The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	0	14929	4456672		Geobacillus_virus(33.33%)	11	NA	NA
AVD30069.1|2855_6224_-	RecBCD enzyme subunit RecC	NA	NA	NA	NA	NA
AVD30070.1|6236_6560_-	prepilin peptidase-dependent protein C	NA	NA	NA	NA	NA
AVD30071.1|6544_6952_-	hypothetical protein	NA	NA	NA	NA	NA
AVD30072.1|6948_7512_-	prepilin peptidase-dependent protein B	NA	NA	NA	NA	NA
AVD30073.1|7502_7973_-	prepilin peptidase-dependent protein A	NA	NA	NA	NA	NA
AVD30074.1|8156_8951_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
AVD30075.1|8957_9833_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AVD30076.1|9983_12230_-	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
AVD30077.1|12242_12773_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AVD30078.1|13457_14147_+	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
AVD30079.1|14215_14929_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 2
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	24559	27054	4456672		Aichi_virus(50.0%)	2	NA	NA
AVD30088.1|24559_25978_-	arabinose-proton symporter	NA	O13311	Aichi_virus	26.9	1.8e-24
AVD30089.1|26292_27054_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 3
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	40167	41441	4456672	transposase	Shigella_phage(100.0%)	1	NA	NA
AVD30106.1|40167_41441_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 4
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	68145	83538	4456672	tRNA	environmental_Halophage(14.29%)	14	NA	NA
AVD30125.1|68145_69546_+	xanthine permease XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
AVD30126.1|69560_70880_+	guanine deaminase	NA	NA	NA	NA	NA
AVD30127.1|70915_72283_+	guanine/hypoxanthine permease GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
AVD30128.1|72318_72807_-	oxidoreductase	NA	NA	NA	NA	NA
AVD30129.1|72806_74726_-	oxidoreductase (Fe-S)-binding subunit	NA	NA	NA	NA	NA
AVD30130.1|75028_75115_+	purine permease YgfU	NA	NA	NA	NA	NA
AVD30131.1|75161_76610_+	uric acid transporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
AVD30132.1|76611_76737_+	hypothetical protein	NA	NA	NA	NA	NA
AVD30133.1|76859_77408_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AVD30134.1|77451_78969_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
AVD30135.1|78978_80077_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
AVD30136.1|80167_81901_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.9e-60
AVD30137.1|81906_82617_-	thiol:disulfide interchange protein DsbC	NA	NA	NA	NA	NA
AVD30138.1|82641_83538_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 5
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	87456	92836	4456672		Pandoravirus(50.0%)	3	NA	NA
AVD30145.1|87456_88896_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.3	2.0e-31
AVD30146.1|88952_89696_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVD30147.1|89962_92836_-	glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.2e-263
>prophage 6
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	100972	102205	4456672		Catovirus(100.0%)	1	NA	NA
AVD30157.1|100972_102205_-	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 7
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	130500	131655	4456672		Staphylococcus_phage(100.0%)	1	NA	NA
AVD30185.1|130500_131655_+	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 8
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	173972	174989	4456672	transposase	Escherichia_phage(100.0%)	1	NA	NA
AVD30226.1|173972_174989_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
>prophage 9
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	193456	194341	4456672		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AVD30247.1|193456_194341_+	NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 10
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	200417	209768	4456672		Staphylococcus_phage(33.33%)	7	NA	NA
AVD30255.1|200417_201245_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	44.9	6.1e-62
AVD30256.1|201444_202371_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AVD30257.1|202421_202679_+	hypothetical protein	NA	NA	NA	NA	NA
AVD30258.1|202721_204941_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
AVD30259.1|205051_206464_-	cell division protein FtsP	NA	NA	NA	NA	NA
AVD30260.1|206538_207276_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AVD30261.1|207509_209768_-	DNA topoisomerase 4 subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
>prophage 11
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	213078	213471	4456672		Stx_converting_phage(100.0%)	1	NA	NA
AVD30267.1|213078_213471_-	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 12
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	217298	231209	4456672	transposase	Bacillus_virus(16.67%)	16	NA	NA
AVD30273.1|217298_219191_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
AVD30274.1|219219_219801_-	esterase YqiA	NA	NA	NA	NA	NA
AVD30275.1|219800_220628_-	phosphodiesterase	NA	NA	NA	NA	NA
AVD30276.1|220652_221075_-	dehydrogenase	NA	NA	NA	NA	NA
AVD30277.1|221075_221705_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
AVD30278.1|221909_223391_+	outer membrane protein TolC	NA	NA	NA	NA	NA
AVD30279.1|223390_223651_+	hypothetical protein	NA	NA	NA	NA	NA
AVD30280.1|223538_224210_+	DUF1190 domain-containing protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
AVD30281.1|224215_225376_+	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
AVD30282.1|225413_226202_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
AVD30283.1|226344_227118_+	zinc transporter ZupT	NA	NA	NA	NA	NA
AVD30284.1|227175_227346_-	DUF4051 domain-containing protein	NA	NA	NA	NA	NA
AVD30285.1|227607_228261_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
AVD30286.1|228574_228925_+	hypothetical protein	NA	NA	NA	NA	NA
AVD30287.1|229208_229760_+	fimbrial protein	NA	NA	NA	NA	NA
AVD30288.1|229936_231209_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 13
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	239114	240548	4456672		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVD30296.1|239114_240548_-	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 14
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	245685	246924	4456672	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
AVD30300.1|245685_246924_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 15
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	253323	269519	4456672	tRNA	Moraxella_phage(16.67%)	16	NA	NA
AVD30307.1|253323_254337_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
AVD30308.1|254345_254576_-	hypothetical protein	NA	NA	NA	NA	NA
AVD30309.1|254574_254790_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVD30310.1|254900_256646_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
AVD30311.1|256659_256782_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AVD30312.1|256840_258682_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	1.1e-34
AVD30313.1|258760_259267_-	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AVD30314.1|259520_260285_-	siderophore-interacting protein	NA	NA	NA	NA	NA
AVD30315.1|260572_261196_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AVD30316.1|261349_262870_-	aerotaxis receptor	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
AVD30317.1|263145_263352_+	hypothetical protein	NA	NA	NA	NA	NA
AVD30318.1|263287_264667_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.0e-33
AVD30319.1|264708_265041_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
AVD30320.1|265147_265330_+	hypothetical protein	NA	NA	NA	NA	NA
AVD30321.1|265259_266243_+	transcriptional regulator	NA	NA	NA	NA	NA
AVD30322.1|266426_269519_+	evolved beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	2.5e-156
>prophage 16
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	282373	283339	4456672		Escherichia_phage(100.0%)	1	NA	NA
AVD30334.1|282373_283339_+	hypothetical protein	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 17
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	303916	306211	4456672		Tetraselmis_virus(100.0%)	1	NA	NA
AVD30356.1|303916_306211_-	PFL-like enzyme TdcE	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 18
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	314417	315563	4456672		Streptococcus_phage(100.0%)	1	NA	NA
AVD30364.1|314417_315563_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 19
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	336267	344061	4456672		Streptococcus_phage(25.0%)	10	NA	NA
AVD30383.1|336267_337128_-	rRNA (cytidine-2'-O-)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
AVD30384.1|337192_339229_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
AVD30385.1|339186_339582_+	YraN family protein	NA	NA	NA	NA	NA
AVD30386.1|339601_340192_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
AVD30387.1|340201_340777_+	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AVD30388.1|340890_341931_-	permease	NA	NA	NA	NA	NA
AVD30389.1|342003_342639_-	hypothetical protein	NA	NA	NA	NA	NA
AVD30390.1|342766_343285_+	glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
AVD30391.1|343264_343708_-	hypothetical protein	NA	NA	NA	NA	NA
AVD30392.1|343758_344061_+	GIY-YIG nuclease family protein	NA	F2NZ06	Diadromus_pulchellus_ascovirus	53.8	7.8e-15
>prophage 20
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	349763	351653	4456672		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVD30399.1|349763_351653_-	DEAD/DEAH box family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 21
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	357134	363773	4456672		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
AVD30406.1|357134_359807_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
AVD30407.1|359831_361319_-	transcription termination protein NusA	NA	NA	NA	NA	NA
AVD34175.1|361346_361799_-	ribosome maturation factor	NA	NA	NA	NA	NA
AVD30408.1|362429_363773_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 22
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	367855	370728	4456672	protease	Pandoravirus(50.0%)	2	NA	NA
AVD30412.1|367855_368704_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
AVD30413.1|368793_370728_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 23
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	377502	378980	4456672		Indivirus(50.0%)	2	NA	NA
AVD30422.1|377502_378474_+	octaprenyl-diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
AVD30423.1|378701_378980_+	sugar fermentation stimulation protein B	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 24
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	383047	391761	4456672		Bacillus_virus(16.67%)	11	NA	NA
AVD30427.1|383047_383857_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
AVD30428.1|384066_385044_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
AVD30429.1|385057_386044_+	arabinose 5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
AVD30430.1|386064_386631_+	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
AVD30431.1|386627_387203_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AVD30432.1|387171_387729_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AVD30433.1|387735_388461_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
AVD30434.1|388508_389942_+	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AVD30435.1|389964_390252_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
AVD30436.1|390369_390861_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AVD30437.1|390906_391761_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
>prophage 25
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	395256	398618	4456672		Hokovirus(50.0%)	2	NA	NA
AVD30442.1|395256_397593_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
AVD34178.1|397688_398618_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 26
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	410269	417142	4456672	transposase	Escherichia_phage(33.33%)	8	NA	NA
AVD30450.1|410269_411286_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AVD30451.1|411248_411497_+	hypothetical protein	NA	NA	NA	NA	NA
AVD30452.1|411493_412210_+	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
AVD30453.1|412394_413522_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
AVD30454.1|413581_414046_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
AVD30455.1|414042_414918_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
AVD30456.1|414914_415604_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
AVD30457.1|415651_417142_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.6	6.4e-09
>prophage 27
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	420846	421344	4456672		Pseudomonas_phage(100.0%)	1	NA	NA
AVD30461.1|420846_421344_-	stringent starvation protein B	NA	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 28
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	425310	427835	4456672	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AVD30468.1|425310_426678_+|protease	periplasmic pH-dependent serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
AVD30469.1|426767_427835_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 29
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	444611	445655	4456672		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVD30484.1|444611_445655_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 30
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	456220	457105	4456672		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVD30496.1|456220_457105_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.9e-24
>prophage 31
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	463716	467762	4456672		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AVD30505.1|463716_464634_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.4	3.7e-68
AVD30506.1|464701_465883_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVD30507.1|465892_466996_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVD30508.1|467003_467762_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
>prophage 32
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	474588	475751	4456672	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
AVD30511.1|474588_475751_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 33
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	479518	480990	4456672	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
AVD30517.1|479518_480028_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
AVD30518.1|480042_480990_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 34
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	502205	504158	4456672		Vibrio_phage(100.0%)	1	NA	NA
AVD34180.1|502205_504158_+	type II secretion system protein GspD	NA	R9TEZ5	Vibrio_phage	30.9	9.2e-32
>prophage 35
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	512988	521547	4456672		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
AVD30567.1|512988_515682_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	8.7e-41
AVD30568.1|515973_517158_-	translation elongation factor EF-Tu 1	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
AVD30569.1|517228_519343_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
AVD30570.1|519370_519910_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
AVD30571.1|520006_520381_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
AVD30572.1|520506_520794_-	sulfurtransferase TusB	NA	NA	NA	NA	NA
AVD30573.1|520801_521161_-	sulfurtransferase TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
AVD30574.1|521160_521547_-	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
>prophage 36
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	527117	536658	4456672		Tupanvirus(25.0%)	10	NA	NA
AVD30583.1|527117_529031_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
AVD30584.1|529030_530053_+	hydrolase	NA	NA	NA	NA	NA
AVD30585.1|530046_530265_+	hypothetical protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
AVD30586.1|530318_531188_+	phosphoribulokinase	NA	NA	NA	NA	NA
AVD30587.1|531242_531647_-	OsmC family protein	NA	NA	NA	NA	NA
AVD30588.1|531726_531942_+	hypothetical protein	NA	NA	NA	NA	NA
AVD30589.1|531948_532581_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AVD30590.1|532619_534722_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
AVD30591.1|534788_536009_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AVD30592.1|536094_536658_-	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 37
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	560905	561742	4456672		Vibrio_phage(100.0%)	1	NA	NA
AVD30619.1|560905_561742_-	DNA adenine methylase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 38
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	578646	582413	4456672		Bacillus_phage(66.67%)	3	NA	NA
AVD30634.1|578646_580269_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
AVD30635.1|580344_581697_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
AVD30636.1|581693_582413_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 39
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	588995	589874	4456672	transposase	Sodalis_phage(100.0%)	1	NA	NA
AVD30642.1|588995_589874_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 40
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	595908	598302	4456672		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AVD30648.1|595908_598302_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 41
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	602681	603908	4456672		Ralstonia_phage(100.0%)	1	NA	NA
AVD30651.1|602681_603908_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	4.0e-134
>prophage 42
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	609963	612411	4456672		Dickeya_phage(100.0%)	1	NA	NA
AVD30658.1|609963_612411_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 43
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	633199	635010	4456672		Enterococcus_phage(50.0%)	2	NA	NA
AVD30676.1|633199_633943_-	glycerophosphoryl diester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.9	9.9e-11
AVD30677.1|633939_635010_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 44
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	638553	640036	4456672		Planktothrix_phage(50.0%)	2	NA	NA
AVD30681.1|638553_639267_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	7.0e-14
AVD30682.1|639268_640036_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 45
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	645758	648577	4456672		Salicola_phage(50.0%)	3	NA	NA
AVD30688.1|645758_646613_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
AVD30689.1|646857_647916_-	ABC transporter permease	NA	NA	NA	NA	NA
AVD30690.1|647908_648577_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 46
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	651580	655712	4456672		Dickeya_phage(50.0%)	4	NA	NA
AVD30695.1|651580_652207_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
AVD30696.1|652280_654479_+	cadmium-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	38.4	8.5e-119
AVD30697.1|654580_654826_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
AVD30698.1|655046_655712_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
>prophage 47
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	663605	669257	4456672		Bacillus_virus(50.0%)	3	NA	NA
AVD30707.1|663605_664412_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-17
AVD30708.1|664417_664819_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
AVD30709.1|665021_669257_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	7.3e-26
>prophage 48
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	672632	675368	4456672		Staphylococcus_phage(100.0%)	1	NA	NA
AVD30714.1|672632_675368_-	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
>prophage 49
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	688969	691012	4456672		Indivirus(100.0%)	1	NA	NA
AVD30725.1|688969_691012_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	8.9e-46
>prophage 50
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	694357	701732	4456672	transposase	uncultured_Caudovirales_phage(60.0%)	10	NA	NA
AVD30730.1|694357_694711_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
AVD30731.1|694764_696054_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
AVD30732.1|696066_696492_+	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
AVD30733.1|697120_697903_+	hypothetical protein	NA	NA	NA	NA	NA
AVD30734.1|698011_699028_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AVD30735.1|699036_699543_+	hypothetical protein	NA	NA	NA	NA	NA
AVD30736.1|699790_700357_+	outer membrane protein slp	NA	NA	NA	NA	NA
AVD30737.1|700397_700574_+	dctR protein	NA	NA	NA	NA	NA
AVD30738.1|700512_701043_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AVD34186.1|701084_701732_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 51
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	747693	749678	4456672		Bacillus_virus(50.0%)	2	NA	NA
AVD30773.1|747693_748698_-	dipeptide transport ATP-binding protein DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
AVD30774.1|748694_749678_-	dipeptide transport ATP-binding protein DppD	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 52
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	759890	762224	4456672		Escherichia_phage(100.0%)	1	NA	NA
AVD30785.1|759890_762224_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	2.7e-70
>prophage 53
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	765878	767878	4456672	transposase	Morganella_phage(50.0%)	3	NA	NA
AVD30790.1|765878_766091_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
AVD30791.1|766277_766430_-	protein HokA	NA	NA	NA	NA	NA
AVD30792.1|766509_767878_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
>prophage 54
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	771716	772712	4456672		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AVD30796.1|771716_772712_+	O-acetyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 55
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	778029	779571	4456672		Staphylococcus_phage(100.0%)	1	NA	NA
AVD30802.1|778029_779571_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	3.3e-16
>prophage 56
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	803845	805690	4456672		Tupanvirus(100.0%)	1	NA	NA
AVD30826.1|803845_805690_-	selenocysteine-specific translation factor	NA	A0A2K9KZ60	Tupanvirus	26.7	5.6e-15
>prophage 57
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	811950	812967	4456672	transposase	Escherichia_phage(100.0%)	1	NA	NA
AVD30829.1|811950_812967_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
>prophage 58
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	833772	844501	4456672		Rhizobium_phage(16.67%)	10	NA	NA
AVD30850.1|833772_834024_-	glutaredoxin	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
AVD30851.1|834165_834597_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AVD30852.1|834841_836386_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVD30853.1|836395_837679_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
AVD30854.1|837682_838642_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AVD30855.1|838628_839663_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
AVD30856.1|839901_840927_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
AVD30857.1|840936_842133_-	2-amino-3-ketobutyrate CoA ligase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
AVD30858.1|842407_843265_-	protein HtrL	NA	NA	NA	NA	NA
AVD30859.1|843568_844501_+	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
>prophage 59
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	859406	863969	4456672		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
AVD30874.1|859406_859886_+	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
AVD30875.1|859924_860734_-	formamidopyrimidine-DNA glycosylase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
AVD30876.1|860831_860999_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AVD30877.1|861019_861256_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AVD30878.1|861472_862141_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AVD30879.1|862312_863533_+	bifunctional phosphopantothenoylcysteine decarboxylase CoaC/phosphopantothenate--cysteine ligase CoaB	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
AVD34189.1|863513_863969_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	Q2NP83	Xanthomonas_phage	59.5	1.2e-48
>prophage 60
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	867342	874091	4456672		Morganella_phage(25.0%)	6	NA	NA
AVD30885.1|867342_868167_+	DNA-damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	78.9	1.0e-96
AVD30886.1|868456_869074_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
AVD30887.1|869070_870753_-	DNA ligase B	NA	F8SJM3	Pseudomonas_phage	22.3	1.5e-22
AVD30888.1|871010_871634_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
AVD30889.1|871688_871964_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AVD30890.1|871982_874091_+	bifunctional (p)ppGpp synthetase II/ guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 61
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	878527	879919	4456672		environmental_Halophage(100.0%)	1	NA	NA
AVD30894.1|878527_879919_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 62
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	892037	893372	4456672		Moraxella_phage(100.0%)	1	NA	NA
AVD34191.1|892037_893372_-	adenine permease PurP	NA	A0A0R6PHV4	Moraxella_phage	37.2	1.5e-65
>prophage 63
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	900678	909699	4456672		Micromonas_sp._RCC1109_virus(25.0%)	14	NA	NA
AVD30912.1|900678_902367_-	acetolactate synthase isozyme 1 large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	3.2e-57
AVD30913.1|902472_902571_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AVD30914.1|902557_902848_+	hypothetical protein	NA	NA	NA	NA	NA
AVD30915.1|902844_903003_+	hypothetical protein	NA	NA	NA	NA	NA
AVD30916.1|903025_903139_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
AVD30917.1|903135_903225_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AVD30918.1|903282_903465_+	hypothetical protein	NA	NA	NA	NA	NA
AVD30919.1|903504_904689_+	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
AVD30920.1|904696_905194_-	radical SAM protein	NA	NA	NA	NA	NA
AVD30921.1|905190_905553_-	hypothetical protein	NA	NA	NA	NA	NA
AVD30922.1|905542_905890_-	hypothetical protein	NA	NA	NA	NA	NA
AVD30923.1|905997_906447_+	hypothetical protein	NA	NA	NA	NA	NA
AVD30924.1|906493_907987_-	hypothetical protein	NA	A0A2K9L1A5	Tupanvirus	25.6	2.3e-30
AVD30925.1|907983_909699_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 64
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	916051	917005	4456672		Synechococcus_phage(50.0%)	2	NA	NA
AVD30929.1|916051_916480_-	heat-shock protein IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
AVD30930.1|916591_917005_-	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 65
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	921432	922581	4456672		Oenococcus_phage(100.0%)	1	NA	NA
AVD30934.1|921432_922581_-	D-galactonate dehydratase 2	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 66
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	927287	934656	4456672		Bacillus_virus(33.33%)	8	NA	NA
AVD30940.1|927287_929702_-	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
AVD30941.1|929730_930804_-	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
AVD30942.1|930803_931904_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
AVD30943.1|931908_933312_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AVD30944.1|933605_933806_-	hypothetical protein	NA	NA	NA	NA	NA
AVD30945.1|933918_934059_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
AVD30946.1|934075_934435_+	ribonuclease P protein component	NA	NA	NA	NA	NA
AVD30947.1|934398_934656_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 67
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	945631	949930	4456672	transposase	Moraxella_phage(50.0%)	4	NA	NA
AVD30955.1|945631_946969_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
AVD30956.1|947133_947799_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
AVD30957.1|947865_948333_+	protein CbrB	NA	NA	NA	NA	NA
AVD30958.1|948657_949930_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 68
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	959288	966896	4456672		Bacillus_phage(25.0%)	6	NA	NA
AVD30967.1|959288_960062_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
AVD30968.1|960244_961135_-	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AVD30969.1|961134_962094_-	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AVD30970.1|962180_963221_-	phosphate-binding protein	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
AVD30971.1|963534_965364_-	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
AVD30972.1|965525_966896_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 69
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	978850	979843	4456672		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AVD30986.1|978850_979843_+	asparagine synthetase A	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 70
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	983011	988864	4456672		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
AVD30989.1|983011_984880_+	low affinity potassium transport system protein kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
AVD34195.1|985046_985466_+	D-ribose pyranase	NA	NA	NA	NA	NA
AVD30990.1|985473_986979_+	ribose import ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
AVD30991.1|986983_987949_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
AVD30992.1|987973_988864_+	D-ribose ABC transporter substrate-binding protein	NA	C6ZCU4	Enterobacteria_phage	23.4	2.5e-05
>prophage 71
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1012372	1017786	4456672		Bacillus_phage(33.33%)	5	NA	NA
AVD31007.1|1012372_1014394_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.2e-113
AVD31008.1|1014440_1015925_-	guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase	NA	NA	NA	NA	NA
AVD31009.1|1015930_1016053_-	addiction module toxin RelE	NA	NA	NA	NA	NA
AVD31010.1|1016060_1017326_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
AVD31011.1|1017456_1017786_+	thiol reductase thioredoxin	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 72
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1021828	1027972	4456672		Enterobacteria_phage(40.0%)	6	NA	NA
AVD31017.1|1021828_1022959_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.9e-27
AVD31018.1|1022955_1024218_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
AVD31019.1|1024217_1025285_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	2.3e-101
AVD31020.1|1025303_1026185_+	glucose-1-phosphate thymidylyltransferase 2	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
AVD31021.1|1026162_1026837_+	dTDP-fucosamine acetyltransferase	NA	NA	NA	NA	NA
AVD31022.1|1026841_1027972_+	dTDP-4-amino-4,6-dideoxygalactose aminotransferase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 73
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1036046	1037702	4456672		Tetraselmis_virus(100.0%)	1	NA	NA
AVD31029.1|1036046_1037702_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	2.3e-44
>prophage 74
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1047981	1051840	4456672		Bacillus_phage(100.0%)	3	NA	NA
AVD31039.1|1047981_1048878_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
AVD31040.1|1048877_1049594_+	flavin mononucleotide phosphatase YigB	NA	NA	NA	NA	NA
AVD31041.1|1049677_1051840_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 75
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1057557	1059387	4456672		Catovirus(100.0%)	1	NA	NA
AVD34199.1|1057557_1059387_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 76
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1071919	1075206	4456672		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
AVD31061.1|1071919_1073560_+	ubiquinone biosynthesis protein UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
AVD31062.1|1073638_1073908_+	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
AVD31063.1|1073911_1074427_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AVD31064.1|1074429_1075206_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 77
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1084185	1084800	4456672		Streptococcus_phage(100.0%)	1	NA	NA
AVD31072.1|1084185_1084800_+	IMPACT family member YigZ	NA	A0A1X9I5T8	Streptococcus_phage	33.0	2.8e-19
>prophage 78
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1098659	1101446	4456672		uncultured_virus(100.0%)	1	NA	NA
AVD31083.1|1098659_1101446_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 79
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1105562	1108033	4456672		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
AVD34200.1|1105562_1106972_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
AVD31088.1|1106983_1108033_-	two-component system sensor histidine kinase NtrB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 80
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1124368	1127148	4456672		Staphylococcus_phage(50.0%)	3	NA	NA
AVD31101.1|1124368_1125265_-	3-sulfolactaldehyde reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
AVD31102.1|1125432_1126329_+	ribokinase	NA	NA	NA	NA	NA
AVD31103.1|1126362_1127148_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 81
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1134465	1137516	4456672		Escherichia_phage(100.0%)	1	NA	NA
AVD31112.1|1134465_1137516_-	formate dehydrogenase O subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 82
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1152503	1157364	4456672		Bacillus_thuringiensis_phage(33.33%)	6	NA	NA
AVD31127.1|1152503_1153124_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
AVD31128.1|1153298_1153406_+	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AVD31129.1|1153383_1154367_+	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AVD31130.1|1154515_1155190_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AVD31131.1|1155295_1156669_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
AVD31132.1|1156665_1157364_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 83
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1168938	1173441	4456672		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
AVD31145.1|1168938_1169784_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
AVD31146.1|1170208_1170454_+	cell division protein ZapB	NA	NA	NA	NA	NA
AVD31147.1|1170538_1171024_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AVD31148.1|1171116_1172043_-	prenyltransferase	NA	NA	NA	NA	NA
AVD31149.1|1172109_1173441_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 84
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1190739	1197986	4456672		Synechococcus_phage(33.33%)	5	NA	NA
AVD31164.1|1190739_1191402_-	fructose-6-phosphate aldolase 2	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
AVD31165.1|1191413_1193915_-	multiphosphoryl transfer protein 2	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
AVD31166.1|1194223_1195303_+	fructose-like permease IIC component 2	NA	NA	NA	NA	NA
AVD31167.1|1195317_1195638_+	fructose-like phosphotransferase enzyme IIB component 2	NA	NA	NA	NA	NA
AVD31168.1|1195688_1197986_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 85
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1215332	1217177	4456672		Acinetobacter_phage(100.0%)	1	NA	NA
AVD31184.1|1215332_1217177_+	vitamin B12 transporter BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 86
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1225769	1228822	4456672		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AVD31188.1|1225769_1226720_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
AVD31189.1|1226702_1226897_+	hypothetical protein	NA	NA	NA	NA	NA
AVD31190.1|1226906_1227062_-	hypothetical protein	NA	NA	NA	NA	NA
AVD31191.1|1227637_1228822_+	translation elongation factor EF-Tu 2	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 87
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1232938	1241267	4456672		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
AVD31198.1|1232938_1236967_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
AVD31199.1|1237043_1241267_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 88
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1250483	1252247	4456672		Klosneuvirus(50.0%)	3	NA	NA
AVD31210.1|1250483_1251155_+	endonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
AVD31211.1|1251197_1251788_+	DUF416 domain-containing protein	NA	NA	NA	NA	NA
AVD31212.1|1251974_1252247_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 89
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1257636	1259226	4456672		Prochlorococcus_phage(100.0%)	1	NA	NA
AVD31218.1|1257636_1259226_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.9e-68
>prophage 90
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1275520	1279204	4456672		Dickeya_phage(100.0%)	1	NA	NA
AVD31227.1|1275520_1279204_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 91
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1298476	1299592	4456672		Mycoplasma_phage(100.0%)	1	NA	NA
AVD31246.1|1298476_1299592_+	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 92
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1308807	1309416	4456672		Lactococcus_phage(100.0%)	1	NA	NA
AVD31256.1|1308807_1309416_+	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 93
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1316006	1318554	4456672		Escherichia_phage(50.0%)	2	NA	NA
AVD31264.1|1316006_1317422_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
AVD31265.1|1317474_1318554_+	alanine racemase biosynthetic	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 94
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1322741	1326354	4456672		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AVD31271.1|1322741_1325564_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
AVD31272.1|1325817_1326354_+	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 95
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1330171	1331521	4456672		Moraxella_phage(100.0%)	1	NA	NA
AVD31281.1|1330171_1331521_+	guanine/hypoxanthine permease GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 96
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1337105	1339064	4456672		Staphylococcus_phage(100.0%)	1	NA	NA
AVD31286.1|1337105_1339064_-	acetyl-coenzyme A synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 97
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1348800	1350948	4456672		Escherichia_phage(100.0%)	1	NA	NA
AVD31298.1|1348800_1350948_-	formate dehydrogenase N subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 98
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1356193	1362562	4456672		Tetraselmis_virus(50.0%)	5	NA	NA
AVD31303.1|1356193_1358179_-	MBL fold hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	4.2e-149
AVD31304.1|1358451_1359381_-	allose kinase	NA	NA	NA	NA	NA
AVD31305.1|1359364_1360060_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
AVD31306.1|1360070_1361051_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
AVD31307.1|1361029_1362562_-	D-allose import ATP-binding protein AlsA	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	4.8e-20
>prophage 99
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1368796	1370346	4456672		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
AVD31316.1|1368796_1369477_-	alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
AVD31317.1|1369587_1370346_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
>prophage 100
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1375958	1376747	4456672		Cedratvirus(100.0%)	1	NA	NA
AVD31324.1|1375958_1376747_-	phosphonates import ATP-binding protein PhnC	NA	A0A285PWH2	Cedratvirus	30.1	6.5e-13
>prophage 101
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1382083	1383586	4456672		Burkholderia_virus(100.0%)	1	NA	NA
AVD31328.1|1382083_1383586_+	proline/betaine transporter	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 102
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1404781	1407993	4456672	tRNA	Catovirus(50.0%)	2	NA	NA
AVD31347.1|1404781_1406299_-|tRNA	lysine--tRNA ligase heat inducible	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
AVD31348.1|1406535_1407993_-	dipeptide and tripeptide permease C	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
>prophage 103
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1422269	1424253	4456672		Cronobacter_phage(50.0%)	2	NA	NA
AVD31360.1|1422269_1422563_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
AVD31361.1|1422606_1424253_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 104
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1428770	1429304	4456672		Morganella_phage(100.0%)	1	NA	NA
AVD31369.1|1428770_1429304_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 105
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1434224	1435202	4456672		Tupanvirus(100.0%)	1	NA	NA
AVD31375.1|1434224_1435202_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 106
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1443185	1443731	4456672		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVD31382.1|1443185_1443731_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 107
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1447646	1460677	4456672	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
AVD31386.1|1447646_1448984_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
AVD31387.1|1448993_1450841_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
AVD31388.1|1450833_1451784_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AVD31389.1|1451869_1452178_+	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AVD31390.1|1452253_1453534_+	GTPase HflX	NA	NA	NA	NA	NA
AVD31391.1|1453619_1454879_+|protease	protease modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
AVD31392.1|1454881_1455886_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
AVD31393.1|1455967_1456165_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
AVD31394.1|1456268_1457567_+	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
AVD31395.1|1457771_1458197_+	transcriptional regulator	NA	NA	NA	NA	NA
AVD31396.1|1458235_1460677_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
>prophage 108
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1464609	1465773	4456672		Ralstonia_phage(100.0%)	1	NA	NA
AVD31403.1|1464609_1465773_+	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	43.5	6.4e-81
>prophage 109
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1500703	1507191	4456672		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
AVD31443.1|1500703_1501234_-	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
AVD31444.1|1501543_1502500_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVD31445.1|1502639_1504142_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
AVD31446.1|1504152_1505178_+	ABC transporter permease	NA	NA	NA	NA	NA
AVD31447.1|1505164_1506160_+	ABC transporter permease	NA	NA	NA	NA	NA
AVD31448.1|1506192_1507191_-	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 110
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1511481	1514242	4456672		Cronobacter_phage(50.0%)	2	NA	NA
AVD31453.1|1511481_1511946_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
AVD31454.1|1512103_1514242_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 111
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1519206	1523977	4456672		Paramecium_bursaria_Chlorella_virus(100.0%)	4	NA	NA
AVD31458.1|1519206_1521903_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
AVD31459.1|1522108_1522495_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AVD31460.1|1522567_1523029_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AVD31461.1|1523041_1523977_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 112
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1532563	1541644	4456672	tRNA	Klosneuvirus(33.33%)	6	NA	NA
AVD31473.1|1532563_1535419_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
AVD31474.1|1535418_1535862_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AVD31475.1|1536021_1537533_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AVD31476.1|1537799_1538900_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AVD31477.1|1538899_1539982_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AVD31478.1|1539964_1541644_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.2	5.2e-84
>prophage 113
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1546770	1551080	4456672	integrase,transposase	Acanthamoeba_polyphaga_mimivirus(33.33%)	4	1536971:1536984	1557099:1557112
1536971:1536984	attL	TTTGCTGCTTTAAT	NA	NA	NA	NA
AVD31484.1|1546770_1547790_-	aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.1e-44
AVD31485.1|1548107_1548302_+	hypothetical protein	NA	NA	NA	NA	NA
AVD34214.1|1548330_1549521_+|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.3	3.2e-72
AVD31486.1|1549807_1551080_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
1557099:1557112	attR	ATTAAAGCAGCAAA	NA	NA	NA	NA
>prophage 114
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1559046	1563995	4456672	transposase	Staphylococcus_phage(33.33%)	5	NA	NA
AVD31494.1|1559046_1560198_-|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AVD31495.1|1560154_1560523_-	hypothetical protein	NA	NA	NA	NA	NA
AVD31496.1|1561300_1561714_+	hypothetical protein	NA	NA	NA	NA	NA
AVD31497.1|1562270_1563038_-	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AVD31498.1|1563038_1563995_-	Fe3+ dicitrate ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	8.2e-18
>prophage 115
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1588194	1589175	4456672		Stx2-converting_phage(100.0%)	1	NA	NA
AVD34216.1|1588194_1589175_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.6	4.7e-101
>prophage 116
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1592537	1594214	4456672		Escherichia_phage(100.0%)	2	NA	NA
AVD31525.1|1592537_1593140_+	type 1 fimbriae regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
AVD31526.1|1593617_1594214_+	type 1 fimbriae regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 117
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1604481	1605942	4456672		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVD31537.1|1604481_1605942_+	D-mannonate oxidoreductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	4.7e-49
>prophage 118
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1612510	1613065	4456672		Clostridioides_phage(100.0%)	1	NA	NA
AVD31547.1|1612510_1613065_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 119
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1620578	1621499	4456672	transposase	Sodalis_phage(100.0%)	2	NA	NA
AVD31555.1|1620578_1620890_+	hypothetical protein	NA	Q2A0A7	Sodalis_phage	52.6	6.3e-20
AVD31556.1|1620938_1621499_+|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	50.0	6.7e-28
>prophage 120
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1643237	1648593	4456672		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
AVD31571.1|1643237_1644893_+	methyl-accepting chemotaxis protein I	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
AVD31572.1|1644941_1646303_-	L-galactonate transporter	NA	NA	NA	NA	NA
AVD31573.1|1646517_1647432_-	transcriptional regulator	NA	NA	NA	NA	NA
AVD31574.1|1647570_1648593_+	L-galactonate-5-dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 121
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1651818	1653098	4456672		Shigella_phage(50.0%)	2	NA	NA
AVD31576.1|1651818_1652556_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
AVD31577.1|1652558_1653098_-	primosomal protein 1	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 122
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1660991	1663867	4456672		Streptococcus_phage(50.0%)	3	NA	NA
AVD31588.1|1660991_1662581_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
AVD31589.1|1662973_1663579_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
AVD31590.1|1663687_1663867_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
>prophage 123
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1669806	1671129	4456672		Geobacillus_virus(100.0%)	1	NA	NA
AVD31596.1|1669806_1671129_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.4e-79
>prophage 124
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1678892	1684248	4456672		Enterococcus_phage(33.33%)	4	NA	NA
AVD31604.1|1678892_1680125_+	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	3.6e-82
AVD31605.1|1680432_1682100_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
AVD34222.1|1682073_1682202_+	methionine aminopeptidase	NA	NA	NA	NA	NA
AVD31606.1|1682310_1684248_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 125
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1687584	1689698	4456672		Bacillus_phage(50.0%)	2	NA	NA
AVD31611.1|1687584_1688274_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.8	3.3e-29
AVD31612.1|1688273_1689698_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	1.2e-09
>prophage 126
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1701467	1711884	4456672		Cyanophage(20.0%)	9	NA	NA
AVD31623.1|1701467_1702421_+	transaldolase 1	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
AVD31624.1|1702535_1703123_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
AVD31625.1|1703157_1703724_-	succinate-acetate/proton symporter SatP	NA	NA	NA	NA	NA
AVD31626.1|1703872_1704586_-	hypothetical protein	NA	NA	NA	NA	NA
AVD31627.1|1704611_1705016_-	hypothetical protein	NA	NA	NA	NA	NA
AVD31628.1|1705392_1707309_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
AVD31629.1|1707397_1708528_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	37.1	1.4e-27
AVD31630.1|1709979_1710189_-	regulatory protein MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
AVD31631.1|1710717_1711884_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.5	3.4e-90
>prophage 127
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1715619	1718436	4456672	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVD31636.1|1715619_1718436_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 128
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1722879	1724028	4456672		Halovirus(100.0%)	1	NA	NA
AVD31642.1|1722879_1724028_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 129
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1729499	1735160	4456672		Hepacivirus(50.0%)	4	NA	NA
AVD31648.1|1729499_1731053_-	ATP-dependent acyl-CoA ligase	NA	Q75ZG1	Hepacivirus	25.6	2.1e-31
AVD31649.1|1731126_1732344_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
AVD31650.1|1732472_1733615_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVD31651.1|1733645_1735160_-	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 130
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1743051	1744451	4456672		Bacillus_phage(50.0%)	2	NA	NA
AVD31659.1|1743051_1743531_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
AVD31660.1|1743608_1744451_-	diadenosine tetraphosphatase	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 131
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1753586	1759009	4456672		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AVD31669.1|1753586_1756493_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
AVD31670.1|1756657_1759009_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
>prophage 132
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1765457	1766156	4456672		Planktothrix_phage(100.0%)	1	NA	NA
AVD31675.1|1765457_1766156_-	thiamine import ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	3.6e-23
>prophage 133
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1778858	1780583	4456672		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVD31687.1|1778858_1780583_+	acetolactate synthase isozyme 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.4e-36
>prophage 134
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1807448	1808492	4456672		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVD31713.1|1807448_1808492_+	guanosine monophosphate reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 135
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1812737	1813289	4456672		Sphingobium_phage(100.0%)	1	NA	NA
AVD31718.1|1812737_1813289_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 136
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1821916	1823341	4456672		Erysipelothrix_phage(100.0%)	1	NA	NA
AVD34227.1|1821916_1823341_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 137
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1831087	1837710	4456672		Mamastrovirus(33.33%)	5	NA	NA
AVD31732.1|1831087_1832638_+	multicopper oxidase	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
AVD31733.1|1832839_1835230_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
AVD31734.1|1835435_1835972_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
AVD31735.1|1836012_1836675_-	carbonic anhydrase	NA	NA	NA	NA	NA
AVD31736.1|1836783_1837710_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 138
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1840972	1841875	4456672	transposase	Sodalis_phage(100.0%)	1	NA	NA
AVD31742.1|1840972_1841875_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	49.2	7.4e-61
>prophage 139
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1851733	1858539	4456672	tRNA	unidentified_phage(50.0%)	6	NA	NA
AVD31753.1|1851733_1853152_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
AVD31754.1|1853190_1854117_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AVD31755.1|1854153_1854609_-	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AVD31756.1|1854786_1855491_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AVD31757.1|1855505_1856036_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AVD31758.1|1856109_1858539_+	ATP-dependent RNA helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.1	1.3e-38
>prophage 140
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1863782	1864580	4456672		Planktothrix_phage(100.0%)	1	NA	NA
AVD31762.1|1863782_1864580_+	iron(3+)-hydroxamate import ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	2.7e-14
>prophage 141
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1870614	1870959	4456672		Lake_Baikal_phage(100.0%)	1	NA	NA
AVD31767.1|1870614_1870959_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 142
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1874888	1876313	4456672	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVD31772.1|1874888_1876313_+|protease	periplasmic serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 143
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1888910	1889669	4456672		Flavobacterium_phage(100.0%)	1	NA	NA
AVD31786.1|1888910_1889669_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 144
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1898497	1902613	4456672		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
AVD31795.1|1898497_1899094_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
AVD31796.1|1899130_1902613_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
>prophage 145
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1915618	1916650	4456672		Planktothrix_phage(100.0%)	1	NA	NA
AVD31811.1|1915618_1916650_-	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
>prophage 146
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1923171	1930803	4456672		Indivirus(25.0%)	9	NA	NA
AVD31813.1|1923171_1923975_+	2,5-diketo-D-gluconic acid reductase B	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
AVD31814.1|1923971_1924886_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVD31815.1|1925126_1925927_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AVD31816.1|1925930_1926554_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVD31817.1|1926601_1927960_-	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AVD31818.1|1928031_1928787_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AVD31819.1|1928820_1929543_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVD31820.1|1929539_1930007_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AVD34230.1|1930071_1930803_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
>prophage 147
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1937547	1941466	4456672		Caulobacter_phage(50.0%)	6	NA	NA
AVD31827.1|1937547_1938126_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
AVD31828.1|1938331_1939099_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AVD31829.1|1939069_1939810_-	transpeptidase	NA	NA	NA	NA	NA
AVD31830.1|1939965_1940244_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
AVD31831.1|1940246_1940507_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
AVD31832.1|1940716_1941466_+	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
>prophage 148
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1951651	1953612	4456672		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
AVD31843.1|1951651_1952602_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
AVD31844.1|1952598_1953612_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 149
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1957192	1961309	4456672	transposase	Prochlorococcus_phage(50.0%)	5	NA	NA
AVD31848.1|1957192_1958302_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	8.9e-32
AVD31849.1|1958336_1958612_-	transcriptional regulator	NA	NA	NA	NA	NA
AVD31850.1|1958799_1959573_-	hypothetical protein	NA	NA	NA	NA	NA
AVD31851.1|1959574_1960018_-	transferase	NA	NA	NA	NA	NA
AVD31852.1|1960036_1961309_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 150
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1964937	1965705	4456672		Planktothrix_phage(100.0%)	1	NA	NA
AVD31857.1|1964937_1965705_+	taurine import ATP-binding protein TauB	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
>prophage 151
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1970469	1975018	4456672	transposase	Acinetobacter_phage(50.0%)	3	NA	NA
AVD31863.1|1970469_1971632_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AVD31864.1|1973236_1973860_+	hydrogen peroxide resistance inhibitor IprA	NA	NA	NA	NA	NA
AVD31865.1|1973860_1975018_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 152
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1982433	1983549	4456672		Bacillus_phage(100.0%)	1	NA	NA
AVD31877.1|1982433_1983549_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 153
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	1987838	1997915	4456672		Bacillus_phage(60.0%)	7	NA	NA
AVD34233.1|1987838_1988750_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
AVD31886.1|1988874_1989783_+	fructokinase	NA	NA	NA	NA	NA
AVD34234.1|1990027_1991212_-	MFS transporter	NA	NA	NA	NA	NA
AVD31887.1|1991337_1994484_-	nuclease SbcCD subunit C	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
AVD31888.1|1994480_1995683_-	exonuclease sbcCD subunit D	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
AVD31889.1|1995872_1996562_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
AVD31890.1|1996619_1997915_+	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
>prophage 154
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2004867	2013848	4456672	tRNA	uncultured_Mediterranean_phage(60.0%)	11	NA	NA
AVD31896.1|2004867_2005995_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
AVD31897.1|2006017_2006350_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
AVD31898.1|2006377_2008225_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
AVD31899.1|2008235_2009207_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
AVD31900.1|2009335_2009683_+	HNH endonuclease	NA	NA	NA	NA	NA
AVD31901.1|2009859_2010744_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
AVD31902.1|2010876_2011080_-	hypothetical protein	NA	NA	NA	NA	NA
AVD31903.1|2011042_2011582_-	hypothetical protein	NA	NA	NA	NA	NA
AVD31904.1|2011732_2012182_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AVD31905.1|2012185_2013289_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase	NA	A0A1V0SE20	Indivirus	35.8	2.8e-54
AVD31906.1|2013377_2013848_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 155
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2035407	2040454	4456672	protease	Agrobacterium_phage(25.0%)	4	NA	NA
AVD31930.1|2035407_2036031_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
AVD31931.1|2036156_2037431_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
AVD31932.1|2037618_2039973_+|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
AVD31933.1|2040181_2040454_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 156
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2043582	2044278	4456672		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVD31937.1|2043582_2044278_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	5.5e-88
>prophage 157
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2047601	2051148	4456672		Bacillus_phage(100.0%)	2	NA	NA
AVD31941.1|2047601_2049374_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-49
AVD31942.1|2049366_2051148_+	multidrug resistance-like ATP-binding protein MdlB	NA	W8CYL7	Bacillus_phage	27.1	2.3e-42
>prophage 158
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2059984	2063134	4456672		Leptospira_phage(100.0%)	1	NA	NA
AVD31953.1|2059984_2063134_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 159
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2070142	2078704	4456672		Klosneuvirus(25.0%)	8	NA	NA
AVD31962.1|2070142_2070694_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
AVD31963.1|2070822_2072754_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
AVD31964.1|2072806_2073136_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AVD31965.1|2073135_2073741_+	recombination protein RecR	NA	NA	NA	NA	NA
AVD31966.1|2073850_2075725_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
AVD31967.1|2075905_2076550_+	adenylate kinase	NA	NA	NA	NA	NA
AVD31968.1|2076785_2077748_+	ferrochelatase	NA	NA	NA	NA	NA
AVD31969.1|2077744_2078704_-	acetylesterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	3.8e-15
>prophage 160
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2086948	2090110	4456672		Escherichia_phage(50.0%)	2	NA	NA
AVD31978.1|2086948_2087290_+	transcriptional regulator	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
AVD31979.1|2087605_2090110_-	copper-exporting P-type ATPase A	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
>prophage 161
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2094649	2095327	4456672		Bacillus_virus(100.0%)	1	NA	NA
AVD31985.1|2094649_2095327_+	iron export ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
>prophage 162
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2098463	2160828	4456672	terminase,integrase,lysis,tRNA,transposase	Enterobacteria_phage(51.72%)	66	2143486:2143532	2164788:2164834
AVD31990.1|2098463_2099150_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
AVD31991.1|2099146_2101561_+	ABC transporter permease	NA	NA	NA	NA	NA
AVD31992.1|2101991_2106272_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
AVD31993.1|2106311_2106680_+	hypothetical protein	NA	NA	NA	NA	NA
AVD31994.1|2107370_2107631_+	hypothetical protein	NA	NA	NA	NA	NA
AVD31995.1|2107669_2107861_+	hypothetical protein	NA	NA	NA	NA	NA
AVD31996.1|2108862_2109957_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AVD31997.1|2110025_2110952_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
AVD31998.1|2111181_2111664_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
AVD31999.1|2111741_2112557_+	transcriptional regulator	NA	NA	NA	NA	NA
AVD32000.1|2112646_2114428_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
AVD32001.1|2114440_2115217_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
AVD32002.1|2115316_2116195_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
AVD32003.1|2116363_2117818_+	allantoin permease	NA	NA	NA	NA	NA
AVD32004.1|2117877_2119239_+	cyclic amidohydrolase	NA	NA	NA	NA	NA
AVD32005.1|2119295_2120597_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
AVD32006.1|2120618_2121764_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
AVD32007.1|2121991_2122777_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
AVD32008.1|2122787_2124023_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
AVD32009.1|2124044_2125094_-	ureidoglycolate dehydrogenase (NAD(+))	NA	NA	NA	NA	NA
AVD32010.1|2125410_2127078_+	protein FdrA	NA	NA	NA	NA	NA
AVD32011.1|2127087_2128347_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
AVD32012.1|2128357_2129173_+	hypothetical protein	NA	NA	NA	NA	NA
AVD32013.1|2129169_2130063_+	carbamate kinase	NA	NA	NA	NA	NA
AVD32014.1|2130257_2131325_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AVD32015.1|2131321_2131831_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AVD32016.1|2131948_2132671_-	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
AVD32017.1|2132673_2133168_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AVD32018.1|2133341_2134727_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
AVD32019.1|2134762_2135284_-	hypothetical protein	NA	NA	NA	NA	NA
AVD32020.1|2135391_2135604_-	ribosome-associated protein	NA	NA	NA	NA	NA
AVD32021.1|2135605_2136472_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AVD32022.1|2136942_2137485_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AVD32023.1|2137704_2138397_+	fimbrial chaperone SfmC	NA	NA	NA	NA	NA
AVD32024.1|2138427_2141031_+	outer membrane usher protein SfmD	NA	NA	NA	NA	NA
AVD32025.1|2141009_2142050_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AVD32026.1|2142060_2142576_+	fimbriae assembly protein	NA	NA	NA	NA	NA
AVD32027.1|2142578_2143211_-	DNA-binding response regulator	NA	NA	NA	NA	NA
2143486:2143532	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AVD32028.1|2143545_2144709_-|integrase	integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
AVD32029.1|2144828_2145092_-	hypothetical protein	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
AVD32030.1|2145414_2145510_+	protein ren	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
AVD32031.1|2145572_2146734_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AVD32032.1|2147045_2147378_+	multidrug SMR transporter	NA	NA	NA	NA	NA
AVD32033.1|2147632_2149159_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
AVD32034.1|2149623_2150175_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AVD32035.1|2150184_2150982_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVD32036.1|2151098_2151200_+	hypothetical protein	NA	NA	NA	NA	NA
AVD32037.1|2151196_2151652_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
AVD32038.1|2151651_2151822_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AVD32039.1|2151814_2152105_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
AVD32040.1|2152101_2152464_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
AVD32041.1|2152460_2152601_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
AVD32042.1|2152686_2153070_+	antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
AVD32043.1|2153211_2153430_+	hypothetical protein	NA	Q38586	Enterobacteria_phage	70.2	1.1e-13
AVD32044.1|2153467_2154484_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AVD32045.1|2154488_2155556_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
AVD32046.1|2156128_2156344_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AVD32047.1|2156343_2156841_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
AVD32048.1|2156837_2157299_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	97.4	3.9e-74
AVD32049.1|2157330_2157624_-	lipoprotein bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
AVD32050.1|2157914_2158325_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
AVD32051.1|2158610_2158817_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
AVD32052.1|2158981_2159176_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
AVD32053.1|2159323_2159425_+	hypothetical protein	NA	NA	NA	NA	NA
AVD32054.1|2159564_2160110_+	DNA-packaging protein NU1	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
AVD32055.1|2160084_2160828_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
2164788:2164834	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 163
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2172058	2174174	4456672		Hokovirus(50.0%)	2	NA	NA
AVD32066.1|2172058_2173501_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
AVD32067.1|2173490_2174174_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 164
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2177444	2180588	4456672		Leptospira_phage(100.0%)	1	NA	NA
AVD32072.1|2177444_2180588_+	cation efflux system protein CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
>prophage 165
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2192887	2198930	4456672		Tupanvirus(50.0%)	3	NA	NA
AVD32085.1|2192887_2196769_+	enterobactin synthase component F	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
AVD32086.1|2196984_2198118_+	ferric enterobactin transporter FepE	NA	NA	NA	NA	NA
AVD32087.1|2198114_2198930_-	ferric enterobactin transport ATP-binding protein FepC	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 166
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2213476	2215299	4456672		uncultured_marine_virus(50.0%)	2	NA	NA
AVD32102.1|2213476_2214106_-	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
AVD32103.1|2214078_2215299_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	3.6e-58
>prophage 167
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2218482	2220597	4456672		Bacillus_virus(50.0%)	2	NA	NA
AVD32108.1|2218482_2220048_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
AVD32109.1|2220168_2220597_-	universal stress protein G	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 168
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2236021	2236668	4456672		Morganella_phage(50.0%)	2	NA	NA
AVD32126.1|2236021_2236231_+	cold-shock protein CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
AVD32127.1|2236284_2236668_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 169
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2241481	2243920	4456672		Stx2-converting_phage(50.0%)	2	NA	NA
AVD32135.1|2241481_2242693_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
AVD32136.1|2242831_2243920_-	septal ring lytic transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 170
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2250930	2255948	4456672	tRNA,transposase	Staphylococcus_phage(33.33%)	4	NA	NA
AVD32145.1|2250930_2253513_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	1.0e-184
AVD32146.1|2253747_2254230_+	hypothetical protein	NA	NA	NA	NA	NA
AVD32147.1|2254759_2254894_+	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	97.3	8.4e-14
AVD32148.1|2254931_2255948_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
>prophage 171
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2259272	2260352	4456672		Pseudomonas_phage(100.0%)	1	NA	NA
AVD32152.1|2259272_2260352_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 172
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2264447	2266112	4456672		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVD32155.1|2264447_2266112_-	asparagine synthetase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 173
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2270878	2274692	4456672	tRNA	Vibrio_phage(50.0%)	2	NA	NA
AVD32161.1|2270878_2272825_+	PTS N-acetylglucosamine EIICBA component	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
AVD32162.1|2273027_2274692_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 174
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2287990	2300711	4456672		Bacillus_phage(25.0%)	8	NA	NA
AVD32175.1|2287990_2288668_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
AVD32176.1|2288664_2291349_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
AVD32177.1|2291341_2291914_-	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AVD32178.1|2291922_2293971_-	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	2.4e-27
AVD32179.1|2293993_2295667_-	potassium-transporting ATPase A chain	NA	NA	NA	NA	NA
AVD32180.1|2295666_2295756_-	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AVD32181.1|2296068_2296275_+	DUF2517 domain-containing protein	NA	NA	NA	NA	NA
AVD32182.1|2296517_2300711_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	5.5e-26
>prophage 175
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2306441	2309491	4456672		Hokovirus(50.0%)	2	NA	NA
AVD32186.1|2306441_2307860_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	3.1e-61
AVD32187.1|2308009_2309491_-	dipeptide permease D	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 176
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2312869	2313661	4456672		Kaumoebavirus(100.0%)	1	NA	NA
AVD32192.1|2312869_2313661_+	endonuclease VII	NA	A0A1V0CNR6	Kaumoebavirus	27.5	7.5e-09
>prophage 177
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2350100	2353620	4456672		Vibrio_phage(33.33%)	4	NA	NA
AVD32224.1|2350100_2350820_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
AVD32225.1|2350816_2351758_-	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
AVD32226.1|2351871_2352252_-	hypothetical protein	NA	NA	NA	NA	NA
AVD32227.1|2352567_2353620_+	phospho-2-dehydro-3-deoxyheptonate aldolase Phe-sensitive	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 178
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2357973	2364547	4456672		Tupanvirus(33.33%)	8	NA	NA
AVD32232.1|2357973_2358990_-	UDP-glucose 4-epimerase	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
AVD32233.1|2359250_2360723_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
AVD32234.1|2360790_2361579_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AVD32235.1|2361707_2361857_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
AVD34241.1|2361792_2362002_+	hypothetical protein	NA	NA	NA	NA	NA
AVD32236.1|2362023_2362797_+	molybdate-binding periplasmic protein	NA	NA	NA	NA	NA
AVD32237.1|2362796_2363486_+	molybdenum ABC transporter permease	NA	NA	NA	NA	NA
AVD32238.1|2363488_2364547_+	molybdenum import ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
>prophage 179
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2374902	2376192	4456672		Klosneuvirus(100.0%)	1	NA	NA
AVD32248.1|2374902_2376192_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 180
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2382673	2383582	4456672		Streptococcus_phage(100.0%)	1	NA	NA
AVD32254.1|2382673_2383582_-	hypothetical protein	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 181
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2394179	2409135	4456672		Anomala_cuprea_entomopoxvirus(14.29%)	13	NA	NA
AVD32268.1|2394179_2395916_-	multidrug ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
AVD32269.1|2395908_2396907_-	secretion protein HlyD	NA	NA	NA	NA	NA
AVD34242.1|2396906_2397578_-	transcriptional regulator	NA	NA	NA	NA	NA
AVD32270.1|2397806_2399171_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
AVD32271.1|2399402_2399885_-	swarming motility protein YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
AVD32272.1|2400004_2402155_+	ATP-dependent helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
AVD32273.1|2402182_2403145_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AVD32274.1|2403285_2404371_+	dehydrogenase	NA	NA	NA	NA	NA
AVD32275.1|2404599_2404860_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVD32276.1|2405124_2405391_-	DksA/TraR family C4-type zinc finger protein	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
AVD32277.1|2405464_2406142_-	PKHD-type hydroxylase	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
AVD32278.1|2406183_2408466_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
AVD32279.1|2408730_2409135_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	2.6e-05
>prophage 182
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2412675	2417900	4456672		Planktothrix_phage(33.33%)	7	NA	NA
AVD32282.1|2412675_2413398_-	glutamine transport ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
AVD32283.1|2413394_2414054_-	glutamine ABC transporter permease	NA	NA	NA	NA	NA
AVD32284.1|2414192_2414939_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVD32285.1|2414865_2415057_-	hypothetical protein	NA	NA	NA	NA	NA
AVD32286.1|2415342_2415846_-	DNA starvation/stationary phase protection protein	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
AVD32287.1|2416144_2417032_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AVD32288.1|2417384_2417900_+	outer membrane protein X	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 183
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2422897	2431239	4456672		Tupanvirus(33.33%)	6	NA	NA
AVD32294.1|2422897_2424490_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
AVD32295.1|2424730_2425996_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
AVD32296.1|2426147_2426963_-	sugar phosphatase YbiV	NA	NA	NA	NA	NA
AVD32297.1|2427108_2429541_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
AVD32298.1|2429546_2430446_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
AVD32299.1|2430576_2431239_+	fructose-6-phosphate aldolase 1	NA	C7BV14	Synechococcus_phage	32.5	2.8e-25
>prophage 184
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2434454	2436326	4456672		Planktothrix_phage(100.0%)	1	NA	NA
AVD32303.1|2434454_2436326_+	glutathione import ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 185
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2447661	2448864	4456672		Stx2-converting_phage(100.0%)	1	NA	NA
AVD34244.1|2447661_2448864_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
>prophage 186
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2457430	2466580	4456672		Vibrio_phage(25.0%)	12	NA	NA
AVD32321.1|2457430_2457688_-	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
AVD32322.1|2457847_2458135_+	hypothetical protein	NA	NA	NA	NA	NA
AVD32323.1|2458118_2458841_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AVD32324.1|2458901_2459804_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
AVD32325.1|2459891_2460368_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
AVD32326.1|2460573_2460735_+	putrescine/spermidine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVD32327.1|2460718_2461831_+	putrescine-binding periplasmic protein	NA	NA	NA	NA	NA
AVD32328.1|2461925_2463059_+	putrescine transport ATP-binding protein PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
AVD32329.1|2463068_2464022_+	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AVD32330.1|2464018_2464864_+	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AVD32331.1|2464923_2465412_+	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AVD32332.1|2465452_2466580_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	1.0e-27
>prophage 187
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2469940	2472678	4456672		Planktothrix_phage(50.0%)	4	NA	NA
AVD32337.1|2469940_2470669_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
AVD32338.1|2470886_2471402_-	lipoprotein	NA	NA	NA	NA	NA
AVD32339.1|2471527_2471851_+	hypothetical protein	NA	NA	NA	NA	NA
AVD32340.1|2471847_2472678_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 188
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2476265	2477984	4456672		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
AVD32343.1|2476265_2477984_-	pyruvate dehydrogenase [ubiquinone]	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
>prophage 189
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2487281	2510966	4456672	protease,tRNA	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
AVD32351.1|2487281_2489228_+	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
AVD32352.1|2489300_2489525_-	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AVD32353.1|2489847_2490168_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AVD32354.1|2490198_2492475_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AVD32355.1|2493159_2493378_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AVD32356.1|2493662_2494367_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVD32357.1|2494408_2496130_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
AVD32358.1|2496130_2497897_-	ATP-binding/permease CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
AVD32359.1|2498019_2498985_-	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
AVD32360.1|2499529_2500024_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AVD32361.1|2500158_2504148_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AVD32362.1|2504306_2504918_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AVD32363.1|2504928_2506272_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AVD32364.1|2506362_2507655_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AVD32365.1|2507893_2510338_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
AVD32366.1|2510348_2510966_+	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 190
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2517274	2520489	4456672		Tetraselmis_virus(100.0%)	2	NA	NA
AVD32373.1|2517274_2518015_-	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
AVD32374.1|2518206_2520489_-	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 191
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2524587	2525676	4456672		Streptococcus_phage(100.0%)	1	NA	NA
AVD32378.1|2524587_2525676_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 192
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2530762	2535304	4456672		Bacillus_phage(100.0%)	3	NA	NA
AVD32383.1|2530762_2531047_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
AVD32384.1|2531254_2533519_+	ComEC family protein	NA	NA	NA	NA	NA
AVD32385.1|2533555_2535304_+	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 193
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2550009	2560979	4456672	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
AVD34246.1|2550009_2550558_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
AVD32397.1|2550584_2551232_+	hypothetical protein	NA	NA	NA	NA	NA
AVD32398.1|2551453_2552644_-	aspartate aminotransferase	NA	NA	NA	NA	NA
AVD32399.1|2552828_2553917_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
AVD32400.1|2554519_2555920_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
AVD32401.1|2556088_2557291_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AVD32402.1|2557556_2560169_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
AVD32403.1|2560211_2560979_-	aliphatic sulfonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 194
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2576898	2578806	4456672		Tupanvirus(100.0%)	1	NA	NA
AVD32419.1|2576898_2578806_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
>prophage 195
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2591405	2593460	4456672		Bacillus_phage(100.0%)	1	NA	NA
AVD32430.1|2591405_2593460_+	helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 196
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2597693	2598353	4456672		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVD32438.1|2597693_2598353_-	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 197
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2618395	2632048	4456672	transposase	Morganella_phage(16.67%)	14	NA	NA
AVD32456.1|2618395_2618608_+	cold-shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
AVD32457.1|2618642_2619851_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.8	3.0e-235
AVD32458.1|2619923_2620145_+	cold-shock protein	NA	NA	NA	NA	NA
AVD32459.1|2620119_2620350_+	cold-shock protein	NA	NA	NA	NA	NA
AVD32460.1|2620339_2620513_+	protein GnsA	NA	NA	NA	NA	NA
AVD32461.1|2620561_2621635_-	electron transporter YccM	NA	NA	NA	NA	NA
AVD32462.1|2621706_2624451_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	2.7e-37
AVD32463.1|2624533_2625562_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
AVD32464.1|2625534_2626227_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
AVD32465.1|2626356_2627529_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
AVD32466.1|2627528_2630075_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	1.2e-71
AVD32467.1|2630071_2630671_+	molecular chaperone TorD	NA	NA	NA	NA	NA
AVD32468.1|2630822_2631128_-	chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
AVD32469.1|2631127_2632048_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 198
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2636353	2638627	4456672		Enterobacteria_phage(100.0%)	3	NA	NA
AVD32475.1|2636353_2636527_+	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
AVD32476.1|2636783_2638112_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	1.1e-233
AVD32477.1|2638132_2638627_-	FMN reductase	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
>prophage 199
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2653264	2654329	4456672		Cronobacter_phage(100.0%)	1	NA	NA
AVD32493.1|2653264_2654329_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.2	8.9e-90
>prophage 200
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2662546	2663709	4456672	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
AVD32498.1|2662546_2663709_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 201
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2669302	2670136	4456672		Pelagibacter_phage(100.0%)	1	NA	NA
AVD32505.1|2669302_2670136_-	curli production assembly/transport component CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 202
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2674271	2674805	4456672		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
AVD32514.1|2674271_2674805_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 203
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2684113	2685034	4456672		Morganella_phage(100.0%)	1	NA	NA
AVD32522.1|2684113_2685034_-	lipid A biosynthesis lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 204
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2689693	2689939	4456672		Salmonella_phage(100.0%)	1	NA	NA
AVD32529.1|2689693_2689939_-	DNA-damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 205
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2705822	2706764	4456672		Brevibacillus_phage(100.0%)	1	NA	NA
AVD32549.1|2705822_2706764_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 206
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2719121	2720303	4456672		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AVD32561.1|2719121_2719856_+	beta-ketoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
AVD32562.1|2720066_2720303_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 207
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2723575	2725218	4456672		Pseudomonas_phage(50.0%)	2	NA	NA
AVD32566.1|2723575_2724217_+	thymidylate kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
AVD32567.1|2724213_2725218_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	31.8	6.4e-05
>prophage 208
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2737524	2737782	4456672		Erwinia_phage(100.0%)	1	NA	NA
AVD32580.1|2737524_2737782_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 209
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2745070	2748811	4456672		Planktothrix_phage(50.0%)	4	NA	NA
AVD32585.1|2745070_2745772_+	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
AVD32586.1|2745771_2747016_+	lipoprotein-releasing system transmembrane subunit LolE	NA	NA	NA	NA	NA
AVD32587.1|2747044_2747956_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AVD32588.1|2747971_2748811_+	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.7e-23
>prophage 210
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2752068	2754046	4456672		Mycoplasma_phage(100.0%)	2	NA	NA
AVD32593.1|2752068_2752926_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AVD32594.1|2752909_2754046_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 211
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2759067	2760438	4456672		Bodo_saltans_virus(100.0%)	1	NA	NA
AVD32599.1|2759067_2760438_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
>prophage 212
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2763574	2767307	4456672		Enterobacteria_phage(66.67%)	4	NA	NA
AVD32603.1|2763574_2764825_+	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	96.3	3.2e-22
AVD32604.1|2764927_2765251_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
AVD32605.1|2765950_2766355_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AVD32606.1|2766575_2767307_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 213
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2784014	2785702	4456672		Morganella_phage(50.0%)	2	NA	NA
AVD32627.1|2784014_2784434_+	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
AVD32628.1|2784433_2785702_+	protein UmuC	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 214
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2812371	2815123	4456672		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVD32651.1|2812371_2814051_-	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
AVD32652.1|2814175_2815123_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 215
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2818259	2822267	4456672		Pseudomonas_phage(50.0%)	5	NA	NA
AVD32656.1|2818259_2819342_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
AVD32657.1|2819341_2820175_+	protein-(glutamine-N5) methyltransferase, release factor-specific	NA	NA	NA	NA	NA
AVD32658.1|2820171_2820564_+	protein sirB2	NA	NA	NA	NA	NA
AVD32659.1|2820567_2821377_+	protein sirB1	NA	NA	NA	NA	NA
AVD32660.1|2821412_2822267_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 216
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2825366	2825597	4456672		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
AVD32665.1|2825366_2825597_+	cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 217
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2836851	2847392	4456672		Escherichia_phage(25.0%)	10	NA	NA
AVD32673.1|2836851_2838390_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
AVD32674.1|2838386_2839097_+	nitrate reductase molybdenum cofactor assembly chaperone NarJ	NA	NA	NA	NA	NA
AVD32675.1|2839096_2839774_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
AVD32676.1|2841029_2841872_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
AVD32677.1|2841921_2842380_-	hypothetical protein	NA	NA	NA	NA	NA
AVD32678.1|2842492_2843398_+	patatin family protein	NA	NA	NA	NA	NA
AVD32679.1|2843489_2844503_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
AVD32680.1|2844704_2845613_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
AVD32681.1|2845756_2846170_-	DNA-binding protein H-NS	NA	NA	NA	NA	NA
AVD32682.1|2846774_2847392_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 218
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2856802	2858817	4456672		Planktothrix_phage(50.0%)	2	NA	NA
AVD32688.1|2856802_2857816_+	oligopeptide transport ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	5.8e-14
AVD32689.1|2857812_2858817_+	oligopeptide transport ATP-binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 219
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2870475	2873433	4456672		Acinetobacter_phage(100.0%)	2	NA	NA
AVD34265.1|2870475_2871834_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	3.3e-36
AVD32704.1|2871837_2873433_-	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
>prophage 220
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2880402	2885694	4456672	protease	Chrysochromulina_ericina_virus(33.33%)	5	NA	NA
AVD32711.1|2880402_2881161_-	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
AVD32712.1|2881380_2882430_+|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
AVD32713.1|2882465_2882717_-	hypothetical protein	NA	NA	NA	NA	NA
AVD32714.1|2882761_2882974_+	hypothetical protein	NA	NA	NA	NA	NA
AVD32715.1|2883096_2885694_+	DNA topoisomerase 1	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 221
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2890618	2891209	4456672		Staphylococcus_phage(100.0%)	1	NA	NA
AVD32721.1|2890618_2891209_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 222
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2899026	2904683	4456672		Lactococcus_phage(50.0%)	5	NA	NA
AVD32732.1|2899026_2900961_-	exoribonuclease 2	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
AVD32733.1|2901028_2902156_-	CMD domain-containing protein	NA	NA	NA	NA	NA
AVD32734.1|2902299_2903088_-	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AVD32735.1|2903455_2903809_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
AVD32736.1|2903876_2904683_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 223
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2917598	2918864	4456672		Klosneuvirus(100.0%)	1	NA	NA
AVD32750.1|2917598_2918864_+	4-aminobutyrate aminotransferase PuuE	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.0e-24
>prophage 224
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2948124	2949141	4456672	transposase	Escherichia_phage(100.0%)	1	NA	NA
AVD32778.1|2948124_2949141_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
>prophage 225
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2957661	2964932	4456672	tRNA	Bacillus_phage(20.0%)	7	NA	NA
AVD34268.1|2957661_2958894_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
AVD32787.1|2959148_2960132_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AVD32788.1|2960406_2960580_+	hypothetical protein	NA	NA	NA	NA	NA
AVD32789.1|2960609_2961983_+	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AVD32790.1|2962111_2963047_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
AVD32791.1|2963223_2963658_-	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
AVD32792.1|2963798_2964932_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 226
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2969892	2970882	4456672		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVD32797.1|2969892_2970882_-	lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
>prophage 227
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	2995959	2998548	4456672	transposase	Shigella_phage(50.0%)	2	NA	NA
AVD32819.1|2995959_2997233_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AVD32820.1|2997396_2998548_+|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 228
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3011099	3015002	4456672		Klosneuvirus(100.0%)	1	NA	NA
AVD32828.1|3011099_3015002_+	ATP-dependent helicase	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 229
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3018940	3019889	4456672		Escherichia_phage(50.0%)	2	NA	NA
AVD32832.1|3018940_3019471_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
AVD32833.1|3019715_3019889_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 230
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3031695	3041869	4456672	protease,transposase	Escherichia_phage(20.0%)	10	NA	NA
AVD32846.1|3031695_3032904_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.0	1.7e-206
AVD32847.1|3032943_3034158_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
AVD32848.1|3034210_3034747_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVD32849.1|3034819_3036781_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.3	3.5e-23
AVD32850.1|3036872_3037103_-	DUF2554 domain-containing protein	NA	NA	NA	NA	NA
AVD32851.1|3037324_3037501_+	mRNA interferase HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
AVD34272.1|3037546_3037963_+	antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
AVD32852.1|3038041_3039448_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVD32853.1|3039692_3040838_+	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVD32854.1|3040855_3041869_+	polyamine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 231
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3049001	3051104	4456672		Salmonella_phage(100.0%)	1	NA	NA
AVD32866.1|3049001_3051104_-	TonB-dependent siderophore receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	5.3e-134
>prophage 232
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3065347	3066892	4456672		Escherichia_phage(100.0%)	1	NA	NA
AVD32881.1|3065347_3066892_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 233
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3073776	3074067	4456672		Enterobacteria_phage(100.0%)	1	NA	NA
AVD32884.1|3073776_3074067_-	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 234
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3080436	3081877	4456672		Escherichia_phage(50.0%)	2	NA	NA
AVD32890.1|3080436_3080721_-	transcriptional regulator	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
AVD32891.1|3080866_3081877_-	zinc-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 235
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3085150	3087056	4456672		Planktothrix_phage(100.0%)	2	NA	NA
AVD32896.1|3085150_3086077_-	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-14
AVD32897.1|3086069_3087056_-	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
>prophage 236
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3091372	3095179	4456672		Klosneuvirus(50.0%)	2	NA	NA
AVD32902.1|3091372_3093796_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
AVD32903.1|3093796_3095179_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 237
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3100445	3107381	4456672	protease	Powai_lake_megavirus(50.0%)	3	NA	NA
AVD32907.1|3100445_3103241_-|protease	zinc protease	protease	A0A167R9K4	Powai_lake_megavirus	24.0	5.7e-19
AVD32908.1|3103285_3105658_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AVD32909.1|3105695_3107381_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.3	2.2e-10
>prophage 238
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3120703	3122104	4456672		Escherichia_phage(100.0%)	1	NA	NA
AVD32921.1|3120703_3122104_-	outer membrane autotransporter barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	4.0e-106
>prophage 239
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3129527	3131063	4456672		Staphylococcus_phage(100.0%)	1	NA	NA
AVD32925.1|3129527_3131063_+	autoinducer 2 import ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	4.4e-21
>prophage 240
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3138944	3139892	4456672		Bacillus_virus(100.0%)	1	NA	NA
AVD32935.1|3138944_3139892_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	29.6	7.3e-19
>prophage 241
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3147611	3147995	4456672		Streptococcus_phage(100.0%)	1	NA	NA
AVD32944.1|3147611_3147995_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 242
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3150997	3151888	4456672		Bacillus_phage(100.0%)	1	NA	NA
AVD32949.1|3150997_3151888_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
>prophage 243
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3157252	3191813	4456672	lysis,integrase,tail	Enterobacteria_phage(31.03%)	49	3165736:3165751	3191884:3191899
AVD32955.1|3157252_3157456_+	protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
AVD32956.1|3157490_3158951_-	D-mannonate oxidoreductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	1.2e-41
AVD32957.1|3159039_3160323_-	MFS transporter	NA	NA	NA	NA	NA
AVD32958.1|3161109_3161343_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AVD32959.1|3161659_3162250_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AVD32960.1|3162347_3162923_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
AVD32961.1|3162922_3163885_-|tail	side tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
AVD32962.1|3163835_3164405_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
AVD32963.1|3164544_3164646_-	hypothetical protein	NA	NA	NA	NA	NA
AVD32964.1|3164793_3165027_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
AVD32965.1|3165147_3165360_-	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AVD32966.1|3165722_3166220_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
3165736:3165751	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
AVD32967.1|3166216_3166750_-	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AVD32968.1|3166746_3167058_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AVD32969.1|3167062_3167278_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AVD32970.1|3168031_3168247_-	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AVD32971.1|3168547_3168760_+	cold-shock protein CspF	NA	NA	NA	NA	NA
AVD32972.1|3169181_3169934_-	antitermination protein Q	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
AVD32973.1|3169947_3170997_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
AVD32974.1|3170998_3171277_-	hypothetical protein	NA	NA	NA	NA	NA
AVD32975.1|3171343_3171595_-	hypothetical protein	NA	NA	NA	NA	NA
AVD32976.1|3171811_3171967_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AVD32977.1|3172038_3172326_-	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AVD32978.1|3172325_3172565_-	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AVD32979.1|3172589_3172895_+	hypothetical protein	NA	NA	NA	NA	NA
AVD32980.1|3173097_3173430_+	protein FlxA	NA	NA	NA	NA	NA
AVD32981.1|3173699_3173822_-	plasmid mobilization protein	NA	NA	NA	NA	NA
AVD32982.1|3174312_3174543_-	division inhibition gene dicB repressor	NA	NA	NA	NA	NA
AVD32983.1|3174626_3175034_+	transcriptional regulator	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
AVD32984.1|3175200_3175356_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AVD32985.1|3175315_3175486_+	hypothetical protein	NA	NA	NA	NA	NA
AVD32986.1|3175515_3175734_+	hypothetical protein	NA	NA	NA	NA	NA
AVD32987.1|3176301_3176490_+	division inhibition protein DicB	NA	NA	NA	NA	NA
AVD32988.1|3176486_3176678_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVD32989.1|3178204_3179401_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	59.2	7.9e-135
AVD32990.1|3179420_3179531_-	transporter	NA	NA	NA	NA	NA
AVD32991.1|3179588_3180608_-	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AVD32992.1|3180619_3181834_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AVD32993.1|3181814_3182003_-	hypothetical protein	NA	NA	NA	NA	NA
AVD32994.1|3182039_3182366_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AVD32995.1|3182500_3182842_+	hypothetical protein	NA	NA	NA	NA	NA
AVD32996.1|3182876_3183437_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AVD34275.1|3183439_3184150_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AVD32997.1|3184257_3184563_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AVD32998.1|3184761_3187188_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
AVD34276.1|3187248_3189672_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
AVD32999.1|3189682_3190300_+	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AVD33000.1|3190301_3191156_+	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AVD33001.1|3191198_3191813_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
3191884:3191899	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 244
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3209574	3210876	4456672		Bacillus_phage(100.0%)	1	NA	NA
AVD33022.1|3209574_3210876_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.2	3.2e-17
>prophage 245
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3220952	3222764	4456672		Vaccinia_virus(100.0%)	1	NA	NA
AVD33030.1|3220952_3222764_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 246
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3242639	3243914	4456672	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AVD33051.1|3242639_3243914_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 247
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3250825	3252324	4456672		Salmonella_phage(50.0%)	2	NA	NA
AVD34279.1|3250825_3251347_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
AVD33059.1|3251427_3252324_-	oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 248
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3261126	3269934	4456672		Streptomyces_phage(20.0%)	10	NA	NA
AVD33067.1|3261126_3261942_+	murein DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
AVD33068.1|3262069_3262651_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
AVD33069.1|3262812_3263982_-	MFS transporter	NA	NA	NA	NA	NA
AVD33070.1|3264147_3264237_-	YnhF family membrane protein	NA	NA	NA	NA	NA
AVD33071.1|3264323_3264548_+	hypothetical protein	NA	NA	NA	NA	NA
AVD33072.1|3264535_3265561_+	PurR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
AVD33073.1|3265557_3266490_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVD33074.1|3266602_3267814_+	MFS transporter	NA	NA	NA	NA	NA
AVD33075.1|3268104_3269253_+	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
AVD33076.1|3269292_3269934_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 249
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3275519	3277786	4456672		Edwardsiella_phage(50.0%)	3	NA	NA
AVD33081.1|3275519_3276332_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
AVD33082.1|3276335_3277121_-	protein PhsC	NA	NA	NA	NA	NA
AVD34280.1|3277117_3277786_-	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 250
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3286075	3291159	4456672		environmental_halophage(33.33%)	5	NA	NA
AVD33091.1|3286075_3287296_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
AVD33092.1|3287292_3288564_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AVD33093.1|3288538_3289285_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	31.4	8.4e-10
AVD33094.1|3289294_3290782_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AVD33095.1|3290790_3291159_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 251
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3309803	3329343	4456672	tRNA	Tupanvirus(22.22%)	20	NA	NA
AVD34281.1|3309803_3311450_+	cyclohexanecarboxylate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	2.9e-31
AVD33113.1|3311506_3313885_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
AVD33114.1|3313938_3314106_-	hypothetical protein	NA	NA	NA	NA	NA
AVD33115.1|3314217_3315051_+	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AVD33116.1|3315207_3316254_+	phospho-2-dehydro-3-deoxyheptonate aldolase Trp-sensitive	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
AVD33117.1|3316385_3316577_+	hypothetical protein	NA	NA	NA	NA	NA
AVD33118.1|3316580_3318017_-	YdiU family protein	NA	NA	NA	NA	NA
AVD33119.1|3318079_3318793_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AVD33120.1|3319039_3319504_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
AVD33121.1|3319581_3320331_-	vitamin B12 import ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
AVD33122.1|3320330_3320882_-	glutathione peroxidase	NA	NA	NA	NA	NA
AVD33123.1|3320944_3321925_-	vitamin B12 import system permease BtuC	NA	NA	NA	NA	NA
AVD33124.1|3322025_3322325_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AVD33125.1|3322329_3324717_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AVD33126.1|3324731_3325715_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
AVD34282.1|3325998_3326043_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AVD33127.1|3326165_3326522_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVD33128.1|3326574_3326772_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVD33129.1|3326868_3327411_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
AVD33130.1|3327414_3329343_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 252
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3340639	3342901	4456672		Tupanvirus(100.0%)	1	NA	NA
AVD33144.1|3340639_3342901_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
>prophage 253
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3349230	3350058	4456672		Bacillus_virus(100.0%)	1	NA	NA
AVD33153.1|3349230_3350058_+	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.7e-72
>prophage 254
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3357534	3358755	4456672		Klosneuvirus(100.0%)	1	NA	NA
AVD33161.1|3357534_3358755_-	succinylornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 255
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3365519	3366173	4456672		Planktothrix_phage(100.0%)	1	NA	NA
AVD33169.1|3365519_3366173_+	sulfate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	1.2e-12
>prophage 256
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3371771	3373733	4456672		Streptococcus_phage(100.0%)	1	NA	NA
AVD33176.1|3371771_3373733_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 257
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3378659	3382744	4456672		Tupanvirus(50.0%)	4	NA	NA
AVD33183.1|3378659_3379301_+	bifunctional pyrazinamidase/nicotinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
AVD33184.1|3379393_3380752_-	MFS transporter	NA	NA	NA	NA	NA
AVD33185.1|3380868_3381627_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AVD33186.1|3381763_3382744_-	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.5	2.3e-07
>prophage 258
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3391554	3392409	4456672		Indivirus(100.0%)	1	NA	NA
AVD33196.1|3391554_3392409_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.6	2.5e-10
>prophage 259
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3395727	3400304	4456672		Bacillus_phage(100.0%)	3	NA	NA
AVD33199.1|3395727_3397011_+	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
AVD33200.1|3397157_3398633_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AVD33201.1|3398813_3400304_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 260
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3414833	3422939	4456672	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
AVD33220.1|3414833_3416519_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
AVD33221.1|3416723_3417305_-	hypothetical protein	NA	NA	NA	NA	NA
AVD33222.1|3417344_3418040_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AVD33223.1|3418097_3420008_-	ATP-dependent helicase	NA	A0A127AW80	Bacillus_phage	31.7	6.5e-91
AVD33224.1|3420139_3420484_+	hypothetical protein	NA	NA	NA	NA	NA
AVD33225.1|3420845_3421205_+	DUF1889 domain-containing protein	NA	NA	NA	NA	NA
AVD33226.1|3421324_3421504_-	YoaH family protein	NA	NA	NA	NA	NA
AVD33227.1|3421577_3422939_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
>prophage 261
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3426801	3428358	4456672		Moraxella_phage(100.0%)	1	NA	NA
AVD33231.1|3426801_3428358_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 262
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3433998	3434208	4456672		Morganella_phage(100.0%)	1	NA	NA
AVD33240.1|3433998_3434208_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 263
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3439540	3441589	4456672	protease,tail	Moraxella_phage(100.0%)	1	NA	NA
AVD33249.1|3439540_3441589_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 264
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3449085	3453555	4456672		Escherichia_phage(33.33%)	7	NA	NA
AVD33255.1|3449085_3449742_-	serine/threonine-protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
AVD33256.1|3450137_3450479_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AVD33257.1|3450491_3451364_-	hypothetical protein	NA	NA	NA	NA	NA
AVD33258.1|3451367_3451742_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AVD33259.1|3451880_3452111_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
AVD33260.1|3452212_3452869_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AVD33261.1|3452892_3453555_+	DNA polymerase III subunit epsilon	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 265
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3461611	3463087	4456672		Cyanophage(100.0%)	1	NA	NA
AVD33269.1|3461611_3463087_-	glucose-6-phosphate 1-dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 266
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3467085	3474149	4456672		Bacillus_virus(50.0%)	9	NA	NA
AVD33273.1|3467085_3468408_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
AVD34288.1|3468423_3469356_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVD33274.1|3469434_3470190_+	Mn2+/Zn2+ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
AVD33275.1|3470186_3470972_+	zinc uptake system membrane protein ZnuB	NA	NA	NA	NA	NA
AVD33276.1|3471118_3472129_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AVD33277.1|3472137_3472749_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AVD34289.1|3472887_3472953_-	hypothetical protein	NA	NA	NA	NA	NA
AVD33278.1|3473023_3473626_+	hypothetical protein	NA	NA	NA	NA	NA
AVD33279.1|3473627_3474149_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 267
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3478167	3480218	4456672		Escherichia_coli_phage(50.0%)	3	NA	NA
AVD33284.1|3478167_3478986_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
AVD33285.1|3479038_3479434_+	hypothetical protein	NA	NA	NA	NA	NA
AVD33286.1|3479474_3480218_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
>prophage 268
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3486834	3488568	4456672	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVD33292.1|3486834_3488568_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 269
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3493820	3499464	4456672		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
AVD33298.1|3493820_3494210_-	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
AVD33299.1|3494224_3495274_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	7.9e-06
AVD33300.1|3495276_3496137_-	chemotaxis protein methyltransferase	NA	NA	NA	NA	NA
AVD33301.1|3496155_3497757_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	6.4e-15
AVD33302.1|3497802_3499464_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 270
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3509551	3511066	4456672		Staphylococcus_phage(100.0%)	1	NA	NA
AVD33313.1|3509551_3511066_-	arabinose import ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 271
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3523058	3523811	4456672		Bacillus_virus(100.0%)	1	NA	NA
AVD33328.1|3523058_3523811_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 272
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3535817	3538777	4456672	integrase	uncultured_Caudovirales_phage(50.0%)	4	3531527:3531540	3540737:3540750
3531527:3531540	attL	GAGCAAAGACGAAC	NA	NA	NA	NA
AVD33342.1|3535817_3536486_+	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	7.3e-82
AVD33343.1|3536596_3537076_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVD33344.1|3537344_3537536_-	hypothetical protein	NA	NA	NA	NA	NA
AVD33345.1|3538498_3538777_+|integrase	integrase	integrase	A0A286S1S8	Klebsiella_phage	48.9	2.1e-06
3540737:3540750	attR	GAGCAAAGACGAAC	NA	NA	NA	NA
>prophage 273
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3552319	3559076	4456672		Burkholderia_phage(50.0%)	8	NA	NA
AVD33364.1|3552319_3554014_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
AVD33365.1|3553934_3554123_-	hypothetical protein	NA	NA	NA	NA	NA
AVD33366.1|3554184_3554367_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AVD33367.1|3554445_3555363_-	hypothetical protein	NA	NA	NA	NA	NA
AVD33368.1|3555535_3556456_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AVD33369.1|3556444_3556915_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
AVD33370.1|3556895_3558314_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
AVD33371.1|3558380_3559076_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
>prophage 274
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3564148	3564820	4456672		Bacillus_phage(100.0%)	1	NA	NA
AVD34290.1|3564148_3564820_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.2	2.4e-32
>prophage 275
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3568364	3568895	4456672		Escherichia_phage(100.0%)	1	NA	NA
AVD33380.1|3568364_3568895_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 276
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3592300	3596221	4456672	transposase	Escherichia_phage(50.0%)	5	NA	NA
AVD33394.1|3592300_3593317_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
AVD33395.1|3594341_3594524_+	hypothetical protein	NA	NA	NA	NA	NA
AVD33396.1|3594451_3594679_-	hypothetical protein	NA	NA	NA	NA	NA
AVD33397.1|3594630_3595023_+	hypothetical protein	NA	NA	NA	NA	NA
AVD33398.1|3594947_3596221_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 277
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3602812	3603034	4456672		Klebsiella_phage(100.0%)	1	NA	NA
AVD33404.1|3602812_3603034_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 278
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3607376	3608543	4456672		Stx2-converting_phage(100.0%)	1	NA	NA
AVD33410.1|3607376_3608543_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	99.2	2.9e-227
>prophage 279
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3616187	3617087	4456672		Cellulophaga_phage(100.0%)	1	NA	NA
AVD33419.1|3616187_3617087_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 280
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3624442	3641891	4456672	transposase	Escherichia_phage(20.0%)	14	NA	NA
AVD33428.1|3624442_3625609_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.0e-110
AVD33429.1|3625857_3627264_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
AVD33430.1|3627890_3628907_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AVD33431.1|3629386_3630505_-	glycosyltransferase	NA	NA	NA	NA	NA
AVD33432.1|3630489_3631080_-	acetyltransferase	NA	A0A1V0SJ47	Klosneuvirus	32.6	2.6e-06
AVD33433.1|3631060_3632053_-	beta-1,6-galactofuranosyltransferase WbbI	NA	NA	NA	NA	NA
AVD33434.1|3632055_3633222_-	O16 family O-antigen polymerase	NA	NA	NA	NA	NA
AVD33435.1|3633221_3634325_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
AVD33436.1|3634332_3635580_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
AVD33437.1|3635576_3636134_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
AVD33438.1|3636133_3637015_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
AVD33439.1|3637970_3639056_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
AVD33440.1|3639428_3640322_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AVD33441.1|3640496_3641891_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 281
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3647603	3654309	4456672		Bacillus_phage(25.0%)	6	NA	NA
AVD33446.1|3647603_3648974_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	1.7e-32
AVD33447.1|3649078_3650515_-	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	9.7e-47
AVD33448.1|3650517_3651741_-	colanic acid biosynthesis glycosyltransferase WcaI	NA	NA	NA	NA	NA
AVD33449.1|3651737_3652217_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AVD33450.1|3652219_3653185_-	GDP-fucose synthetase	NA	D1LW79	Prochlorococcus_phage	51.1	1.3e-87
AVD33451.1|3653187_3654309_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 282
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3658552	3668943	4456672		uncultured_marine_virus(20.0%)	8	NA	NA
AVD33457.1|3658552_3659392_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
AVD33458.1|3659484_3661647_-	tyrosine-protein kinase wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
AVD33459.1|3661649_3662093_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AVD33460.1|3662098_3663238_-	lipoprotein	NA	NA	NA	NA	NA
AVD33461.1|3663896_3665480_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
AVD33462.1|3665753_3667607_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AVD33463.1|3667628_3668210_-	deoxycytidine triphosphate deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.0e-31
AVD33464.1|3668301_3668943_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 283
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3673668	3675021	4456672		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVD33468.1|3673668_3675021_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.6	2.7e-06
>prophage 284
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3688870	3697392	4456672	protease,transposase	Bacillus_phage(33.33%)	9	NA	NA
AVD33477.1|3688870_3690274_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
AVD33478.1|3690270_3690993_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
AVD33479.1|3691183_3691516_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AVD33480.1|3691662_3693024_+|protease	protease	protease	Q6DW11	Phage_TP	100.0	1.1e-217
AVD33481.1|3693296_3693551_-	transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	98.8	2.3e-44
AVD33482.1|3693983_3694301_-	hypothetical protein	NA	NA	NA	NA	NA
AVD33483.1|3694706_3695606_+	phosphatidylglycerol kinase metal-dependent	NA	A0A1V0SBJ0	Catovirus	29.0	2.8e-12
AVD33484.1|3695687_3696134_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AVD33485.1|3696230_3697392_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 285
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3706863	3710420	4456672		Serratia_phage(50.0%)	4	NA	NA
AVD33493.1|3706863_3707868_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
AVD33494.1|3707864_3708830_+	sugar kinase	NA	NA	NA	NA	NA
AVD33495.1|3708803_3709550_-	transcriptional regulator	NA	NA	NA	NA	NA
AVD33496.1|3709601_3710420_-	hypothetical protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
>prophage 286
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3721067	3723101	4456672	tRNA	Indivirus(100.0%)	1	NA	NA
AVD33508.1|3721067_3723101_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 287
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3734734	3744175	4456672		Enterobacteria_phage(85.71%)	10	NA	NA
AVD33514.1|3734734_3735871_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
AVD33515.1|3735867_3737712_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.9	0.0e+00
AVD33516.1|3737992_3738454_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AVD33517.1|3738493_3738964_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
AVD33518.1|3739010_3739730_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVD33519.1|3739726_3741412_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AVD33520.1|3741633_3742365_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AVD33521.1|3742424_3742532_+	hypothetical protein	NA	NA	NA	NA	NA
AVD33522.1|3742512_3743244_-	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AVD33523.1|3743248_3744175_-	ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 288
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3764536	3766057	4456672		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVD33541.1|3764536_3766057_-	galactose/methyl galactoside import ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 289
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3769751	3773537	4456672	tRNA	Cellulophaga_phage(50.0%)	5	NA	NA
AVD33545.1|3769751_3770420_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
AVD33546.1|3770403_3770517_-|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AVD33547.1|3770573_3770750_+	hypothetical protein	NA	NA	NA	NA	NA
AVD33548.1|3770677_3771514_+	S-formylglutathione hydrolase YeiG	NA	NA	NA	NA	NA
AVD33549.1|3771545_3773537_-	colicin I receptor	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 290
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3777607	3778465	4456672		Catovirus(100.0%)	1	NA	NA
AVD33554.1|3777607_3778465_+	endonuclease IV with intrinsic 3''-5'' exonuclease activity	NA	A0A1V0SBL9	Catovirus	34.0	4.0e-24
>prophage 291
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3793012	3797313	4456672		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
AVD33568.1|3793012_3794479_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.3e-43
AVD33569.1|3794596_3795583_+	hypothetical protein	NA	NA	NA	NA	NA
AVD33570.1|3795621_3796335_+	lipid A 1-diphosphate synthase	NA	NA	NA	NA	NA
AVD33571.1|3796746_3797313_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 292
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3803067	3810715	4456672		Vibrio_phage(50.0%)	8	NA	NA
AVD33576.1|3803067_3804657_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
AVD33577.1|3804660_3805005_-	hypothetical protein	NA	NA	NA	NA	NA
AVD33578.1|3805337_3806528_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
AVD33579.1|3806555_3807251_-	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
AVD33580.1|3807251_3807374_+	aldose epimerase	NA	NA	NA	NA	NA
AVD33581.1|3807399_3809160_+	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	41.8	2.4e-100
AVD33582.1|3809284_3809569_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
AVD33583.1|3809707_3810715_-	nucleoid-associated protein	NA	A0A1V0E8C0	Vibrio_phage	48.6	4.1e-84
>prophage 293
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3815672	3816849	4456672	transposase	Human_immunodeficiency_virus(50.0%)	2	NA	NA
AVD33587.1|3815672_3815795_+	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	97.2	3.8e-13
AVD33588.1|3815832_3816849_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
>prophage 294
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3823788	3824412	4456672		Bacillus_virus(100.0%)	1	NA	NA
AVD33598.1|3823788_3824412_-	cytochrome c biogenesis ATP-binding export protein CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.0e-12
>prophage 295
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3833739	3839517	4456672		Bacillus_phage(25.0%)	5	NA	NA
AVD33609.1|3833739_3835383_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.2e-13
AVD33610.1|3835458_3836109_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L3R7	Tupanvirus	33.0	8.3e-06
AVD33611.1|3836108_3837173_-	bifunctional transcriptional activator/DNA repair protein Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
AVD33612.1|3837246_3838302_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
AVD33613.1|3838413_3839517_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.3	5.2e-117
>prophage 296
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3843794	3848637	4456672		Hokovirus(50.0%)	2	NA	NA
AVD33618.1|3843794_3846644_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
AVD33619.1|3846810_3848637_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
>prophage 297
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3863560	3866188	4456672		Bacillus_virus(100.0%)	1	NA	NA
AVD33631.1|3863560_3866188_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.3	3.1e-91
>prophage 298
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3871632	3877779	4456672		Pseudomonas_phage(50.0%)	6	NA	NA
AVD33634.1|3871632_3873918_+	ribonucleoside-diphosphate reductase 1 subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
AVD33635.1|3874151_3875282_+	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
AVD33636.1|3875281_3875536_+	ferredoxin	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
AVD33637.1|3875589_3876240_-	protein InaA	NA	NA	NA	NA	NA
AVD33638.1|3876454_3876661_+	hypothetical protein	NA	NA	NA	NA	NA
AVD33639.1|3876702_3877779_-	glycerophosphoryl diester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.0e-08
>prophage 299
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3883671	3888182	4456672		Sodalis_phage(50.0%)	5	NA	NA
AVD33644.1|3883671_3884571_+	hypothetical protein	NA	Q2A0A7	Sodalis_phage	54.0	2.4e-67
AVD33645.1|3884583_3884769_+	hypothetical protein	NA	NA	NA	NA	NA
AVD33646.1|3884809_3885613_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
AVD33647.1|3885630_3886920_-	MFS transporter	NA	NA	NA	NA	NA
AVD34301.1|3886976_3888182_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
>prophage 300
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3891785	3896789	4456672		Tupanvirus(50.0%)	4	NA	NA
AVD33652.1|3891785_3892388_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
AVD33653.1|3892695_3893835_+	UDP-4-amino-4-deoxy-L-arabinose-oxoglutarate aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.5e-29
AVD33654.1|3893838_3894807_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
AVD33655.1|3894806_3896789_+	bifunctional UDP-glucuronic acid oxidase/UDP-4-amino-4-deoxy-L-arabinose formyltransferase	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 301
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3935629	3938857	4456672		Salmonella_phage(50.0%)	3	NA	NA
AVD33692.1|3935629_3936229_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
AVD33693.1|3936287_3938120_-	transporter	NA	NA	NA	NA	NA
AVD33694.1|3938206_3938857_-	sugar phosphatase YfbT	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.4	3.1e-08
>prophage 302
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	3949416	4005799	4456672	integrase,tRNA,tail,transposase	Enterobacteria_phage(36.36%)	60	3989438:3989497	3996329:3997586
AVD33706.1|3949416_3950307_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	43.9	8.9e-67
AVD33707.1|3950503_3951277_-	histidine transport ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
AVD33708.1|3951284_3952001_-	histidine ABC transporter permease	NA	NA	NA	NA	NA
AVD33709.1|3951997_3952684_-	histidine ABC transporter permease	NA	NA	NA	NA	NA
AVD33710.1|3952773_3953556_-	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
AVD33711.1|3953776_3954559_-	lysine/arginine/ornithine-binding periplasmic protein	NA	NA	NA	NA	NA
AVD33712.1|3954824_3955394_-	3-octaprenyl-4-hydroxybenzoate carboxy-lyase partner protein	NA	NA	NA	NA	NA
AVD33713.1|3955488_3957006_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
AVD33714.1|3957042_3957531_-	colicin V production protein	NA	NA	NA	NA	NA
AVD33715.1|3957789_3958452_-	protein DedD	NA	NA	NA	NA	NA
AVD33716.1|3958441_3959710_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AVD33717.1|3959779_3960694_-	acetyl-CoA carboxylase carboxyl transferase subunit beta	NA	NA	NA	NA	NA
AVD33718.1|3960849_3961509_-	protein DedA	NA	NA	NA	NA	NA
AVD33719.1|3961591_3962404_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AVD33720.1|3962403_3963417_-	USG-1 protein	NA	NA	NA	NA	NA
AVD33721.1|3963482_3964619_-	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.5	6.5e-22
AVD33722.1|3964717_3965713_+	flagella biosynthesis regulator	NA	NA	NA	NA	NA
AVD33723.1|3965709_3966888_-	MFS transporter	NA	NA	NA	NA	NA
AVD33724.1|3966829_3967051_+	hypothetical protein	NA	NA	NA	NA	NA
AVD33725.1|3967152_3968373_-	3-oxoacyl-ACP synthase I	NA	NA	NA	NA	NA
AVD33726.1|3968531_3970538_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AVD33727.1|3970658_3970937_-	YfcL family protein	NA	NA	NA	NA	NA
AVD33728.1|3970970_3971519_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AVD33729.1|3971518_3972328_-	hypothetical protein	NA	NA	NA	NA	NA
AVD33730.1|3972327_3973152_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AVD33731.1|3973155_3974241_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
AVD33732.1|3974275_3975208_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVD33733.1|3975373_3975925_+	endonuclease SmrB	NA	NA	NA	NA	NA
AVD33734.1|3975995_3976817_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
AVD33735.1|3976818_3977358_-	fimbrial protein	NA	NA	NA	NA	NA
AVD33736.1|3977354_3977843_-	fimbrial protein	NA	NA	NA	NA	NA
AVD33737.1|3977839_3978352_-	hypothetical protein	NA	NA	NA	NA	NA
AVD33738.1|3978351_3979104_-	fimbrial chaperone	NA	NA	NA	NA	NA
AVD33739.1|3981850_3982414_-	fimbrial protein	NA	NA	NA	NA	NA
AVD33740.1|3983094_3983580_-	phosphohistidine phosphatase	NA	NA	NA	NA	NA
AVD33741.1|3983782_3985927_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AVD33742.1|3985926_3987237_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AVD33743.1|3987417_3987702_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
AVD33744.1|3987786_3988038_-	hypothetical protein	NA	NA	NA	NA	NA
AVD33745.1|3988073_3989414_+	long-chain fatty acid transporter	NA	NA	NA	NA	NA
3989438:3989497	attL	TGATCTTACCCAGCAATAGTGGACACGCGGCTAAGTGAGTAAACTCTCAGTCAGAGGTGA	NA	NA	NA	NA
AVD33746.1|3989502_3990664_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AVD33747.1|3991039_3992098_+	hypothetical protein	NA	NA	NA	NA	NA
AVD33748.1|3992279_3993035_-	phospholipid-binding lipoprotein	NA	NA	NA	NA	NA
AVD33749.1|3993060_3993231_-	hypothetical protein	NA	NA	NA	NA	NA
AVD33750.1|3993328_3994261_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
AVD33751.1|3994572_3995730_+|integrase	integrase	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
AVD33752.1|3995882_3996245_+	glucose translocase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
AVD33753.1|3996393_3997555_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AVD33754.1|3998419_3999751_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
3996329:3997586	attR	TGATCTTACCCAGCAATAGTGGACACGCGGCTAAGTGAGTAAACTCTCAGTCAGAGGTGACTCACATGACAAAAACAGTATCAACCAGTAAAAAACCCCGTAAACAGCATTCGCCTGAATTTCGCAGTGAAGCCCTGAAGCTTGCTGAACGCATCGGTGTTACTGCCGCAGCCCGTGAACTCAGCCTGTATGAATCACAACTCTACAACTGGCGCAGTAAACAGCAAAATCAGCAGACGTCTTCTGAACGTGAACTGGAGATGTCTACCGAGATTGCACGTCTCAAACGCCAGCTGGCAGAACGGGATGAAGAGCTGGCTATCCTCCAAAAGGCCGCGACATACTTCGCGAAGCGCCTGAAATGAAGTATGTCTTTATTGAAAAACATCAGGCTGAGTTCAGCATCAAAGCAATGTGCCGCGTGCTCCGGGTGGCCCGCAGCGGCTGGTATACGTGGTGTCAGCGGCGGACAAGGATAAGCACGCGTCAGCAGTTCCGCCAACACTGCGACAGCGTTGTCCTCGCGGCTTTTACCCGGTCAAAACAGCGTTACGGTGCCCCACGCCTGACGGATGAACTGCGTGCTCAGGGTTACCCCTTTAACGTAAAAACCGTGGCGGCAAGCCTGCGCCGTCAGGGACTGAGGGCAAAGGCCTCCCGGAAGTTCAGCCCGGTCAGCTACCGCGCACACGGCCTGCCTGTGTCAGAAAATCTGTTGGAGCAGGATTTTTACGCCAGTGGCCCGAACCAGAAGTGGGCAGGAGACATCACGTACTTACGTACAGATGAAGGCTGGCTGTATCTGGCAGTGGTCATTGACCTGTGGTCACGTGCCGTTATTGGCTGGTCAATGTCGCCACGCATGACGGCGCAACTGGCCTGCGATGCCCTGCAGATGGCGCTGTGGCGGCGTAAGAGGCCCCGGAACGTTATCGTTCACACGGACCGTGGAGGCCAGTACTGTTCAGCAGATTATCAGGCGCAACTGAAGCGGCATAATCTGCGTGGAAGTATGAGCGCAAAAGGTTGCTGCTACGATAATGCCTGCGTGGAAAGCTTCTTTCATTCGCTGAAAGTGGAATGTATCCATGGAGAACACTTTATCAGCCGGGAAATAATGCGGGCAACGGTGTTTAATTATATCGAATGTGATTACAATCGGTGGCGGCGGCACAGTTGGTGTGGCGGCCTCAGTCCGGAACAATTTGAAAACAAGAACCTCGCTTAGGCCTGTGTCCATATTACGTGGGTAGGATCA	NA	NA	NA	NA
AVD33755.1|4000049_4000394_+|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	86.2	3.1e-44
AVD33756.1|4000365_4000806_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
AVD34303.1|4000832_4001351_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
AVD33757.1|4001400_4001676_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
AVD33758.1|4001675_4002170_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
AVD33759.1|4002892_4003255_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
AVD33760.1|4003320_4004145_+	DUF2303 domain-containing protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
AVD33761.1|4004272_4004809_+	HD family hydrolase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
AVD33762.1|4004799_4005162_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
AVD33763.1|4005161_4005467_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
AVD33764.1|4005598_4005799_+	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
>prophage 303
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4013662	4021239	4456672		Bacillus_phage(50.0%)	4	NA	NA
AVD33771.1|4013662_4017256_+	sensor protein EvgS	NA	W8CYM9	Bacillus_phage	40.0	1.1e-09
AVD33772.1|4017311_4018457_-	acetyl-CoA--oxalate CoA-transferase	NA	NA	NA	NA	NA
AVD33773.1|4018530_4019475_-	transporter YfdV	NA	NA	NA	NA	NA
AVD33774.1|4019544_4021239_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
>prophage 304
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4024933	4025854	4456672		Morganella_phage(100.0%)	1	NA	NA
AVD33779.1|4024933_4025854_+	lipid A biosynthesis palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 305
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4029671	4030406	4456672		Clostridioides_phage(100.0%)	1	NA	NA
AVD33782.1|4029671_4030406_+	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 306
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4057449	4070103	4456672		Streptococcus_phage(40.0%)	12	NA	NA
AVD33807.1|4057449_4059465_-	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.7e-150
AVD33808.1|4059535_4060522_-	cell division protein ZipA	NA	NA	NA	NA	NA
AVD33809.1|4060751_4061513_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
AVD33810.1|4061697_4062669_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
AVD33811.1|4063052_4063310_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AVD33812.1|4063354_4065082_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	31.1	1.3e-16
AVD33813.1|4065122_4065632_+	glucose-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AVD33814.1|4065674_4066526_-	pyridoxine kinase	NA	NA	NA	NA	NA
AVD33815.1|4066630_4067005_+	hypothetical protein	NA	NA	NA	NA	NA
AVD33816.1|4067037_4067772_+	WGR domain-containing protein	NA	NA	NA	NA	NA
AVD33817.1|4067960_4068872_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.3	3.8e-57
AVD33818.1|4069005_4070103_-	sulfate/thiosulfate import ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
>prophage 307
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4073120	4073912	4456672		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AVD33823.1|4073120_4073912_-	NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 308
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4077390	4082510	4456672		Mycobacterium_phage(33.33%)	6	NA	NA
AVD33827.1|4077390_4078695_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
AVD33828.1|4078934_4079834_-	deferrochelatase/peroxidase	NA	S4VVJ7	Pandoravirus	33.1	1.6e-26
AVD33829.1|4079929_4080505_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AVD33830.1|4080565_4081015_-	hypothetical protein	NA	NA	NA	NA	NA
AVD33831.1|4081001_4081427_-	acetyltransferase YpeA	NA	NA	NA	NA	NA
AVD33832.1|4081640_4082510_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 309
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4101164	4102115	4456672		Cyanophage(100.0%)	1	NA	NA
AVD33851.1|4101164_4102115_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 310
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4119403	4120117	4456672		Synechococcus_phage(100.0%)	1	NA	NA
AVD33864.1|4119403_4120117_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 311
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4141369	4145371	4456672		Enterobacteria_phage(33.33%)	5	NA	NA
AVD33885.1|4141369_4142659_-	uracil/xanthine transporter	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
AVD33886.1|4142744_4143371_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AVD33887.1|4143491_4143677_+	hypothetical protein	NA	NA	NA	NA	NA
AVD33888.1|4143695_4144733_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.4e-71
AVD33889.1|4144732_4145371_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	1.8e-29
>prophage 312
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4151618	4158101	4456672		Escherichia_phage(66.67%)	8	NA	NA
AVD33893.1|4151618_4151771_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
AVD33894.1|4151788_4151980_+	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AVD33895.1|4152041_4152188_+	succinate dehydrogenase	NA	NA	NA	NA	NA
AVD33896.1|4152290_4152809_+	hypothetical protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
AVD33897.1|4152824_4153364_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
AVD33898.1|4153456_4155034_-	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AVD33899.1|4155102_4156569_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
AVD33900.1|4156730_4158101_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.4e-42
>prophage 313
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4166931	4167363	4456672		Powai_lake_megavirus(100.0%)	1	NA	NA
AVD33909.1|4166931_4167363_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 314
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4177573	4184030	4456672		Mycoplasma_phage(20.0%)	8	NA	NA
AVD33914.1|4177573_4178857_-	peptidase B	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
AVD33915.1|4179034_4179235_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AVD33916.1|4179246_4179582_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AVD33917.1|4179583_4181434_-	molecular chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
AVD33918.1|4181450_4181966_-	co-chaperone protein HscB	NA	NA	NA	NA	NA
AVD33919.1|4182061_4182385_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
AVD33920.1|4182401_4182788_-	iron-sulfur cluster scaffold-like protein	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
AVD33921.1|4182815_4184030_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 315
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4199348	4200860	4456672		Staphylococcus_phage(100.0%)	1	NA	NA
AVD33937.1|4199348_4200860_-	heme ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 316
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4206752	4218042	4456672		Bacillus_phage(50.0%)	7	NA	NA
AVD33941.1|4206752_4208006_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
AVD33942.1|4208333_4209524_+	flavohemoprotein	NA	NA	NA	NA	NA
AVD33943.1|4209568_4209907_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AVD33944.1|4209967_4211302_-	transcriptional regulator	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
AVD33945.1|4211291_4212005_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AVD33946.1|4212169_4213597_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
AVD33947.1|4214154_4218042_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.3e-130
>prophage 317
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4222161	4222422	4456672		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVD33953.1|4222161_4222422_+	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 318
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4225881	4229623	4456672		Tetraselmis_virus(50.0%)	4	NA	NA
AVD33960.1|4225881_4226562_-	ribonuclease 3	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
AVD33961.1|4226505_4226784_+	hypothetical protein	NA	NA	NA	NA	NA
AVD33962.1|4226833_4227808_-	S26 family signal peptidase	NA	NA	NA	NA	NA
AVD33963.1|4227823_4229623_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 319
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4235394	4241653	4456672		Cafeteria_roenbergensis_virus(25.0%)	8	NA	NA
AVD33970.1|4235394_4236729_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
AVD33971.1|4236937_4237819_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVD33972.1|4237921_4238509_+	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AVD33973.1|4238564_4238948_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
AVD33974.1|4239252_4239942_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
AVD33975.1|4239989_4241027_-	methyltransferase	NA	NA	NA	NA	NA
AVD33976.1|4241016_4241220_-	hypothetical protein	NA	NA	NA	NA	NA
AVD33977.1|4241233_4241653_+	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 320
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4246946	4248245	4456672		Burkholderia_virus(100.0%)	1	NA	NA
AVD33982.1|4246946_4248245_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 321
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4254098	4256672	4456672		Enterobacteria_phage(100.0%)	1	NA	NA
AVD33984.1|4254098_4256672_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 322
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4262578	4263649	4456672		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AVD33992.1|4262578_4263649_-	phospho-2-dehydro-3-deoxyheptonate aldolase Tyr-sensitive	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 323
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4277394	4277877	4456672		Staphylococcus_phage(100.0%)	1	NA	NA
AVD34009.1|4277394_4277877_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 324
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4283532	4283751	4456672		Salmonella_phage(100.0%)	1	NA	NA
AVD34011.1|4283532_4283751_-	DNA invertase	NA	A0A1S6L009	Salmonella_phage	70.0	4.1e-10
>prophage 325
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4293202	4297254	4456672		Klosneuvirus(50.0%)	4	NA	NA
AVD34018.1|4293202_4294483_+	4-aminobutyrate aminotransferase GabT	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
AVD34019.1|4294720_4296121_+	GABA permease	NA	NA	NA	NA	NA
AVD34020.1|4296141_4296804_+	transcriptional regulator	NA	NA	NA	NA	NA
AVD34021.1|4296804_4297254_-	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 326
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4301190	4306485	4456672		Oenococcus_phage(20.0%)	5	NA	NA
AVD34029.1|4301190_4301436_+	NrdH-redoxin	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
AVD34030.1|4301432_4301843_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
AVD34031.1|4301815_4303960_+	ribonucleotide-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
AVD34032.1|4303969_4304929_+	ribonucleoside-diphosphate reductase 2 subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
AVD34033.1|4305282_4306485_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 327
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4319428	4324814	4456672	tRNA	Vibrio_phage(25.0%)	5	NA	NA
AVD34045.1|4319428_4319614_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AVD34046.1|4319848_4322479_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
AVD34047.1|4322606_4323107_-	regulatory protein RecX	NA	NA	NA	NA	NA
AVD34048.1|4323175_4324237_-	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
AVD34049.1|4324316_4324814_-	nicotinamide-nucleotide amidohydrolase PncC	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 328
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4330280	4331246	4456672		Tetraselmis_virus(100.0%)	1	NA	NA
AVD34057.1|4330280_4331246_+	arabinose 5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 329
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4338721	4339732	4456672		Enterobacteria_phage(100.0%)	1	NA	NA
AVD34314.1|4338721_4339732_-	transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.4	7.1e-28
>prophage 330
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4357560	4370742	4456672		Escherichia_phage(50.0%)	12	NA	NA
AVD34079.1|4357560_4360122_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
AVD34080.1|4360227_4360884_+	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
AVD34081.1|4360934_4361702_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AVD34082.1|4361897_4362806_+	oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
AVD34083.1|4362802_4363969_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
AVD34084.1|4364060_4364699_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AVD34085.1|4364703_4365480_+	hypothetical protein	NA	NA	NA	NA	NA
AVD34086.1|4365568_4366933_+	permease	NA	NA	NA	NA	NA
AVD34087.1|4367026_4368019_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AVD34088.1|4368081_4369221_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AVD34089.1|4369360_4369987_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AVD34090.1|4369980_4370742_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 331
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4373854	4375887	4456672		Tupanvirus(50.0%)	2	NA	NA
AVD34096.1|4373854_4374460_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
AVD34097.1|4374459_4375887_-	sulfate adenylyltransferase	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 332
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4399955	4400741	4456672		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AVD34118.1|4399955_4400741_-	oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.2e-20
>prophage 333
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4405214	4410134	4456672		Vibrio_phage(33.33%)	5	NA	NA
AVD34121.1|4405214_4405886_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
AVD34122.1|4406024_4406165_+	hypothetical protein	NA	NA	NA	NA	NA
AVD34123.1|4406178_4407051_+	TPM domain protein phosphatase	NA	NA	NA	NA	NA
AVD34124.1|4407110_4408409_-	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
AVD34125.1|4408496_4410134_-	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 334
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4414166	4418281	4456672		Erysipelothrix_phage(50.0%)	2	NA	NA
AVD34130.1|4414166_4415468_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	5.2e-39
AVD34131.1|4415524_4418281_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.4	5.4e-54
>prophage 335
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4425815	4426664	4456672		Vibrio_phage(100.0%)	1	NA	NA
AVD34139.1|4425815_4426664_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	1.0e-40
>prophage 336
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4431522	4432278	4456672		Bacillus_phage(100.0%)	1	NA	NA
AVD34143.1|4431522_4432278_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 337
CP026612	Escherichia coli strain DTU-1 chromosome, complete genome	4456672	4443804	4456471	4456672	tRNA	Bacillus_phage(40.0%)	8	NA	NA
AVD34155.1|4443804_4445010_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	3.0e-73
AVD34156.1|4445009_4445453_+	sulfur acceptor protein CsdE	NA	NA	NA	NA	NA
AVD34157.1|4445503_4446310_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
AVD34158.1|4446548_4447646_-	murein transglycosylase A	NA	NA	NA	NA	NA
AVD34159.1|4448224_4449478_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
AVD34160.1|4449709_4451041_+	N-acetylglutamate synthase	NA	NA	NA	NA	NA
AVD34161.1|4451102_4452929_-	RecBCD enzyme subunit RecD	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
AVD34162.1|4452928_4456471_-	RecBCD enzyme subunit RecB	NA	A7KV33	Bacillus_phage	20.9	1.5e-08
