938214_4938784_+	putative membrane protein	NA	NA	NA	NA	NA
AUO36813.1|4938752_4938914_-	hypothetical protein	NA	NA	NA	NA	NA
AUO36814.1|4939131_4939473_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.1	6.2e-53
AUO36815.1|4939476_4939953_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	95.6	5.0e-85
AUO36816.1|4939949_4940414_+|lysis	bacteriophage lysis family protein	lysis	A0A0K2FJD0	Enterobacteria_phage	93.4	4.0e-71
AUO36817.1|4940584_4942009_+	trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
AUO36818.1|4942146_4942938_+	parB-like nuclease domain protein	NA	R4TG31	Halovirus	40.2	2.8e-48
AUO36819.1|4942930_4943863_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.1e-83
AUO36820.1|4943840_4944050_+	hypothetical protein	NA	NA	NA	NA	NA
AUO36821.1|4944053_4945148_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	4.5e-113
AUO36822.1|4945173_4946430_+|terminase	terminase-like family protein	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	1.4e-142
AUO36823.1|4946432_4947839_+	hypothetical protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
AUO36824.1|4947822_4948935_+	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
AUO36825.1|4949039_4949804_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
AUO36826.1|4949902_4951042_+|coat	P22 coat protein	coat	G8C7P7	Escherichia_phage	75.0	9.7e-159
AUO36827.1|4951084_4951261_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
AUO36828.1|4951264_4951660_+	hypothetical protein	NA	NA	NA	NA	NA
AUO36829.1|4951659_4952043_+	putative glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
AUO36830.1|4952043_4952424_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
AUO36831.1|4952420_4952813_+	bacteriophage related domain of unknown function family protein	NA	NA	NA	NA	NA
AUO36832.1|4952839_4953802_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	8.4e-55
AUO36833.1|4953862_4954312_+	hypothetical protein	NA	NA	NA	NA	NA
AUO36834.1|4954783_4958017_+|tail	phage tail tape measure protein, lambda family	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.0	7.4e-103
AUO36835.1|4958051_4958342_+|tail	phage minor tail family protein	tail	A0A1B5FPI1	Escherichia_phage	40.6	5.0e-11
AUO36836.1|4958346_4959045_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
AUO36837.1|4959194_4959794_+	nlpC/P60 family protein	NA	A5LH41	Enterobacteria_phage	97.5	5.7e-118
AUO36838.1|4959790_4960333_+|tail	bacteriophage lambda tail assembly I family protein	tail	A0A291AWV5	Escherichia_phage	83.0	1.1e-75
AUO36839.1|4960393_4963873_+	fibronectin type III family protein	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
AUO36840.1|4963940_4964540_+	outer membrane beta-barrel domain protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
AUO36841.1|4964604_4966980_+	carboxypeptidase regulatory-like domain protein	NA	A0A1X7QGG5	Escherichia_phage	68.8	9.1e-167
AUO36842.1|4966979_4967261_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
AUO36843.1|4967270_4968311_+	chaperone of endosialidase family protein	NA	A0A0E3M4A9	Enterobacteria_phage	67.9	2.9e-125
AUO36844.1|4968353_4968647_+	hypothetical protein	NA	NA	NA	NA	NA
AUO36845.1|4969192_4969987_-	hypothetical protein	NA	NA	NA	NA	NA
AUO36846.1|4970459_4971317_-	ABC 3 transport family protein	NA	NA	NA	NA	NA
AUO36847.1|4971313_4972171_-	ABC 3 transport family protein	NA	NA	NA	NA	NA
AUO36848.1|4972167_4972995_-	ABC transporter family protein	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
AUO36849.1|4972994_4973909_-	periplasmic solute binding family protein	NA	NA	NA	NA	NA
AUO36850.1|4974493_4974928_-	hypothetical protein	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
AUO36851.1|4975068_4976202_-	outer membrane protein N	NA	Q1MVN1	Enterobacteria_phage	58.7	4.1e-117
AUO36852.1|4976568_4980093_-	ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
AUO36853.1|4980366_4980633_+	hypothetical protein	NA	NA	NA	NA	NA
AUO36854.1|4980629_4981052_-	heat shock protein HslJ	NA	NA	NA	NA	NA
AUO36855.1|4981162_4982152_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
AUO36856.1|4982359_4984999_+	dicarboxylate transport family protein	NA	NA	NA	NA	NA
AUO36857.1|4984995_4985181_+	ynbE-like lipofamily protein	NA	NA	NA	NA	NA
AUO36858.1|4985188_4985512_+	hypothetical protein	NA	NA	NA	NA	NA
AUO36859.1|4985913_4991994_+	putative entS/YbdA MFS transporter	NA	NA	NA	NA	NA
AUO36860.1|4992201_4993062_+	putative oxidoreductase YdbC	NA	NA	NA	NA	NA
AUO36861.1|4993125_4995432_+	hypothetical protein	NA	NA	NA	NA	NA
AUO36862.1|4995602_4996208_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
AUO36863.1|4996207_4996429_+	putative membrane protein	NA	NA	NA	NA	NA
4996393:4996409	attR	GTTTTTTGCGCTGATAA	NA	NA	NA	NA
AUO36864.1|4996636_4997104_+	cytidylyltransferase family protein	NA	NA	NA	NA	NA
AUO36865.1|4997119_4998877_+	methyltransferase domain protein	NA	NA	NA	NA	NA
AUO36866.1|4998914_5000183_+	protein-tyrosine phosphatase family protein	NA	NA	NA	NA	NA
AUO36867.1|5000236_5000842_-	NADPH-dependent FMN reductase family protein	NA	NA	NA	NA	NA
AUO36868.1|5001042_5004945_+	ATP-dependent helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
AUO36869.1|5005090_5005225_+	hypothetical protein	NA	NA	NA	NA	NA
AUO36870.1|5005229_5005568_+	hypothetical protein	NA	NA	NA	NA	NA
AUO36871.1|5005554_5006004_+	hypothetical protein	NA	NA	NA	NA	NA
AUO36872.1|5006123_5006501_+	hypothetical protein	NA	NA	NA	NA	NA
AUO36873.1|5006616_5007417_+	protein YdcF	NA	NA	NA	NA	NA
AUO36874.1|5007613_5009053_+	lactaldehyde dehydrogenase	NA	NA	NA	NA	NA
AUO36875.1|5009094_5010096_-	glyceraldehyde-3-phosphate dehydrogenase, type I	NA	NA	NA	NA	NA
AUO36876.1|5010284_5010815_+	prokaryotic cytochrome b561 family protein	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.0e-18
AUO36877.1|5011059_5011233_+	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	59.6	4.4e-07
AUO36878.1|5011344_5011512_-	putative regulatory protein MokB	NA	NA	NA	NA	NA
AUO36879.1|5011852_5013493_+	methyl-accepting chemotaxis protein III	NA	NA	NA	NA	NA
AUO36880.1|5013530_5014454_-	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AUO36881.1|5014670_5016014_+	hypothetical protein	NA	NA	NA	NA	NA
AUO36882.1|5016274_5017894_+	glucans biosynthesis protein D	NA	NA	NA	NA	NA
AUO36883.1|5018033_5018258_+	hypothetical protein	NA	NA	NA	NA	NA
AUO36884.1|5018320_5018860_+	ribosomal-protein-serine acetyltransferase	NA	NA	NA	NA	NA
AUO36885.1|5018851_5019832_-	bacterial transferase hexapeptide family protein	NA	NA	NA	NA	NA
AUO36886.1|5019955_5020948_+	tellurite resistance protein TehA	NA	NA	NA	NA	NA
AUO36887.1|5020944_5021538_+	tellurite resistance protein TehB	NA	NA	NA	NA	NA
AUO36888.1|5021840_5022509_+	hypothetical protein	NA	NA	NA	NA	NA
AUO36889.1|5022686_5023145_+|transposase	transposase IS200 like family protein	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
AUO36890.1|5023397_5023856_+|transposase	transposase IS200 like family protein	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
>prophage 12
CP025707	Escherichia coli strain YDC107 chromosome, complete genome	5198311	5174630	5198133	5198311	capsid,tail,head	Enterobacteria_phage(60.87%)	25	NA	NA
AUO37022.1|5174630_5176091_-	mannitol dehydrogenase Rossmann domain protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
AUO37023.1|5176179_5177463_-	H+ symporter family protein	NA	NA	NA	NA	NA
AUO37024.1|5178248_5178482_+	putative dNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AUO37025.1|5178798_5179389_+	putative DNA-invertase from lambdoid prophage Rac	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AUO37026.1|5179616_5179910_-	hypothetical protein	NA	NA	NA	NA	NA
AUO37027.1|5179920_5180625_-	chaperone of endosialidase family protein	NA	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
AUO37028.1|5180634_5180916_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
AUO37029.1|5180912_5183312_-	carboxypeptidase regulatory-like domain protein	NA	A0A0E3M194	Enterobacteria_phage	55.3	3.9e-133
AUO37030.1|5183376_5183976_-	outer membrane beta-barrel domain protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
AUO37031.1|5184043_5187523_-	fibronectin type III family protein	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
AUO37032.1|5187583_5188126_-|tail	bacteriophage lambda tail assembly I family protein	tail	A0A291AWV5	Escherichia_phage	83.0	1.1e-75
AUO37033.1|5188122_5188722_-	nlpC/P60 family protein	NA	A5LH41	Enterobacteria_phage	97.5	4.4e-118
AUO37034.1|5188871_5189570_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
AUO37035.1|5189569_5189899_-|tail	phage minor tail family protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AUO37036.1|5189895_5192457_-|tail	phage tail tape measure protein, lambda family	tail	A0A0K2FI43	Enterobacteria_phage	95.9	0.0e+00
AUO37037.1|5192449_5192884_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AUO37038.1|5192865_5193288_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
AUO37039.1|5193303_5194044_-|tail	major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
AUO37040.1|5194051_5194447_-|tail	minor tail protein U	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
AUO37041.1|5194443_5195022_-|tail	prophage minor tail Z family protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
AUO37042.1|5195033_5195387_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
AUO37043.1|5195398_5195797_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.3e-62
AUO37044.1|5195838_5196864_-|capsid	phage major capsid E family protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
AUO37045.1|5196918_5197251_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AUO37046.1|5197260_5198133_-	peptidase S49 family protein	NA	A0A2I6TC87	Escherichia_phage	97.2	1.1e-146
>prophage 1
CP025708	Escherichia coli strain YDC107 plasmid pYDC107_184, complete sequence	184098	1262	90988	184098	integrase,transposase,protease	Escherichia_phage(36.67%)	106	45225:45284	68060:68880
AUO37048.1|1262_2003_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
AUO37049.1|2521_2779_+	hypothetical protein	NA	NA	NA	NA	NA
AUO37050.1|2734_2917_-	ribbon-helix-helix, copG family protein	NA	NA	NA	NA	NA
AUO37051.1|3448_4618_+	putative membrane protein	NA	NA	NA	NA	NA
AUO37052.1|4813_5107_-	putative iPF_100	NA	NA	NA	NA	NA
AUO37053.1|5212_5488_-	plasmid stabilization system family protein	NA	NA	NA	NA	NA
AUO37054.1|5487_5766_-	ribbon-helix-helix, copG family protein	NA	NA	NA	NA	NA
AUO37055.1|6376_7129_+	hypothetical protein	NA	NA	NA	NA	NA
AUO37056.1|7174_8140_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
AUO37057.1|8172_8553_-	L-PSP putative endoribonuclease	NA	NA	NA	NA	NA
AUO37058.1|8577_9468_-	dihydrodipicolinate synthetase family protein	NA	NA	NA	NA	NA
AUO37059.1|10081_10309_+	putative oxidoreductase	NA	NA	NA	NA	NA
AUO37060.1|10451_11318_+	binding-protein-dependent transport system inner membrane component family protein	NA	NA	NA	NA	NA
AUO37061.1|11307_12195_+	binding-protein-dependent transport system inner membrane component family protein	NA	NA	NA	NA	NA
AUO37062.1|12205_13030_+	3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA	NA	NA	NA	NA	NA
AUO37063.1|13035_14109_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	33.7	2.6e-28
AUO37064.1|14101_15412_+	bacterial extracellular solute-binding family protein	NA	NA	NA	NA	NA
AUO37065.1|15470_15836_-|transposase	transposase Tn5 dimerization domain protein	transposase	NA	NA	NA	NA
AUO37066.1|15855_16029_-|transposase	tn3 transposase DDE domain protein	transposase	A0A125RQ78	Bacillus_phage	45.1	2.2e-06
AUO37067.1|16110_16497_-|integrase	integrase core domain protein	integrase	A0A0N7C1X7	Escherichia_phage	96.9	1.2e-65
AUO37068.1|16540_16999_-	HTH-like domain protein	NA	A0A0N7C035	Escherichia_phage	96.6	1.1e-76
AUO37069.1|17331_18036_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
AUO37070.1|18069_18624_-	histidine phosphatase super family protein	NA	NA	NA	NA	NA
AUO37071.1|18745_19231_-	winged helix-turn-helix DNA-binding family protein	NA	NA	NA	NA	NA
AUO37072.1|19255_19741_-	thioredoxin-like family protein	NA	NA	NA	NA	NA
AUO37073.1|19727_20423_-	ABC transporter family protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
AUO37074.1|20427_21540_-	macB-like periplasmic core domain protein	NA	NA	NA	NA	NA
AUO37075.1|21547_22831_-	macB-like periplasmic core domain protein	NA	NA	NA	NA	NA
AUO37076.1|22833_24213_-	hypothetical protein	NA	NA	NA	NA	NA
AUO37077.1|24316_24838_-	periplasmic protein involved in high-affinity Fe2+ transport	NA	NA	NA	NA	NA
AUO37078.1|24884_26801_-	iron permease FTR1 family protein	NA	NA	NA	NA	NA
AUO37079.1|27117_27879_-	ubiquinone oxidoreductase, Na(+)-translocating, C subunit	NA	NA	NA	NA	NA
AUO37080.1|28115_28622_-	thioredoxin-like family protein	NA	NA	NA	NA	NA
AUO37081.1|28611_28770_-	DSBA-like thioredoxin domain protein	NA	NA	NA	NA	NA
AUO37082.1|29265_29481_-	hypothetical protein	NA	NA	NA	NA	NA
AUO37083.1|29552_29930_+|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	95.2	3.9e-64
AUO37084.1|30394_31108_+|transposase	transposase DDE domain protein	transposase	Q9E8P4	Bluetongue_virus	99.6	8.0e-135
AUO37085.1|31117_31534_-	transposon Tn10 TetD protein	NA	NA	NA	NA	NA
AUO37086.1|31621_32215_+	transposon Tn10 TetC protein	NA	NA	NA	NA	NA
AUO37087.1|32327_33533_-	tetracycline resistance protein, class B	NA	NA	NA	NA	NA
AUO37088.1|33614_34238_+	tetracycline repressor protein class B from transposon Tn10	NA	NA	NA	NA	NA
AUO37089.1|34215_34902_-	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AUO37090.1|34909_35296_-	ACT domain protein	NA	NA	NA	NA	NA
AUO37091.1|35288_35462_-	putative antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AUO37092.1|35548_35926_-|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
AUO37093.1|35997_36213_+	hypothetical protein	NA	NA	NA	NA	NA
AUO37094.1|36764_37553_+	nucleotidyltransferase domain protein	NA	NA	NA	NA	NA
AUO37095.1|37758_38106_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
AUO37096.1|38099_38939_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUO37097.1|39066_39270_+	hypothetical protein	NA	NA	NA	NA	NA
AUO37098.1|39425_40631_+	chromate transporter, chromate ion transporter family protein	NA	NA	NA	NA	NA
AUO37099.1|40641_40947_+	winged helix DNA-binding domain protein	NA	NA	NA	NA	NA
AUO37100.1|41173_41938_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AUO37101.1|42430_43015_-	erythromycin resistance repressor protein	NA	NA	NA	NA	NA
AUO37102.1|43014_44253_-	Major Facilitator Superfamily protein	NA	NA	NA	NA	NA
AUO37103.1|44249_45155_-	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
45225:45284	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
AUO37104.1|45276_45981_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUO37105.1|46115_46211_+	23S rRNA methylase leader peptide family protein	NA	NA	NA	NA	NA
AUO37106.1|46336_47074_+	rRNA adenine N-6-methyltransferase	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
AUO37107.1|47078_47189_+	putative ermAM-like protein	NA	E4ZFP9	Streptococcus_phage	88.6	1.9e-08
AUO37108.1|47703_48153_+	hypothetical protein	NA	NA	NA	NA	NA
AUO37109.1|48113_48455_+	groEL domain protein	NA	NA	NA	NA	NA
AUO37110.1|48681_50214_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AUO37111.1|50536_51241_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUO37112.1|51277_52405_-	hypothetical protein	NA	NA	NA	NA	NA
AUO37113.1|52455_52683_-	putative membrane protein	NA	NA	NA	NA	NA
AUO37114.1|53379_53922_-	AAA domain protein	NA	NA	NA	NA	NA
AUO37115.1|53934_54795_-	aminoglycoside 3-N-acetyltransferase family protein	NA	NA	NA	NA	NA
AUO37116.1|55207_55912_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AUO37117.1|56018_56351_+	resolvase, N terminal domain protein	NA	Q1MVP4	Enterobacteria_phage	100.0	3.0e-52
AUO37118.1|56533_57394_+	beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AUO37119.1|57624_58461_-	aminoglycoside/hydroxyurea antibiotic resistance kinase family protein	NA	NA	NA	NA	NA
AUO37120.1|58460_59264_-	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
AUO37121.1|59324_60140_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AUO37122.1|60469_60646_+	hypothetical protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AUO37123.1|60827_61832_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AUO37124.1|61910_64877_-	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
AUO37125.1|64879_65134_-	resolvase, N terminal domain protein	NA	A0A1B0V7I5	Salmonella_phage	86.7	1.6e-29
AUO37126.1|65247_65952_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUO37127.1|66021_66495_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
AUO37128.1|66650_67664_+|integrase	integron integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUO37129.1|68111_68816_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUO37130.1|68866_70396_+|transposase	tn3 transposase DDE domain protein	transposase	A0A1B0V7H9	Salmonella_phage	100.0	1.4e-293
68060:68880	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCA	NA	NA	NA	NA
AUO37131.1|70610_72383_-	divergent AAA domain protein	NA	NA	NA	NA	NA
AUO37132.1|72667_73000_-	mRNA interferase PemK	NA	NA	NA	NA	NA
AUO37133.1|73001_73259_-	antitoxin PemI	NA	NA	NA	NA	NA
AUO37134.1|73351_74005_-|protease	CAAX protease self-immunity family protein	protease	NA	NA	NA	NA
AUO37135.1|74943_75801_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AUO37136.1|76103_76361_-	replication regulatory RepB family protein	NA	NA	NA	NA	NA
AUO37137.1|76765_77788_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AUO37138.1|78259_78613_+	putative membrane protein	NA	NA	NA	NA	NA
AUO37139.1|79025_79520_-	hypothetical protein	NA	NA	NA	NA	NA
AUO37140.1|79952_80330_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	99.2	6.4e-67
AUO37141.1|80812_81337_-	hypothetical protein	NA	NA	NA	NA	NA
AUO37142.1|81756_82233_-	arginine repressor, C-terminal domain protein	NA	NA	NA	NA	NA
AUO37143.1|82316_83720_-	C4-dicarboxylate anaerobic carrier family protein	NA	NA	NA	NA	NA
AUO37144.1|83767_84772_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AUO37145.1|84856_85768_-	carbamate kinase	NA	NA	NA	NA	NA
AUO37146.1|85778_86999_-	arginine deiminase	NA	NA	NA	NA	NA
AUO37147.1|87840_88086_+	pre-toxin domain with VENN motif family protein	NA	NA	NA	NA	NA
AUO37148.1|88313_88766_-	incFII RepA family protein	NA	NA	NA	NA	NA
AUO37149.1|89068_89326_-	replication regulatory RepB family protein	NA	NA	NA	NA	NA
AUO37150.1|89609_89759_-	hok/gef family protein	NA	NA	NA	NA	NA
AUO37151.1|89814_90057_+	hypothetical protein	NA	NA	NA	NA	NA
AUO37152.1|90002_90185_-	hypothetical protein	NA	NA	NA	NA	NA
AUO37153.1|90601_90988_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	97.7	4.3e-66
>prophage 2
CP025708	Escherichia coli strain YDC107 plasmid pYDC107_184, complete sequence	184098	129266	178379	184098	integrase,transposase	Shigella_phage(23.81%)	50	145991:146005	180161:180175
AUO37197.1|129266_129644_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	99.2	6.4e-67
AUO37198.1|130187_130367_-	hypothetical protein	NA	NA	NA	NA	NA
AUO37199.1|130366_131761_-	maltoporin periplasmic N-terminal extension family protein	NA	NA	NA	NA	NA
AUO37200.1|131955_133386_-	sucrose-6-phosphate hydrolase family protein	NA	F8WPR5	Bacillus_phage	24.5	1.2e-28
AUO37201.1|133385_134663_-	H+ symporter family protein	NA	NA	NA	NA	NA
AUO37202.1|134725_136852_-	alpha-galactosidase	NA	NA	NA	NA	NA
AUO37203.1|136947_137958_-	HTH-type transcriptional regulator RafR	NA	C6ZCU4	Enterobacteria_phage	27.1	6.2e-16
AUO37204.1|138115_138859_-|integrase	phage integrase family protein	integrase	Q7M297	Enterobacteria_phage	60.7	3.3e-83
AUO37205.1|138964_139330_+|transposase	transposase family protein	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
AUO37206.1|139353_140193_+	HTH-like domain protein	NA	Q9ZXG3	Shigella_phage	98.6	4.0e-162
AUO37207.1|140177_140747_+	caspase domain protein	NA	NA	NA	NA	NA
AUO37208.1|141271_141841_+	hypothetical protein	NA	NA	NA	NA	NA
AUO37209.1|141847_142102_-	putative membrane protein	NA	NA	NA	NA	NA
AUO37210.1|142127_142691_-	methyltransferase domain protein	NA	A8HNV9	Thalassomonas_phage	37.3	1.0e-20
AUO37211.1|142738_144100_-	hypothetical protein	NA	NA	NA	NA	NA
AUO37212.1|144151_144382_-	hypothetical protein	NA	NA	NA	NA	NA
AUO37213.1|145416_145608_-	hypothetical protein	NA	NA	NA	NA	NA
AUO37214.1|145604_146027_-	hypothetical protein	NA	NA	NA	NA	NA
145991:146005	attL	GCACTTCGCGGATAA	NA	NA	NA	NA
AUO37215.1|146073_146499_-	antirestriction family protein	NA	NA	NA	NA	NA
AUO37216.1|146915_147692_-	hypothetical protein	NA	NA	NA	NA	NA
AUO37217.1|147742_148177_-	hypothetical protein	NA	NA	NA	NA	NA
AUO37218.1|148190_148412_-	hypothetical protein	NA	NA	NA	NA	NA
AUO37219.1|148412_149096_-	DNA methylase family protein	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
AUO37220.1|149480_150407_-	hypothetical protein	NA	NA	NA	NA	NA
AUO37221.1|151249_152221_-	protein SopB	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
AUO37222.1|152220_153387_-	cobQ/CobB/MinD/ParA nucleotide binding domain protein	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
AUO37223.1|153974_154730_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
AUO37224.1|155503_156310_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
AUO37225.1|156310_156616_-	toxin CcdB	NA	NA	NA	NA	NA
AUO37226.1|156617_156836_-	antitoxin CcdA	NA	NA	NA	NA	NA
AUO37227.1|157469_157667_+	hypothetical protein	NA	NA	NA	NA	NA
AUO37228.1|157663_157948_-	putative korC protein	NA	NA	NA	NA	NA
AUO37229.1|157967_159101_-	hypothetical protein	NA	NA	NA	NA	NA
AUO37230.1|159363_162483_-	putative membrane protein	NA	NA	NA	NA	NA
AUO37231.1|162789_163020_+	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
AUO37232.1|163031_163433_+	PIN domain protein	NA	NA	NA	NA	NA
AUO37233.1|163594_165733_-	AAA domain protein	NA	NA	NA	NA	NA
AUO37234.1|166197_167193_+	hypothetical protein	NA	NA	NA	NA	NA
AUO37235.1|167235_168129_+	hypothetical protein	NA	NA	NA	NA	NA
AUO37236.1|168265_168769_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	98.8	4.1e-93
AUO37237.1|169176_172293_-	type I restriction enzyme EcoR124II R protein	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
AUO37238.1|172414_173659_-	type I restriction modification DNA specificity domain protein	NA	NA	NA	NA	NA
AUO37239.1|173655_175212_-	type I restriction-modification system, M subunit	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
AUO37240.1|175394_175616_+	antitoxin phd	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AUO37241.1|175615_175996_+	toxin doc	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
AUO37242.1|176000_176180_+	putative pdcA	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
AUO37243.1|176207_176567_+	putative pdcB	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
AUO37244.1|176529_176904_+|integrase	integrase core domain protein	integrase	Q716C2	Shigella_phage	94.3	5.4e-66
AUO37245.1|176853_177171_-	type I site-specific deoxyribonuclease, HsdR family domain protein	NA	NA	NA	NA	NA
AUO37246.1|177398_178379_-	hypothetical protein	NA	Q38213	Escherichia_phage	99.4	6.1e-186
180161:180175	attR	TTATCCGCGAAGTGC	NA	NA	NA	NA
>prophage 1
CP025710	Escherichia coli strain YDC107 plasmid pYDC107_70, complete sequence	70372	0	51496	70372	integrase,transposase	Enterobacteria_phage(28.57%)	59	15191:15250	50387:50996
AUO37347.1|0_720_+	initiator Replication family protein	NA	I3WF20	Macacine_betaherpesvirus	28.9	8.6e-20
AUO37348.1|764_2255_+	hypothetical protein	NA	NA	NA	NA	NA
AUO37349.1|2331_2574_-	hypothetical protein	NA	NA	NA	NA	NA
AUO37350.1|2527_2680_-	hypothetical protein	NA	NA	NA	NA	NA
AUO37351.1|2676_3246_-	resolvase, N terminal domain protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
AUO37352.1|3638_4652_-|integrase	integron integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUO37353.1|4807_5281_+	dihydrofolate reductase type 1	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
AUO37354.1|5501_5768_+	bacterial mobilization family protein	NA	NA	NA	NA	NA
AUO37355.1|5767_5878_+	hypothetical protein	NA	NA	NA	NA	NA
AUO37356.1|5910_6675_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AUO37357.1|6941_8150_+	type-2 restriction enzyme EcoRII	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AUO37358.1|8183_9617_-	DNA (cytosine-5-)-methyltransferase family protein	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AUO37359.1|9998_10205_-	hypothetical protein	NA	NA	NA	NA	NA
AUO37360.1|10209_10719_-	restriction endonuclease family protein	NA	NA	NA	NA	NA
AUO37361.1|10906_11218_-	hypothetical protein	NA	NA	NA	NA	NA
AUO37362.1|11253_11568_-	trbM family protein	NA	NA	NA	NA	NA
AUO37363.1|11564_11909_-	hypothetical protein	NA	NA	NA	NA	NA
AUO37364.1|11924_12230_-	H-NS histone family protein	NA	NA	NA	NA	NA
AUO37365.1|12338_13073_+	transglycosylase SLT domain protein	NA	NA	NA	NA	NA
AUO37366.1|13081_13363_+	putative korA	NA	NA	NA	NA	NA
AUO37367.1|13372_13666_+	putative membrane protein	NA	NA	NA	NA	NA
AUO37368.1|13715_14033_+	type IV secretory pathway, VirB3-like family protein	NA	NA	NA	NA	NA
AUO37369.1|14032_15142_+	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
15191:15250	attL	TTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTC	NA	NA	NA	NA
AUO37370.1|15209_15836_+	putative p12 protein	NA	NA	NA	NA	NA
AUO37371.1|15783_15981_-	bacterial regulatory, arsR family protein	NA	NA	NA	NA	NA
AUO37372.1|16208_16544_-	hypothetical protein	NA	NA	NA	NA	NA
AUO37373.1|16708_17242_-	endonuclease	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
AUO37374.1|17241_18237_-	type II/IV secretion system family protein	NA	NA	NA	NA	NA
AUO37375.1|18278_19439_-	traF protein	NA	NA	NA	NA	NA
AUO37376.1|19438_20323_-	traO protein	NA	NA	NA	NA	NA
AUO37377.1|20333_21032_-	virB8 family protein	NA	NA	NA	NA	NA
AUO37378.1|21250_22291_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
AUO37379.1|22306_22534_-	putative eex protein	NA	NA	NA	NA	NA
AUO37380.1|22541_23255_-	traC	NA	NA	NA	NA	NA
AUO37381.1|23272_24946_-	type IV secretion/conjugal transfer ATPase, VirB4 family protein	NA	NA	NA	NA	NA
AUO37382.1|24915_25524_-	putative p12 protein	NA	NA	NA	NA	NA
AUO37383.1|25740_27519_+|transposase	tn3 transposase DDE domain protein	transposase	A0A1B0V7H9	Salmonella_phage	79.2	1.9e-278
AUO37384.1|27597_28602_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AUO37385.1|28783_28960_-	hypothetical protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AUO37386.1|29289_30105_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AUO37387.1|30165_30969_+	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
AUO37388.1|31175_31805_+	aminoglycoside/hydroxyurea antibiotic resistance kinase family protein	NA	NA	NA	NA	NA
AUO37389.1|32525_33386_-	beta-lactamase TEM	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AUO37390.1|33568_33820_-	resolvase, N terminal domain protein	NA	Q1MVP4	Enterobacteria_phage	100.0	1.3e-36
AUO37391.1|34085_34910_-	beta-lactamase OXA-9 domain protein	NA	NA	NA	NA	NA
AUO37392.1|34969_35746_-	nucleotidyltransferase domain protein	NA	NA	NA	NA	NA
AUO37393.1|35827_36433_-	aminoglycoside N(6')-acetyltransferase type 1	NA	NA	NA	NA	NA
AUO37394.1|36615_37173_-	transposon Tn3 resolvase	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
AUO37395.1|37336_38245_+	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	100.0	3.0e-171
AUO37396.1|38287_39841_-|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
AUO37397.1|40112_43142_+	hypothetical protein	NA	NA	NA	NA	NA
AUO37398.1|43248_44274_+|integrase	integrase core domain protein	integrase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AUO37399.1|44270_45050_+	phoH-like family protein	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AUO37400.1|45046_45385_+	hypothetical protein	NA	NA	NA	NA	NA
AUO37401.1|45436_46318_+	carbapenem-hydrolyzing beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
AUO37402.1|46567_47887_-	hypothetical protein	NA	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AUO37403.1|48337_50353_+|transposase	tn3 transposase DDE domain protein	transposase	Q1MVP5	Enterobacteria_phage	99.9	0.0e+00
AUO37404.1|50405_51032_+|transposase	putative transposase	transposase	NA	NA	NA	NA
50387:50996	attR	TTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
AUO37405.1|51067_51496_+|transposase	tn3 transposase DDE domain protein	transposase	Q1MVP5	Enterobacteria_phage	77.0	3.4e-56
>prophage 1
CP025712	Escherichia phage YDC107_1 chromosome, complete genome	46701	310	46299	46701	portal,head,lysis,tail,terminase,capsid,protease	Escherichia_phage(100.0%)	67	NA	NA
AUO37478.1|310_1804_-|tail	phage tail family protein	tail	A0A2I6TCW5	Escherichia_phage	100.0	5.3e-298
AUO37479.1|1864_2536_-|tail	bacteriophage lambda tail assembly I family protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	8.1e-105
AUO37480.1|3170_3983_+	hypothetical protein	NA	A0A2I6TC81	Escherichia_phage	100.0	2.5e-153
AUO37481.1|3880_4210_-|tail	phage minor tail family protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
AUO37482.1|4206_6786_-|tail	phage tail tape measure protein, lambda family	tail	A0A2R9YJM8	Escherichia_phage	100.0	0.0e+00
AUO37483.1|6778_7060_-|tail	phage tail assembly protein T	tail	A0A2R9YJK0	Escherichia_phage	100.0	1.0e-32
AUO37484.1|7623_8364_-|tail	major tail protein V	tail	A0A2I6TC77	Escherichia_phage	100.0	3.5e-133
AUO37485.1|8371_8767_-|tail	minor tail protein U	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
AUO37486.1|8763_9342_-|tail	prophage minor tail Z family protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
AUO37487.1|9353_9707_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
AUO37488.1|9718_10117_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	100.0	9.1e-64
AUO37489.1|10158_11178_-|capsid	phage major capsid E family protein	capsid	A0A2I6TCE5	Escherichia_phage	100.0	2.7e-192
AUO37490.1|11239_11572_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
AUO37491.1|11581_12901_-|protease	clp protease family protein	protease	A0A2I6TC87	Escherichia_phage	100.0	9.3e-238
AUO37492.1|12881_14381_-|portal	phage portal protein, lambda family	portal	A0A2I6TC89	Escherichia_phage	100.0	2.8e-291
AUO37493.1|14479_14686_-|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AUO37494.1|14682_16170_-|terminase	phage terminase large subunit family protein	terminase	A0A2I6TC92	Escherichia_phage	100.0	2.1e-302
AUO37495.1|16188_16662_+	hypothetical protein	NA	A0A2I6TC88	Escherichia_phage	100.0	3.2e-92
AUO37496.1|16582_17050_-|terminase	terminase small subunit	terminase	A0A2I6TC94	Escherichia_phage	100.0	1.1e-79
AUO37497.1|17679_18276_-	hypothetical protein	NA	A0A2I6TCU3	Escherichia_phage	100.0	7.2e-105
AUO37498.1|18556_18868_-	hypothetical protein	NA	A0A2I6TCY5	Escherichia_phage	100.0	4.2e-56
AUO37499.1|18909_19377_-|lysis	bacteriophage lysis family protein	lysis	A0A2I6TCF9	Escherichia_phage	100.0	7.7e-78
AUO37500.1|19373_19871_-	lysozyme RrrD	NA	A0A2I6TCA1	Escherichia_phage	100.0	5.8e-92
AUO37501.1|20238_21315_-	DNA methylase family protein	NA	A0A2I6TC96	Escherichia_phage	100.0	1.0e-194
AUO37502.1|21582_21810_-	putative gp51	NA	A0A2I6TC98	Escherichia_phage	100.0	2.3e-35
AUO37503.1|21823_22045_-	putative gp50	NA	A0A2I6TCC3	Escherichia_phage	100.0	9.9e-36
AUO37504.1|22210_22522_+	hypothetical protein	NA	A0A2I6TCA4	Escherichia_phage	100.0	1.4e-51
AUO37505.1|22521_22809_+	helix-turn-helix family protein	NA	A0A2I6TC97	Escherichia_phage	100.0	8.9e-45
AUO37506.1|22851_23055_-	putative gp47	NA	A0A2I6TCA2	Escherichia_phage	100.0	5.4e-28
AUO37507.1|23137_23380_-	putative gp47	NA	A0A2I6TCV0	Escherichia_phage	100.0	1.5e-37
AUO37508.1|23398_23725_-	putative gp46	NA	A0A2I6TCZ1	Escherichia_phage	100.0	2.6e-56
AUO37509.1|23740_24400_-	pmgU domain protein	NA	A0A2I6TCG8	Escherichia_phage	100.0	1.9e-106
AUO37510.1|24396_24687_-	hypothetical protein	NA	A0A2I6TCB0	Escherichia_phage	100.0	1.1e-47
AUO37511.1|24686_25106_-	hypothetical protein	NA	A0A2I6TCA7	Escherichia_phage	100.0	8.7e-73
AUO37512.1|25105_25705_-	putative exonuclease	NA	A0A2I6TCA6	Escherichia_phage	100.0	4.1e-116
AUO37513.1|25728_25956_-	putative orf QD1	NA	A0A2I6TCC8	Escherichia_phage	100.0	1.5e-39
AUO37514.1|25912_26215_-	putative orf QD1	NA	A0A2I6TCB2	Escherichia_phage	100.0	2.0e-55
AUO37515.1|26165_26876_-	phage antitermination Q family protein	NA	A0A2I6TCB3	Escherichia_phage	100.0	8.8e-134
AUO37516.1|26865_27114_-	gp39 domain protein	NA	A0A2I6TCB1	Escherichia_phage	100.0	8.3e-39
AUO37517.1|27178_27775_+	helix-turn-helix domain protein	NA	A0A2I6TCW0	Escherichia_phage	100.0	2.8e-109
AUO37518.1|28020_32004_+	origin of replication binding family protein	NA	A0A2I6TD01	Escherichia_phage	100.0	0.0e+00
AUO37519.1|32015_32288_+	putative gp36	NA	A0A2I6TCJ7	Escherichia_phage	100.0	2.0e-46
AUO37520.1|32290_32686_+	hypothetical protein	NA	A0A2I6TCB8	Escherichia_phage	100.0	1.2e-71
AUO37521.1|32704_32929_+	putative gp31	NA	A0A2I6TCC0	Escherichia_phage	100.0	7.0e-37
AUO37522.1|33014_33230_+	hypothetical protein	NA	A0A2I6TCC1	Escherichia_phage	100.0	1.5e-36
AUO37523.1|33273_33474_+	putative secondary immunity repressor	NA	A0A2I6TCE0	Escherichia_phage	100.0	4.5e-27
AUO37524.1|33470_33704_+	putative gp31	NA	A0A2I6TCC2	Escherichia_phage	100.0	1.7e-33
AUO37525.1|33700_34477_+	BRO family, N-terminal domain protein	NA	A0A2I6TCD0	Escherichia_phage	100.0	4.4e-147
AUO37526.1|34493_34676_+	hypothetical protein	NA	A0A2I6TCC6	Escherichia_phage	100.0	6.3e-28
AUO37527.1|34649_36551_-	protelomerase	NA	A0A2I6TCW8	Escherichia_phage	100.0	0.0e+00
AUO37528.1|36933_37143_+	protelomerase domain protein	NA	A0A2I6TD05	Escherichia_phage	100.0	7.0e-31
AUO37529.1|37139_37430_+	protelomerase domain protein	NA	A0A2I6TCJ0	Escherichia_phage	100.0	3.7e-46
AUO37530.1|37492_38833_+	protelomerase	NA	A0A2I6TCD1	Escherichia_phage	100.0	9.4e-238
AUO37531.1|38806_38989_-	hypothetical protein	NA	A0A2I6TCC6	Escherichia_phage	100.0	6.3e-28
AUO37532.1|39005_39782_-	BRO family, N-terminal domain protein	NA	A0A2I6TCD0	Escherichia_phage	100.0	4.4e-147
AUO37533.1|39778_40012_-	putative gp31	NA	A0A2I6TCC2	Escherichia_phage	100.0	1.7e-33
AUO37534.1|40008_40209_-	putative secondary immunity repressor	NA	A0A2I6TCE0	Escherichia_phage	100.0	4.5e-27
AUO37535.1|40252_40468_-	hypothetical protein	NA	A0A2I6TCC1	Escherichia_phage	100.0	1.5e-36
AUO37536.1|40553_40778_-	putative gp31	NA	A0A2I6TCC0	Escherichia_phage	100.0	7.0e-37
AUO37537.1|40796_41018_-	hypothetical protein	NA	A0A2I6TCX4	Escherichia_phage	100.0	3.6e-38
AUO37538.1|40981_41191_-	hypothetical protein	NA	A0A2I6TD15	Escherichia_phage	100.0	1.1e-31
AUO37539.1|41193_41466_-	putative gp36	NA	A0A2I6TCJ7	Escherichia_phage	100.0	2.0e-46
AUO37540.1|41477_41876_-	gp37 domain protein	NA	A0A2I6TD01	Escherichia_phage	100.0	6.8e-67
AUO37541.1|41836_44566_-	origin of replication binding family protein	NA	A0A2I6TCD3	Escherichia_phage	100.0	0.0e+00
AUO37542.1|44660_45458_-	replication origin binding domain protein	NA	A0A2I6TCE3	Escherichia_phage	100.0	7.8e-131
AUO37543.1|45703_45979_-	putative repressor protein	NA	A0A2I6TCF5	Escherichia_phage	100.0	2.3e-45
AUO37544.1|45966_46299_-	helix-turn-helix domain protein	NA	A0A2I6TCE4	Escherichia_phage	100.0	2.1e-53
>prophage 1
CP025713	Escherichia phage YDC107_2 chromosome, complete genome	18617	6	18578	18617	integrase,tail	Escherichia_phage(95.45%)	44	6206:6220	14043:14057
AUO37545.1|6_819_+	hypothetical protein	NA	A0A2I6TCD4	Escherichia_phage	100.0	1.8e-154
AUO37546.1|793_1291_+	hypothetical protein	NA	A0A2I6TCD7	Escherichia_phage	100.0	1.2e-89
AUO37547.1|1274_1460_+	17 domain protein	NA	A0A2I6TCY4	Escherichia_phage	100.0	2.0e-29
AUO37548.1|1444_1756_+	17 domain protein	NA	A0A2I6TD24	Escherichia_phage	100.0	3.9e-54
AUO37549.1|1932_2229_+	putative membrane protein	NA	A0A2R9YJP3	Escherichia_phage	100.0	2.5e-50
AUO37550.1|2179_2281_+	hypothetical protein	NA	A0A2I6TCE9	Escherichia_phage	100.0	4.5e-12
AUO37551.1|2361_2517_-	hypothetical protein	NA	A0A2I6TCE1	Escherichia_phage	100.0	1.6e-24
AUO37552.1|2710_2860_+	hypothetical protein	NA	A0A2I6TCF2	Escherichia_phage	100.0	3.6e-21
AUO37553.1|2846_3428_+|tail	putative phage tail-fibre protein	tail	A0A2I6TCG5	Escherichia_phage	100.0	2.4e-105
AUO37554.1|3627_4032_-	hypothetical protein	NA	A0A2I6TCF4	Escherichia_phage	100.0	2.1e-68
AUO37555.1|4229_4385_-	hypothetical protein	NA	A0A2I6TCE2	Escherichia_phage	100.0	6.1e-24
AUO37556.1|4385_4484_-	hypothetical protein	NA	A0A2I6TCE6	Escherichia_phage	100.0	1.2e-09
AUO37557.1|4497_5685_+	hypothetical protein	NA	A0A2I6TCZ8	Escherichia_phage	100.0	4.6e-236
AUO37558.1|5921_6074_-	hypothetical protein	NA	A0A2I6TD30	Escherichia_phage	100.0	2.3e-23
AUO37559.1|6090_6495_+	putative membrane protein	NA	G9L6E6	Escherichia_phage	97.0	2.7e-63
6206:6220	attL	TGATTTTTGTTACCT	NA	NA	NA	NA
AUO37560.1|6481_6790_+	hypothetical protein	NA	G9L6E7	Escherichia_phage	91.2	8.7e-46
AUO37561.1|6779_7409_+	chitinase class I family protein	NA	G9L6E8	Escherichia_phage	96.2	1.2e-113
AUO37562.1|7405_7888_+	hypothetical protein	NA	A0A2R9YJI7	Escherichia_phage	100.0	5.5e-79
AUO37563.1|8049_8157_+	putative membrane protein	NA	A0A2I6TCH3	Escherichia_phage	100.0	1.3e-12
AUO37564.1|8177_8273_+	hypothetical protein	NA	A0A2I6TCG3	Escherichia_phage	100.0	1.2e-09
AUO37565.1|8289_9456_+|integrase	phage integrase family protein	integrase	A0A2I6TCF0	Escherichia_phage	100.0	6.8e-224
AUO37566.1|9459_9654_-	hypothetical protein	NA	A0A0F6R7M7	Escherichia_coli_O157_typing_phage	96.9	2.2e-26
AUO37567.1|9650_10301_-	MT-A70 family protein	NA	A0A2R9YJG0	Escherichia_phage	100.0	5.0e-128
AUO37568.1|10293_10593_-	perC transcriptional activator family protein	NA	A0A2R9YJK3	Escherichia_phage	100.0	4.3e-50
AUO37569.1|10589_10706_-	putative membrane protein	NA	A0A2I6TCL8	Escherichia_phage	100.0	3.9e-15
AUO37570.1|10702_10951_-	prophage CP4-57 regulatory family protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
AUO37571.1|11000_11942_-	recT family protein	NA	A0A2R9YJJ1	Escherichia_phage	100.0	4.5e-178
AUO37572.1|11938_12760_-	hypothetical protein	NA	A0A2R9YJH7	Escherichia_phage	100.0	1.2e-163
AUO37573.1|12756_13020_-	hypothetical protein	NA	A0A2I6TCI1	Escherichia_phage	100.0	2.1e-40
AUO37574.1|13025_13244_+	hypothetical protein	NA	A0A2I6TCH2	Escherichia_phage	100.0	2.4e-34
AUO37575.1|13362_13593_-	putative transcriptional repressor domain protein	NA	A0A2I6TCG1	Escherichia_phage	100.0	3.9e-35
AUO37576.1|13607_13808_+	hypothetical protein	NA	A0A2I6TCG4	Escherichia_phage	100.0	9.3e-33
AUO37577.1|14256_14403_+	hypothetical protein	NA	A0A2I6TD04	Escherichia_phage	100.0	1.8e-22
14043:14057	attR	TGATTTTTGTTACCT	NA	NA	NA	NA
AUO37578.1|14580_14763_-	hypothetical protein	NA	A0A2I6TD44	Escherichia_phage	100.0	5.3e-27
AUO37579.1|14895_15138_-	putative membrane protein	NA	A0A2I6TCM7	Escherichia_phage	100.0	1.2e-37
AUO37580.1|15171_15681_+	putative primosomal domain protein	NA	A0A2I6TCH5	Escherichia_phage	100.0	5.9e-100
AUO37581.1|15674_16067_+	replication P family protein	NA	A0A2I6TCG7	Escherichia_phage	100.0	2.0e-71
AUO37582.1|16032_16254_+	putative replication protein	NA	A0A2I6TCH8	Escherichia_phage	100.0	1.5e-36
AUO37583.1|16417_16567_+	hypothetical protein	NA	A0A2I6TCI8	Escherichia_phage	100.0	3.3e-19
AUO37584.1|16559_16796_-	hypothetical protein	NA	A0A2I6TCI0	Escherichia_phage	100.0	2.2e-41
AUO37585.1|16824_17274_+	hypothetical protein	NA	A0A2I6TCH0	Escherichia_phage	100.0	2.2e-74
AUO37586.1|17270_17378_+	hypothetical protein	NA	A0A2I6TCH7	Escherichia_phage	100.0	4.3e-13
AUO37587.1|17419_17584_+	hypothetical protein	NA	A0A2I6TD13	Escherichia_phage	100.0	2.5e-23
AUO37588.1|17570_18578_+	ead/Ea22-like family protein	NA	A0A2I6TD51	Escherichia_phage	100.0	2.6e-192
