The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026228	Aeromonas sp. ASNIH1 chromosome, complete genome	4984360	500600	564002	4984360	holin,capsid,terminase,lysis,tail,head,portal	Vibrio_phage(13.04%)	64	NA	NA
AUZ78640.1|500600_500816_+|lysis	lysis protein	lysis	NA	NA	NA	NA
AUZ78641.1|500878_501517_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUZ78642.1|501663_501870_-	DNA-binding protein	NA	NA	NA	NA	NA
AUZ78643.1|501909_502596_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ78644.1|502734_503634_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
AUZ78645.1|503694_504678_+	hydrolase	NA	NA	NA	NA	NA
AUZ78646.1|504659_505811_-	GGDEF domain-containing protein	NA	A0A2D0W9B6	Bordetella_phage	39.4	8.7e-06
AUZ78647.1|505900_506146_+	hypothetical protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	38.9	1.6e-05
AUZ78648.1|506381_507251_+	phosphoribulokinase	NA	NA	NA	NA	NA
AUZ78649.1|507267_507801_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ78650.1|507870_508170_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ78651.1|508218_508623_-	OsmC family protein	NA	NA	NA	NA	NA
AUZ78652.1|508996_509635_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AUZ78653.1|509762_510563_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AUZ78654.1|510702_513300_-	glycoside hydrolase	NA	A0A097P8Z3	Sucra_jujuba_nucleopolyhedrovirus	60.9	9.8e-199
AUZ78655.1|513699_517161_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AUZ78656.1|517224_518367_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
AUZ78657.1|518627_520721_-	ligand-gated channel protein	NA	NA	NA	NA	NA
AUZ78658.1|520917_521886_+	iron-regulated protein	NA	NA	NA	NA	NA
AUZ78659.1|521900_522452_+	cysteine hydrolase	NA	NA	NA	NA	NA
AUZ78660.1|522491_522899_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ78661.1|522963_523521_-	heme utilization protein HutZ	NA	NA	NA	NA	NA
AUZ78662.1|523517_524030_-	heme utilization cystosolic carrier protein HutX	NA	NA	NA	NA	NA
AUZ78663.1|524197_525043_+	hemin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUZ78664.1|525042_526071_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AUZ78665.1|526086_526878_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.5	1.9e-12
AUZ78666.1|526975_527584_-	YitT family protein	NA	NA	NA	NA	NA
AUZ78667.1|527876_529226_+	UDP-glucose 6-dehydrogenase	NA	A0A127AXI2	Bacillus_phage	37.1	1.4e-76
AUZ78668.1|529222_530221_+	protein CapI	NA	A0A1V0SAI6	Catovirus	28.5	2.4e-28
AUZ82360.1|530263_531949_-	phospholipid carrier-dependent glycosyltransferase	NA	NA	NA	NA	NA
AUZ78669.1|531941_532301_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ78670.1|532300_533041_-	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	25.7	2.8e-05
AUZ78671.1|533139_533355_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ78672.1|533353_534199_+	lytic transglycosylase	NA	NA	NA	NA	NA
AUZ78673.1|534765_535056_-	DUF2845 domain-containing protein	NA	NA	NA	NA	NA
AUZ78674.1|535352_535862_-	pilus assembly protein	NA	NA	NA	NA	NA
AUZ78675.1|535940_536165_-	hypothetical protein	NA	A0A088C533	Shewanella_sp._phage	41.8	4.1e-05
AUZ78676.1|536161_538108_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ78677.1|538135_538540_-	hypothetical protein	NA	A0A1E1GE27	Vibrio_phage	34.8	2.0e-10
AUZ78678.1|539011_540220_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ78679.1|540264_543882_-	curculin (mannose-binding) lectin protein	NA	A0A0M4U447	Ralstonia_phage	44.1	3.2e-272
AUZ78680.1|543878_544265_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ78681.1|544261_547837_-	hypothetical protein	NA	A0A2I7S9D9	Vibrio_phage	36.1	6.8e-33
AUZ78682.1|547905_548628_-	restriction endonuclease	NA	NA	NA	NA	NA
AUZ78683.1|548761_549511_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ78684.1|549550_549973_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ78685.1|549969_550527_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ78686.1|550526_551066_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ78687.1|551074_551386_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	40.4	4.1e-11
AUZ78688.1|551628_552918_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	62.7	3.8e-143
AUZ78689.1|552986_553922_-	serine peptidase	NA	Q6UAX7	Klebsiella_phage	50.5	1.3e-79
AUZ78690.1|553909_555163_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	65.6	3.3e-160
AUZ78691.1|555162_555351_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ78692.1|555344_557066_-|terminase	terminase	terminase	U5P0Q5	Shigella_phage	74.2	7.8e-261
AUZ78693.1|557075_557561_-|terminase	phage terminase small subunit P27 family	terminase	A0A2D1GNP3	Pseudomonas_phage	59.0	2.5e-47
AUZ78694.1|557656_558037_-	HNH endonuclease	NA	A0A1V0E8A5	Vibrio_phage	54.7	7.5e-31
AUZ78695.1|558123_558642_-	DUF2514 domain-containing protein	NA	A0A059VF51	Pseudomonas_phage	37.9	2.2e-17
AUZ78696.1|558638_559157_-	lysozyme	NA	V5YSX1	Pseudomonas_phage	78.4	9.1e-72
AUZ82361.1|559143_559467_-|holin	phage holin, lambda family	holin	A5X9I3	Aeromonas_virus	54.5	5.7e-24
AUZ78697.1|559709_560777_-	site-specific DNA-methyltransferase	NA	A0A1I9KF79	Aeromonas_phage	73.7	2.6e-129
AUZ78698.1|560688_560907_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUZ78699.1|561384_561999_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUZ78700.1|562079_563273_+	tetracycline efflux MFS transporter Tet(E)	NA	NA	NA	NA	NA
AUZ78701.1|563363_564002_-	DUF159 family protein	NA	C7BGE4	Burkholderia_phage	41.7	2.6e-44
>prophage 2
CP026228	Aeromonas sp. ASNIH1 chromosome, complete genome	4984360	569174	578274	4984360		Vibrio_phage(37.5%)	17	NA	NA
AUZ82362.1|569174_569420_-	hypothetical protein	NA	A0A067ZIN8	Vibrio_phage	58.2	1.9e-19
AUZ78708.1|569524_570514_-	DUF968 domain-containing protein	NA	A0A1V0E819	Vibrio_phage	31.2	1.1e-33
AUZ78709.1|570510_570774_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ78710.1|570757_570976_-	DUF3283 domain-containing protein	NA	NA	NA	NA	NA
AUZ78711.1|571030_571840_-	hypothetical protein	NA	A0A1W6JP13	Morganella_phage	39.0	1.6e-30
AUZ78712.1|571943_572333_-	DUF4406 domain-containing protein	NA	A0A1V0E824	Vibrio_phage	51.2	3.9e-19
AUZ78713.1|572322_572628_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ78714.1|572620_572815_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ82363.1|572823_573051_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ78715.1|573050_573311_-	hypothetical protein	NA	A0A1I9KFB1	Aeromonas_phage	53.0	1.5e-14
AUZ78716.1|573310_573796_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ78717.1|573773_574892_-	hypothetical protein	NA	A5VW95	Enterobacteria_phage	36.0	2.1e-17
AUZ78718.1|575020_576307_-	hypothetical protein	NA	K7PLX4	Enterobacteria_phage	48.9	3.2e-57
AUZ78719.1|576441_576699_+	bssS family protein	NA	NA	NA	NA	NA
AUZ78720.1|576717_577236_-	transcriptional regulator	NA	NA	NA	NA	NA
AUZ78721.1|577255_577474_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ78722.1|577581_578274_+	hypothetical protein	NA	B1B6L9	Salmonella_phage	39.1	1.3e-25
>prophage 3
CP026228	Aeromonas sp. ASNIH1 chromosome, complete genome	4984360	946265	1019213	4984360	tRNA,holin,transposase,integrase	Klosneuvirus(16.67%)	60	959740:959757	1016193:1016210
AUZ79026.1|946265_947252_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AUZ79027.1|947254_947404_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ82383.1|947486_947912_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ79028.1|948025_948298_-	DNA-binding protein HU-alpha	NA	A0A249Y2G7	Serratia_phage	44.2	3.6e-11
AUZ79029.1|948636_949119_+	Rsd/AlgQ family anti-sigma factor	NA	NA	NA	NA	NA
AUZ82384.1|949221_949608_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
AUZ79030.1|949660_951025_-	DNA repair protein RadA	NA	NA	NA	NA	NA
AUZ79031.1|951125_953501_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
AUZ79032.1|953557_954463_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUZ79033.1|954491_955496_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
AUZ82385.1|955689_956298_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ79034.1|956377_958609_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.7	2.3e-18
AUZ79035.1|958673_959390_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
AUZ79036.1|959523_960732_-	phosphopentomutase	NA	NA	NA	NA	NA
959740:959757	attL	CAGCAGGTCGAACAGCTC	NA	NA	NA	NA
AUZ79037.1|960746_962078_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.3	1.7e-77
AUZ79038.1|962187_962961_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
AUZ79039.1|963348_963519_-	XapX domain-containing protein	NA	R4TMJ4	Halovirus	60.0	4.8e-06
AUZ79040.1|963642_964917_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
AUZ79041.1|965130_965919_-	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
AUZ79042.1|966784_967297_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUZ79043.1|967404_968757_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	42.2	5.5e-92
AUZ79044.1|968987_970415_-	ammonia channel protein	NA	NA	NA	NA	NA
AUZ79045.1|970948_971317_+	glyoxalase	NA	NA	NA	NA	NA
AUZ79046.1|971575_972211_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ79047.1|972355_973426_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AUZ82386.1|973451_974558_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AUZ79048.1|974736_976248_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.6	1.4e-48
AUZ79049.1|976417_976873_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AUZ79050.1|976875_979791_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	35.9	7.0e-137
AUZ79051.1|979998_981291_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ79052.1|981309_981975_+	DedA family protein	NA	NA	NA	NA	NA
AUZ79053.1|982111_982939_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
AUZ79054.1|984135_984324_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	5.0e-12
AUZ79055.1|984417_985665_-	aspartate kinase	NA	NA	NA	NA	NA
AUZ79056.1|985681_988306_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.5	1.8e-75
AUZ79057.1|988578_989085_-	regulatory protein RecX	NA	NA	NA	NA	NA
AUZ79058.1|989126_990191_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	64.4	1.2e-115
AUZ82387.1|990271_990763_-	damage-inducible protein CinA	NA	B5TK85	Pseudomonas_phage	49.0	9.0e-29
AUZ82388.1|990986_991370_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ79059.1|991728_993270_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	9.8e-130
AUZ79060.1|993284_994040_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.9	3.4e-59
AUZ79061.1|994907_995588_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ79062.1|995584_995917_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ79063.1|996151_997420_+|transposase	IS4-like element ISAeme3 family transposase	transposase	NA	NA	NA	NA
AUZ79064.1|997409_997850_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ79065.1|997926_1001028_-	DEAD/DEAH box helicase	NA	A0A220A398	Liberibacter_phage	26.4	2.2e-64
AUZ79066.1|1001085_1001676_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ79067.1|1001672_1002965_-	ATP-binding protein	NA	NA	NA	NA	NA
AUZ79068.1|1003106_1003361_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ79069.1|1003435_1004482_-	DUF4917 domain-containing protein	NA	NA	NA	NA	NA
AUZ79070.1|1004483_1005782_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AUZ79071.1|1005771_1007634_-	restriction endonuclease subunit M	NA	A0A220A2U5	Liberibacter_phage	29.9	2.0e-44
AUZ79072.1|1008031_1009018_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ79073.1|1009037_1010069_-|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
AUZ79074.1|1010255_1010825_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ79075.1|1011261_1011489_-	transcriptional regulator	NA	NA	NA	NA	NA
AUZ79076.1|1012396_1013483_+|transposase	IS3-like element ISAs22 family transposase	transposase	NA	NA	NA	NA
AUZ79077.1|1013487_1014771_-|integrase	integrase	integrase	C7BGE7	Burkholderia_phage	28.6	1.8e-31
AUZ79078.1|1014983_1017539_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	25.2	1.2e-34
1016193:1016210	attR	GAGCTGTTCGACCTGCTG	NA	NA	NA	NA
AUZ79079.1|1017614_1019213_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.4	4.7e-26
>prophage 4
CP026228	Aeromonas sp. ASNIH1 chromosome, complete genome	4984360	2273156	2283126	4984360	tRNA	uncultured_Mediterranean_phage(25.0%)	10	NA	NA
AUZ80132.1|2273156_2273918_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.6	3.6e-69
AUZ80133.1|2273922_2274540_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.4	5.3e-34
AUZ82481.1|2274542_2275118_+	DedA family protein	NA	NA	NA	NA	NA
AUZ80134.1|2275127_2276198_+	LysM peptidoglycan-binding domain-containing protein	NA	I2E8W3	Clostridium_phage	34.9	1.7e-11
AUZ80135.1|2276244_2277228_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	33.7	3.8e-34
AUZ80136.1|2277302_2278316_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.0	2.6e-107
AUZ80137.1|2278495_2278711_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AUZ80138.1|2278726_2279170_+|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	47.9	7.6e-27
AUZ80139.1|2279259_2281047_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	40.9	2.6e-73
AUZ80140.1|2281260_2283126_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
>prophage 5
CP026228	Aeromonas sp. ASNIH1 chromosome, complete genome	4984360	2420914	2516866	4984360	plate,holin,terminase,capsid,tRNA,lysis,tail,integrase,transposase,portal	Burkholderia_phage(21.43%)	97	2479679:2479698	2516875:2516894
AUZ82488.1|2420914_2421610_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AUZ80253.1|2421636_2421969_+	DUF469 domain-containing protein	NA	NA	NA	NA	NA
AUZ80254.1|2422065_2422986_+	glutaminase	NA	NA	NA	NA	NA
AUZ80255.1|2423015_2424308_+	sulfurtransferase	NA	NA	NA	NA	NA
AUZ80256.1|2424389_2426477_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AUZ80257.1|2426476_2427226_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80258.1|2427222_2427867_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80259.1|2428006_2428957_+|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
AUZ80260.1|2428972_2429236_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80261.1|2429322_2430282_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80262.1|2430329_2432948_-	sugar transporter	NA	NA	NA	NA	NA
AUZ80263.1|2433510_2434461_+|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
AUZ80264.1|2434788_2434995_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
AUZ80265.1|2435050_2438611_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	21.9	9.9e-08
AUZ80266.1|2438708_2439986_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUZ80267.1|2440512_2440734_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80268.1|2441335_2441671_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
AUZ80269.1|2441742_2443713_-	diguanylate phosphodiesterase	NA	G3MA91	Bacillus_virus	23.5	1.3e-06
AUZ80270.1|2443879_2444374_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80271.1|2444470_2444872_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80272.1|2444874_2445126_-	DUF2960 domain-containing protein	NA	NA	NA	NA	NA
AUZ80273.1|2445130_2445379_-	DUF2132 domain-containing protein	NA	NA	NA	NA	NA
AUZ82489.1|2445375_2446248_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AUZ80274.1|2446277_2447357_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
AUZ80275.1|2447403_2447949_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	36.9	3.6e-26
AUZ80276.1|2449369_2449579_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	57.1	1.8e-15
AUZ80277.1|2449873_2450533_-	opacity-associated protein A	NA	NA	NA	NA	NA
AUZ80278.1|2450632_2452735_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.8	4.9e-23
AUZ80279.1|2452997_2454413_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AUZ80280.1|2454460_2454544_+|tRNA	glutamyl-tRNA synthetase	tRNA	NA	NA	NA	NA
AUZ80281.1|2455948_2458090_-	nuclease	NA	NA	NA	NA	NA
AUZ82490.1|2458612_2461618_+	chitinase	NA	A0A1X9VNM7	Mimivirus	29.7	5.2e-26
AUZ80282.1|2461940_2463176_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AUZ80283.1|2463187_2463823_-	energy transducer TonB	NA	NA	NA	NA	NA
AUZ80284.1|2463839_2464247_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUZ80285.1|2464314_2464842_-	biopolymer transporter ExbB	NA	NA	NA	NA	NA
AUZ80286.1|2464852_2466226_-	biopolymer transporter ExbB	NA	NA	NA	NA	NA
AUZ80287.1|2466222_2466987_-	DUF3450 domain-containing protein	NA	NA	NA	NA	NA
AUZ80288.1|2467089_2469696_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.4	1.5e-37
AUZ80289.1|2470435_2471461_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUZ82491.1|2471469_2472507_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUZ80290.1|2472589_2474407_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUZ82492.1|2474432_2475470_+	peptide ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.2	1.6e-11
AUZ82493.1|2475564_2476566_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.8	7.8e-19
AUZ80291.1|2476811_2476931_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80292.1|2477195_2478647_-	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
AUZ80293.1|2479016_2479130_+	hypothetical protein	NA	NA	NA	NA	NA
2479679:2479698	attL	TGGCGGCAAAGTGGCGGCAG	NA	NA	NA	NA
AUZ80294.1|2479831_2480482_-	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	41.1	6.6e-35
AUZ80295.1|2480650_2480875_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80296.1|2481301_2482462_-	late control protein D	NA	A0A1S5NV58	Burkholderia_phage	54.8	1.3e-97
AUZ80297.1|2482461_2482953_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	49.7	3.2e-34
AUZ80298.1|2482965_2485413_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	39.5	8.3e-123
AUZ80299.1|2485409_2485541_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AUZ80300.1|2485549_2485834_-|tail	phage tail assembly protein	tail	E5FFG6	Burkholderia_phage	45.3	1.4e-10
AUZ80301.1|2485915_2486434_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	59.3	1.4e-51
AUZ80302.1|2486443_2487622_-|tail	phage tail protein	tail	F1BUU3	Erwinia_phage	62.5	2.3e-134
AUZ80303.1|2487828_2488464_-	hypothetical protein	NA	H9C0Y3	Aeromonas_phage	54.1	1.4e-53
AUZ80304.1|2488460_2489831_-|tail	phage tail protein	tail	A4PE45	Ralstonia_virus	41.9	7.0e-79
AUZ80305.1|2489827_2490460_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	59.3	7.2e-63
AUZ80306.1|2490456_2491356_-|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	58.2	2.2e-89
AUZ80307.1|2491352_2491724_-|plate	baseplate assembly protein	plate	E5E3R0	Burkholderia_phage	52.4	3.6e-22
AUZ82494.1|2491720_2492293_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	43.0	2.3e-28
AUZ80308.1|2492371_2492830_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	44.6	2.7e-27
AUZ80309.1|2492811_2493282_-|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	51.1	5.8e-33
AUZ80310.1|2493392_2493866_-|lysis	phage lysis regulatory protein LysB	lysis	E5FFH9	Burkholderia_phage	34.7	1.6e-06
AUZ80311.1|2493855_2494677_-	peptidoglycan-binding protein	NA	A0A2H4JGJ9	uncultured_Caudovirales_phage	53.7	1.1e-68
AUZ80312.1|2494673_2494982_-|holin	phage holin family protein	holin	E5E3R8	Burkholderia_phage	45.9	1.1e-11
AUZ80313.1|2494983_2495346_-	hypothetical protein	NA	E5E3R9	Burkholderia_phage	37.2	7.4e-12
AUZ80314.1|2495361_2495604_-	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AUZ80315.1|2495594_2495798_-|tail	phage tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	59.1	4.0e-15
AUZ80316.1|2495797_2496268_-	glucose-6-phosphate isomerase	NA	E5E3S2	Burkholderia_phage	49.4	1.4e-31
AUZ80317.1|2496365_2497148_-|terminase	terminase	terminase	A4PE31	Ralstonia_virus	47.1	1.3e-42
AUZ80318.1|2497157_2498189_-|capsid	phage major capsid protein, P2 family	capsid	E5E3W8	Burkholderia_phage	55.0	9.5e-105
AUZ80319.1|2498201_2499032_-|capsid	capsid protein	capsid	E5E3S5	Burkholderia_phage	48.6	5.2e-53
AUZ80320.1|2499181_2500948_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	69.4	2.1e-240
AUZ80321.1|2500944_2502006_+|portal	phage portal protein	portal	A0A077K9Q8	Ralstonia_phage	59.3	1.5e-116
AUZ80322.1|2502467_2503475_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80323.1|2503557_2504181_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	39.4	5.5e-23
AUZ80324.1|2504659_2505067_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80325.1|2505066_2505624_-	hypothetical protein	NA	A0A088CD78	Shigella_phage	60.4	3.5e-05
AUZ80326.1|2506250_2506592_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80327.1|2506593_2506806_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80328.1|2506820_2509199_-	replication initiation protein	NA	A5X9G4	Aeromonas_virus	35.8	3.3e-100
AUZ82495.1|2509195_2509534_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80329.1|2509773_2509980_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80330.1|2509976_2510294_-	hypothetical protein	NA	A5X9G2	Aeromonas_virus	82.4	1.9e-43
AUZ80331.1|2510290_2510473_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80332.1|2510469_2510898_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80333.1|2511067_2511370_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80334.1|2511433_2511877_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80335.1|2511892_2512111_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80336.1|2512107_2512365_-	transcriptional regulator	NA	NA	NA	NA	NA
AUZ80337.1|2512376_2512892_-	hypothetical protein	NA	A5X9F7	Aeromonas_virus	44.6	9.8e-26
AUZ80338.1|2512925_2513246_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ82496.1|2513915_2514245_+	transcriptional regulator	NA	A5X9F5	Aeromonas_virus	64.2	2.1e-34
AUZ80339.1|2514263_2514875_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80340.1|2515819_2516866_+|integrase	integrase	integrase	A5X9F3	Aeromonas_virus	54.5	1.2e-99
2516875:2516894	attR	TGGCGGCAAAGTGGCGGCAG	NA	NA	NA	NA
>prophage 6
CP026228	Aeromonas sp. ASNIH1 chromosome, complete genome	4984360	2723570	2771609	4984360	tRNA,transposase,integrase	uncultured_Mediterranean_phage(18.18%)	35	2726478:2726492	2771571:2771585
AUZ80528.1|2723570_2724575_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUZ80529.1|2724695_2724911_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80530.1|2725227_2725809_+	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	63.5	1.7e-71
AUZ80531.1|2726087_2727305_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.1	8.8e-25
2726478:2726492	attL	ACCCAGATCATCGCC	NA	NA	NA	NA
AUZ80532.1|2727380_2728400_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
AUZ80533.1|2728467_2729937_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUZ80534.1|2730006_2730804_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
AUZ80535.1|2730985_2731237_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80536.1|2731276_2731903_-	beta-phosphoglucomutase family hydrolase	NA	A0A1D8KPI1	Synechococcus_phage	26.3	3.5e-09
AUZ80537.1|2732067_2733432_+	MFS transporter	NA	NA	NA	NA	NA
AUZ82506.1|2733536_2733893_-	DUF1622 domain-containing protein	NA	NA	NA	NA	NA
AUZ80538.1|2734981_2735314_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
AUZ80539.1|2735584_2737417_+	SLC13 family permease	NA	NA	NA	NA	NA
AUZ80540.1|2739029_2740652_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	3.6e-106
AUZ80541.1|2740648_2741764_-	anticodon nuclease	NA	NA	NA	NA	NA
AUZ80542.1|2741904_2742822_+|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	59.5	2.4e-99
AUZ80543.1|2742814_2744065_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AUZ80544.1|2744061_2745225_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
AUZ80545.1|2745206_2747849_-	histidinol-phosphatase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	21.5	1.4e-19
AUZ80546.1|2747845_2750818_-	DEAD/DEAH box helicase	NA	A0A220A398	Liberibacter_phage	24.1	1.7e-21
AUZ80547.1|2750886_2751096_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	48.3	1.7e-13
AUZ80548.1|2751703_2752441_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80549.1|2754295_2755300_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AUZ80550.1|2755505_2756078_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80551.1|2756086_2759047_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	76.6	0.0e+00
AUZ82507.1|2759221_2760385_-	chromate transporter	NA	NA	NA	NA	NA
AUZ80552.1|2760567_2761506_-	chromate resistance protein	NA	NA	NA	NA	NA
AUZ80553.1|2761793_2762771_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80554.1|2762961_2763975_+|integrase	integrase	integrase	NA	NA	NA	NA
AUZ80555.1|2764372_2764657_-	transcriptional regulator	NA	NA	NA	NA	NA
AUZ80556.1|2765239_2766256_+|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	28.1	1.1e-23
AUZ80557.1|2766314_2766953_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ82508.1|2767055_2767298_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ82509.1|2768109_2769144_+	transcriptional regulator	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	51.4	2.9e-85
AUZ80558.1|2770521_2771609_-|transposase	IS3-like element ISKpn10 family transposase	transposase	NA	NA	NA	NA
2771571:2771585	attR	GGCGATGATCTGGGT	NA	NA	NA	NA
>prophage 7
CP026228	Aeromonas sp. ASNIH1 chromosome, complete genome	4984360	2878465	2951219	4984360	tRNA,transposase,protease	Staphylococcus_phage(14.29%)	56	NA	NA
AUZ80664.1|2878465_2879005_-|protease	SprT family zinc-dependent metalloprotease	protease	A0A060AI19	Cronobacter_phage	29.5	4.1e-06
AUZ80665.1|2879073_2880225_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.8	1.9e-130
AUZ80666.1|2880565_2882557_+	transketolase	NA	NA	NA	NA	NA
AUZ80667.1|2882830_2883172_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80668.1|2883246_2884512_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AUZ80669.1|2885581_2886454_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ82519.1|2886932_2887232_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80670.1|2887343_2888468_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
AUZ80671.1|2888711_2890022_-	peptidase M23	NA	A0A1P8BKT8	Lactococcus_phage	48.7	5.0e-18
AUZ80672.1|2890136_2891336_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
AUZ80673.1|2891414_2893895_-	alpha-glucosidase	NA	NA	NA	NA	NA
AUZ80674.1|2894079_2894892_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUZ80675.1|2894903_2895437_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AUZ80676.1|2895614_2896871_-	adenylosuccinate synthetase	NA	G5CQQ4	Megavirus	31.8	5.9e-48
AUZ80677.1|2897061_2897964_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUZ80678.1|2898027_2899383_-	immunogenic protein	NA	NA	NA	NA	NA
AUZ80679.1|2899531_2900671_-	putative C-S lyase	NA	NA	NA	NA	NA
AUZ80680.1|2900835_2902008_+	MFS transporter	NA	NA	NA	NA	NA
AUZ80681.1|2902079_2902964_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUZ80682.1|2903053_2903809_-	YciK family oxidoreductase	NA	NA	NA	NA	NA
AUZ80683.1|2904033_2905041_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	28.1	1.9e-17
AUZ80684.1|2905271_2906609_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
AUZ80685.1|2906969_2909591_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	34.5	2.7e-87
AUZ80686.1|2909960_2910311_-	cysteine methyltransferase	NA	NA	NA	NA	NA
AUZ80687.1|2910377_2911931_-	aerotaxis receptor Aer	NA	A0A1B0V854	Salmonella_phage	45.1	3.2e-35
AUZ80688.1|2912123_2913980_-	beta-hexosaminidase	NA	A0A076G5S5	Staphylococcus_phage	23.2	1.8e-08
AUZ80689.1|2914047_2914920_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AUZ80690.1|2915024_2916752_-	chitobiase	NA	NA	NA	NA	NA
AUZ80691.1|2916859_2917858_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.9	2.3e-07
AUZ80692.1|2917869_2918892_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.7	8.5e-13
AUZ80693.1|2918888_2919794_-	ABC transporter permease	NA	NA	NA	NA	NA
AUZ80694.1|2919795_2920779_-	ABC transporter permease	NA	NA	NA	NA	NA
AUZ80695.1|2920896_2922579_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUZ82520.1|2923123_2924449_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AUZ82521.1|2925037_2926063_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AUZ80696.1|2927879_2929082_+	MFS transporter	NA	NA	NA	NA	NA
AUZ80697.1|2929348_2930212_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUZ80698.1|2930266_2930674_+	DUF2000 domain-containing protein	NA	NA	NA	NA	NA
AUZ80699.1|2930695_2931241_+	lysine transporter LysE	NA	NA	NA	NA	NA
AUZ80700.1|2931336_2932464_+	DUF4172 domain-containing protein	NA	D7RWK9	Brochothrix_phage	25.7	3.8e-06
AUZ80701.1|2932648_2932912_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80702.1|2932973_2933384_-	transcriptional regulator	NA	NA	NA	NA	NA
AUZ80703.1|2933735_2934035_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80704.1|2934555_2935008_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
AUZ80705.1|2935846_2937139_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
AUZ80706.1|2937234_2940375_-	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
AUZ80707.1|2940371_2941916_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUZ80708.1|2942124_2942448_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80709.1|2942639_2943326_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.5	1.8e-30
AUZ80710.1|2943315_2944683_+	GHKL domain-containing protein	NA	A0A1V0SGX0	Hokovirus	24.4	3.2e-07
AUZ80711.1|2944701_2946263_-|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
AUZ80712.1|2946434_2946842_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUZ80713.1|2946937_2947834_+	cation transporter	NA	NA	NA	NA	NA
AUZ80714.1|2947837_2948350_+	signal peptidase II	NA	NA	NA	NA	NA
AUZ80715.1|2948371_2949703_+|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	1.3e-85
AUZ80716.1|2950131_2951219_-|transposase	IS3-like element ISAs22 family transposase	transposase	NA	NA	NA	NA
>prophage 8
CP026228	Aeromonas sp. ASNIH1 chromosome, complete genome	4984360	3026852	3090868	4984360	transposase,integrase	Aeromonas_phage(60.42%)	74	3021206:3021220	3066876:3066890
3021206:3021220	attL	CCTTGGGGTTGCCCT	NA	NA	NA	NA
AUZ80787.1|3026852_3027803_+|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
AUZ80788.1|3028710_3029466_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.9	3.4e-59
AUZ80789.1|3029480_3031022_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	9.8e-130
AUZ80790.1|3032062_3032338_-	transcriptional regulator	NA	NA	NA	NA	NA
AUZ82528.1|3033058_3033322_-	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AUZ80791.1|3033403_3034162_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80792.1|3034222_3034621_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80793.1|3034644_3034998_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80794.1|3035011_3035929_-	AAA family ATPase	NA	A0A0R6PCP6	Moraxella_phage	52.7	3.7e-76
AUZ80795.1|3036554_3037487_-	WYL domain-containing protein	NA	NA	NA	NA	NA
AUZ82529.1|3038282_3038567_+	ADP-ribosylglycohydrolase	NA	NA	NA	NA	NA
AUZ80796.1|3038563_3039232_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80797.1|3039849_3040227_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80798.1|3040446_3040854_+	transcriptional regulator	NA	NA	NA	NA	NA
AUZ80799.1|3042141_3043524_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80800.1|3044580_3045621_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	41.5	2.8e-72
AUZ80801.1|3045693_3046107_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80802.1|3046126_3046435_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80803.1|3046418_3046763_-	hypothetical protein	NA	A0A2I7S9Z5	Vibrio_phage	29.5	2.6e-06
AUZ80804.1|3046840_3047341_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80805.1|3049079_3049331_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80806.1|3049460_3049640_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80807.1|3050197_3052165_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80808.1|3052497_3053514_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
AUZ80809.1|3053586_3054627_-|transposase	IS481-like element ISAs19 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	41.8	2.2e-72
AUZ80810.1|3056824_3057841_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.9e-186
AUZ82530.1|3057850_3058273_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80811.1|3058513_3059785_-|integrase	integrase	integrase	A0A1V0E8G8	Vibrio_phage	46.1	2.3e-108
AUZ80812.1|3060023_3061169_-|integrase	integrase	integrase	I6PDJ1	Cronobacter_phage	61.6	3.7e-126
AUZ80813.1|3061165_3061363_-	excisionase	NA	I6PBM8	Cronobacter_phage	57.4	3.3e-14
AUZ80814.1|3061355_3061793_-	hypothetical protein	NA	A0A1I9KG69	Aeromonas_phage	78.8	1.5e-46
AUZ82531.1|3061867_3062563_-	site-specific DNA-methyltransferase	NA	A0A0E3IAX4	Synechococcus_phage	48.8	1.5e-56
AUZ80815.1|3062699_3063005_-	nucleoside 2-deoxyribosyltransferase	NA	A0A1I9KFD3	Aeromonas_phage	92.8	5.0e-46
AUZ80816.1|3063008_3063533_-	hypothetical protein	NA	A0A1I9KF90	Aeromonas_phage	100.0	4.1e-96
AUZ80817.1|3063764_3063983_-	hypothetical protein	NA	A0A1I9KF77	Aeromonas_phage	91.7	1.1e-31
AUZ80818.1|3065007_3065352_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ82532.1|3065348_3065714_-	hypothetical protein	NA	A0A1I9KFB4	Aeromonas_phage	100.0	2.7e-22
AUZ80819.1|3066524_3066704_-	hypothetical protein	NA	A0A1I9KFZ1	Aeromonas_phage	91.5	8.3e-25
AUZ80820.1|3066762_3067341_-	phage N-6-adenine-methyltransferase	NA	A0A1I9KF87	Aeromonas_phage	94.8	7.0e-105
3066876:3066890	attR	CCTTGGGGTTGCCCT	NA	NA	NA	NA
AUZ80821.1|3067333_3067561_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80822.1|3067557_3068775_-	hypothetical protein	NA	A0A1I9KG78	Aeromonas_phage	81.7	7.6e-178
AUZ80823.1|3068824_3069913_-	hypothetical protein	NA	A0A1I9KFA0	Aeromonas_phage	95.6	2.4e-106
AUZ80824.1|3069961_3070939_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	96.9	4.0e-185
AUZ80825.1|3070935_3071781_-	exodeoxyribonuclease VIII	NA	A0A1I9KFF5	Aeromonas_phage	96.4	1.5e-164
AUZ80826.1|3071777_3072272_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ80827.1|3072268_3072637_-	hypothetical protein	NA	A0A1I9KFC9	Aeromonas_phage	86.8	2.3e-53
AUZ80828.1|3072639_3072831_-	hypothetical protein	NA	A0A1I9KG01	Aeromonas_phage	93.5	9.8e-24
AUZ82533.1|3072854_3073358_-	hypothetical protein	NA	G0YQE7	Erwinia_phage	52.6	3.1e-40
AUZ80829.1|3073711_3073957_-	hypothetical protein	NA	A0A1I9KF98	Aeromonas_phage	63.0	3.3e-16
AUZ80830.1|3074358_3075063_-	hypothetical protein	NA	A0A1I9KF99	Aeromonas_phage	98.5	4.7e-103
AUZ82534.1|3075081_3075759_-	LexA family transcriptional repressor	NA	A0A1I9KG86	Aeromonas_phage	99.6	2.7e-124
AUZ80831.1|3075838_3076069_+	hypothetical protein	NA	A0A1I9KFF6	Aeromonas_phage	100.0	2.5e-37
AUZ80832.1|3076101_3076800_+	DNA-binding protein	NA	A0A1I9KFA9	Aeromonas_phage	99.1	1.2e-127
AUZ80833.1|3076841_3077231_+	hypothetical protein	NA	A0A1I9KF96	Aeromonas_phage	97.5	9.6e-58
AUZ80834.1|3077234_3077453_+	hypothetical protein	NA	A0A1I9KFG0	Aeromonas_phage	95.8	2.3e-29
AUZ80835.1|3077654_3079160_+	type II restriction endonuclease subunit M	NA	A0A1I9KFD6	Aeromonas_phage	63.5	7.9e-201
AUZ80836.1|3079156_3080191_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	42.9	4.1e-23
AUZ80837.1|3080228_3080657_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80838.1|3080659_3080962_+	hypothetical protein	NA	A0A1I9KFB1	Aeromonas_phage	89.0	4.7e-44
AUZ82535.1|3081037_3081331_+	hypothetical protein	NA	A0A1I9KG94	Aeromonas_phage	91.8	4.4e-47
AUZ80839.1|3081327_3081768_+	hypothetical protein	NA	A0A1I9KFA6	Aeromonas_phage	90.4	1.5e-70
AUZ80840.1|3081764_3082499_+	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	67.7	6.8e-89
AUZ80841.1|3082479_3082797_+	hypothetical protein	NA	A0A1I9KFA7	Aeromonas_phage	89.5	5.1e-49
AUZ80842.1|3082915_3083155_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80843.1|3083151_3083574_+	hypothetical protein	NA	A0A1I9KG18	Aeromonas_phage	80.7	1.8e-62
AUZ80844.1|3083570_3084182_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80845.1|3084428_3084782_+	hypothetical protein	NA	I3PUY0	Vibrio_phage	52.3	6.7e-18
AUZ80846.1|3084778_3085261_+	TIGR02594 family protein	NA	A0A1I9KGA3	Aeromonas_phage	93.6	5.7e-84
AUZ80847.1|3085314_3085539_+	hypothetical protein	NA	A0A1I9KFG6	Aeromonas_phage	78.1	2.8e-25
AUZ80848.1|3085535_3085718_+	hypothetical protein	NA	A0A1I9KFC5	Aeromonas_phage	58.6	4.5e-10
AUZ80849.1|3085844_3086420_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ82536.1|3086502_3087990_+	TerL	NA	A0A1B1IRS4	uncultured_Mediterranean_phage	40.2	5.6e-90
AUZ80850.1|3087992_3090233_+	hypothetical protein	NA	W8FP98	Vibrio_phage	28.8	4.1e-36
AUZ80851.1|3090379_3090868_+	hypothetical protein	NA	A0AR14	Salmonella_phage	56.0	2.1e-33
>prophage 9
CP026228	Aeromonas sp. ASNIH1 chromosome, complete genome	4984360	3119812	3143158	4984360	integrase,head,tail	Vibrio_phage(29.41%)	31	3116374:3116389	3125763:3125778
3116374:3116389	attL	GGCCAGCAGGGCCTGC	NA	NA	NA	NA
AUZ80876.1|3119812_3122026_+|integrase	integrase	integrase	A0A0M4U788	Ralstonia_phage	40.9	3.7e-37
AUZ80877.1|3122067_3122790_+	DNA transposition protein	NA	M4SPU5	Rhodobacter_phage	26.9	1.3e-20
AUZ80878.1|3122833_3123439_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80879.1|3123422_3123983_+	transcriptional regulator	NA	NA	NA	NA	NA
AUZ80880.1|3124038_3124269_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80881.1|3124301_3124922_+	sulfate transporter	NA	A0A2I7S9B0	Vibrio_phage	60.4	3.5e-62
AUZ80882.1|3124936_3125134_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80883.1|3125211_3125424_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80884.1|3125528_3125759_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ82537.1|3125908_3126502_+	regulatory protein GemA	NA	A0A2I7S9B8	Vibrio_phage	35.2	1.5e-22
3125763:3125778	attR	GCAGGCCCTGCTGGCC	NA	NA	NA	NA
AUZ80885.1|3126494_3126932_+	transcriptional regulator	NA	A0A0C4UQZ9	Shigella_phage	45.5	1.7e-26
AUZ80886.1|3127034_3127565_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80887.1|3127649_3128237_+	secretion activator protein	NA	B0ZSJ3	Halomonas_phage	32.6	4.0e-15
AUZ80888.1|3128233_3128536_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80889.1|3128528_3128750_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80890.1|3128776_3129004_+	molecular chaperone DnaK	NA	NA	NA	NA	NA
AUZ80891.1|3128984_3129287_+	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	41.1	4.0e-11
AUZ80892.1|3129283_3129580_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	58.1	1.3e-17
AUZ82538.1|3129592_3130168_+	hypothetical protein	NA	A0A0C4UQU5	Shigella_phage	68.9	2.3e-60
AUZ80893.1|3130167_3131727_+	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	61.3	9.5e-165
AUZ80894.1|3131726_3133319_+	hypothetical protein	NA	J9SVY0	Pseudomonas_phage	48.8	7.5e-133
AUZ82539.1|3133384_3134608_+|head	head morphogenesis protein	head	A0A2H4IYU7	uncultured_Caudovirales_phage	34.1	3.1e-54
AUZ80895.1|3134701_3135133_+	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	33.3	1.7e-15
AUZ80896.1|3135346_3136477_+	hypothetical protein	NA	A0A0C4UQU6	Shigella_phage	46.9	9.9e-71
AUZ80897.1|3136531_3137440_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	57.9	9.3e-104
AUZ80898.1|3137536_3138019_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80899.1|3138020_3138434_+	hypothetical protein	NA	B7SDP4	Haemophilus_phage	37.0	3.1e-14
AUZ80900.1|3138430_3138868_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80901.1|3138864_3139614_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80902.1|3139770_3140199_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ80903.1|3140320_3143158_+|tail	phage tail protein	tail	A0A2I7S9D9	Vibrio_phage	45.6	4.0e-44
>prophage 10
CP026228	Aeromonas sp. ASNIH1 chromosome, complete genome	4984360	3555897	3595404	4984360	transposase,integrase	Acidithiobacillus_phage(16.67%)	29	3553086:3553116	3581127:3581157
3553086:3553116	attL	GAGGGTTCGAATCCCTCCCTCACCGCCAAAT	NA	NA	NA	NA
AUZ81231.1|3555897_3557439_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	9.8e-130
AUZ81232.1|3557453_3558209_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.9	3.4e-59
AUZ81233.1|3559168_3560131_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AUZ81234.1|3560667_3560925_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ82567.1|3561139_3562156_+	hypothetical protein	NA	A0A2P1CFH0	Microbacterium_phage	23.0	2.9e-05
AUZ81235.1|3563115_3563382_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81236.1|3564158_3564473_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
AUZ81237.1|3565292_3565730_+	hypothetical protein	NA	G3MA91	Bacillus_virus	41.1	2.3e-20
AUZ81238.1|3565823_3567053_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.8	4.6e-21
AUZ81239.1|3567296_3568250_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AUZ81240.1|3568485_3569277_-	M48 family peptidase	NA	NA	NA	NA	NA
AUZ82568.1|3569281_3572569_-	DEAD/DEAH box helicase	NA	A0A220A398	Liberibacter_phage	28.4	2.5e-66
AUZ81241.1|3572568_3574302_-	DUF853 domain-containing protein	NA	NA	NA	NA	NA
AUZ81242.1|3574298_3575549_-	SIR2 family protein	NA	NA	NA	NA	NA
AUZ81243.1|3575928_3577542_-|transposase	IS1634-like element ISAs25 family transposase	transposase	NA	NA	NA	NA
AUZ81244.1|3578512_3580036_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.7	1.4e-88
AUZ82569.1|3580086_3580683_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AUZ82570.1|3581428_3582538_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	30.5	1.8e-29
3581127:3581157	attR	GAGGGTTCGAATCCCTCCCTCACCGCCAAAT	NA	NA	NA	NA
AUZ81245.1|3583166_3584183_+|transposase	IS5/IS1182 family transposase	transposase	Q38213	Escherichia_phage	98.2	2.0e-184
AUZ81246.1|3584839_3585442_+	recombination protein RecR	NA	NA	NA	NA	NA
AUZ81247.1|3585616_3585874_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81248.1|3585939_3587853_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	4.1e-117
AUZ81249.1|3588091_3588736_+	adenylate kinase	NA	NA	NA	NA	NA
AUZ81250.1|3588855_3589830_+	ferrochelatase	NA	NA	NA	NA	NA
AUZ81251.1|3589894_3590287_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81252.1|3590462_3591767_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
AUZ82571.1|3591977_3593558_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	2.2e-31
AUZ81253.1|3593681_3594044_+	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
AUZ81254.1|3594201_3595404_+|transposase	ISL3 family transposase ISAeme19	transposase	A9YX10	Burkholderia_phage	53.2	1.0e-102
>prophage 11
CP026228	Aeromonas sp. ASNIH1 chromosome, complete genome	4984360	3617746	3720489	4984360	terminase,capsid,protease,lysis,integrase,head,tail,transposase,portal	Vibrio_phage(11.11%)	100	3638049:3638069	3731144:3731164
AUZ81266.1|3617746_3619084_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
AUZ81267.1|3619209_3620148_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUZ81268.1|3620333_3621065_+	phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AUZ81269.1|3621154_3621973_-	iron-siderophore ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.6	5.2e-13
AUZ81270.1|3622016_3623066_-	permease	NA	NA	NA	NA	NA
AUZ81271.1|3623078_3624095_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AUZ81272.1|3624173_3626147_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	36.4	1.1e-16
AUZ81273.1|3626207_3627443_-	MFS transporter	NA	NA	NA	NA	NA
AUZ81274.1|3627658_3628408_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81275.1|3628417_3628879_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AUZ81276.1|3629023_3629971_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
AUZ81277.1|3630386_3632030_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
AUZ81278.1|3632147_3632906_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
AUZ81279.1|3633009_3633939_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
AUZ81280.1|3634164_3635253_+	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	48.3	1.4e-90
AUZ81281.1|3635423_3636704_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUZ81282.1|3636901_3637957_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	49.2	1.0e-82
AUZ81283.1|3638043_3638766_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	53.0	2.6e-48
3638049:3638069	attL	TGGCCCGCTCCTGGTGGCCGC	NA	NA	NA	NA
AUZ81284.1|3638883_3639999_+	ATP-NAD kinase	NA	NA	NA	NA	NA
AUZ81285.1|3640106_3640385_+	YfcL family protein	NA	NA	NA	NA	NA
AUZ81286.1|3640484_3642149_+	AMP-dependent synthetase	NA	A0A1V0SBX8	Catovirus	27.2	5.2e-44
AUZ81287.1|3643116_3643998_-	cytidine deaminase	NA	NA	NA	NA	NA
AUZ81288.1|3644224_3644911_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
AUZ81289.1|3644969_3645329_-	murein hydrolase regulator LrgA	NA	NA	NA	NA	NA
AUZ81290.1|3645459_3647175_+	alpha-galactosidase	NA	NA	NA	NA	NA
AUZ81291.1|3647232_3647739_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81292.1|3647887_3649315_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AUZ81293.1|3649313_3650690_+|integrase	integrase	integrase	K7P7J2	Enterobacteria_phage	45.1	4.1e-87
AUZ81294.1|3650848_3651322_-	single-stranded DNA-binding protein	NA	R9TR60	Vibrio_phage	66.7	3.3e-52
AUZ81295.1|3651321_3651579_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81296.1|3651633_3651828_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81297.1|3651803_3652241_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81298.1|3652237_3652432_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81299.1|3652521_3654333_-	hypothetical protein	NA	Q5QF27	Pseudomonas_virus	44.5	3.7e-152
AUZ81300.1|3654329_3654974_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81301.1|3656016_3656259_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81302.1|3656255_3656834_-	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	55.7	1.5e-51
AUZ81303.1|3656830_3657175_-	nucleoside 2-deoxyribosyltransferase	NA	A0A1I9KFD3	Aeromonas_phage	61.4	3.6e-24
AUZ81304.1|3657309_3657894_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81305.1|3658098_3658749_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	48.2	7.7e-44
AUZ81306.1|3658836_3659013_+	Cro/Cl family transcriptional regulator	NA	H9C161	Pectobacterium_phage	51.0	2.6e-07
AUZ81307.1|3659039_3659531_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ82573.1|3659608_3659824_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81308.1|3659813_3660080_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81309.1|3661114_3661600_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81310.1|3661599_3661881_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ82574.1|3661966_3662668_+	DNA-binding protein	NA	A0A1I9KFA9	Aeromonas_phage	57.3	1.5e-61
AUZ81311.1|3662664_3662862_+	DUF3283 domain-containing protein	NA	NA	NA	NA	NA
AUZ81312.1|3662876_3663851_+	hypothetical protein	NA	R9TRM9	Vibrio_phage	34.9	8.1e-29
AUZ81313.1|3663861_3664224_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1J0GV15	Halomonas_phage	46.6	1.4e-18
AUZ82575.1|3664333_3664846_+	antitermination protein	NA	NA	NA	NA	NA
AUZ81314.1|3664921_3665248_-	transcriptional regulator	NA	NA	NA	NA	NA
AUZ82576.1|3665535_3665742_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81315.1|3665744_3666236_+	glycoside hydrolase family 24	NA	A0A193GZ38	Enterobacter_phage	39.3	3.0e-16
AUZ81316.1|3666235_3666775_+	DUF2514 domain-containing protein	NA	A0A2D1GNE2	Pseudomonas_phage	49.3	3.4e-05
AUZ81317.1|3666951_3667311_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	55.5	6.4e-32
AUZ81318.1|3667576_3668017_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
AUZ81319.1|3668019_3669765_+|terminase	terminase	terminase	A0A1J0GUY5	Halomonas_phage	53.4	3.3e-166
AUZ81320.1|3669748_3669940_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ82577.1|3669923_3671180_+|portal	phage portal protein	portal	A0A1J0GUY8	Halomonas_phage	55.1	1.7e-108
AUZ81321.1|3671154_3671766_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0GUZ0	Halomonas_phage	59.0	1.7e-56
AUZ81322.1|3671827_3673030_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	46.8	5.2e-94
AUZ81323.1|3673192_3673603_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81324.1|3673672_3674179_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81325.1|3674472_3675384_+	hypothetical protein	NA	G9L689	Escherichia_phage	61.7	4.3e-40
AUZ81326.1|3675377_3675770_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AUZ81327.1|3675766_3676327_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81328.1|3676323_3676692_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81329.1|3676688_3677135_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81330.1|3677141_3677534_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81331.1|3677548_3677743_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81332.1|3677752_3680056_+	hypothetical protein	NA	A0A2I7S7J2	Vibrio_phage	40.8	7.5e-33
AUZ81333.1|3680062_3680677_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	41.4	2.3e-37
AUZ81334.1|3680673_3681267_+	hypothetical protein	NA	A0A0A0RP51	Escherichia_phage	47.9	8.9e-47
AUZ81335.1|3681340_3682678_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
AUZ81336.1|3683115_3687348_+	hypothetical protein	NA	Q7Y3Z3	Yersinia_phage	51.0	9.4e-191
AUZ81337.1|3687403_3688789_+	hypothetical protein	NA	A0A1I9KFH7	Aeromonas_phage	45.5	5.2e-21
AUZ81338.1|3688813_3689140_+	hypothetical protein	NA	A0A2H4J9Z7	uncultured_Caudovirales_phage	45.7	2.7e-13
AUZ81339.1|3689136_3689463_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81340.1|3689785_3690979_+|integrase	integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	41.4	1.1e-83
AUZ81341.1|3691227_3692268_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	42.6	3.7e-72
AUZ81342.1|3692453_3693470_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.9e-186
AUZ81343.1|3694194_3695736_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81344.1|3695809_3696760_-|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
AUZ81345.1|3697412_3701375_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81346.1|3701371_3703804_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81347.1|3703800_3704934_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81348.1|3704934_3706788_+	ATPase	NA	A0A2L0V0F4	Agrobacterium_phage	33.2	3.9e-40
AUZ81349.1|3706791_3707373_+	radical SAM protein	NA	A0A288TZV3	Enterococcus_phage	33.8	2.4e-12
AUZ81350.1|3708477_3709746_-|transposase	IS4-like element ISAeme3 family transposase	transposase	NA	NA	NA	NA
AUZ81351.1|3710462_3711323_+	histidinol phosphate phosphatase	NA	NA	NA	NA	NA
AUZ82578.1|3711487_3712444_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ82579.1|3712461_3713241_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81352.1|3713195_3714731_-	ADP-heptose--LPS heptosyltransferase	NA	NA	NA	NA	NA
AUZ81353.1|3715225_3715405_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81354.1|3715742_3716075_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81355.1|3716104_3716887_-	hypothetical protein	NA	A0A2I7S9Y2	Vibrio_phage	29.9	6.7e-18
AUZ81356.1|3717793_3717997_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81357.1|3718116_3718773_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81358.1|3719401_3720489_-|transposase	IS3-like element ISAs22 family transposase	transposase	NA	NA	NA	NA
3731144:3731164	attR	GCGGCCACCAGGAGCGGGCCA	NA	NA	NA	NA
>prophage 12
CP026228	Aeromonas sp. ASNIH1 chromosome, complete genome	4984360	3780304	3838970	4984360	tRNA,transposase,bacteriocin,protease	Bacillus_virus(16.67%)	50	NA	NA
AUZ81403.1|3780304_3781972_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	31.6	1.7e-42
AUZ82584.1|3782628_3784911_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	43.0	2.4e-164
AUZ81404.1|3784952_3785801_-	formate transporter FocA	NA	NA	NA	NA	NA
AUZ81405.1|3786182_3787943_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AUZ81406.1|3788278_3788962_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81407.1|3789188_3789503_-	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
AUZ81408.1|3789842_3790955_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUZ81409.1|3791071_3791290_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.2	1.2e-17
AUZ81410.1|3791518_3791836_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.9	2.0e-13
AUZ81411.1|3791896_3794149_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.6	4.9e-170
AUZ81412.1|3794218_3794437_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AUZ81413.1|3794505_3795222_-	arginyltransferase	NA	NA	NA	NA	NA
AUZ82585.1|3795218_3795926_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUZ81414.1|3795943_3796414_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AUZ81415.1|3796497_3797739_-	diguanylate cyclase response regulator	NA	A0A127AWB9	Bacillus_phage	33.0	5.3e-17
AUZ81416.1|3797797_3798748_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	7.8e-61
AUZ81417.1|3798931_3800047_-	alanine dehydrogenase	NA	NA	NA	NA	NA
AUZ81418.1|3800197_3800689_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
AUZ81419.1|3800878_3803383_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.4	2.3e-88
AUZ82586.1|3803460_3804069_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUZ81420.1|3804136_3805474_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.0	3.4e-78
AUZ81421.1|3805439_3805685_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81422.1|3805755_3807051_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.9	3.1e-92
AUZ81423.1|3807226_3807718_+|bacteriocin	bacteriocin production protein	bacteriocin	NA	NA	NA	NA
AUZ81424.1|3807736_3809257_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.4	7.5e-90
AUZ81425.1|3809359_3810787_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	28.5	1.5e-36
AUZ81426.1|3810818_3812273_-	PTS cellobiose/arbutin/salicin transporter subunit IIBC	NA	NA	NA	NA	NA
AUZ82587.1|3812535_3813534_+	transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	29.3	3.1e-28
AUZ81427.1|3813627_3814386_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
AUZ81428.1|3814524_3815310_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	5.9e-14
AUZ81429.1|3815392_3816391_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.7	3.6e-08
AUZ81430.1|3816470_3817364_-	antimicrobial peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
AUZ81431.1|3817453_3818413_-	antimicrobial peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
AUZ81432.1|3818474_3820070_-	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
AUZ81433.1|3820206_3821253_-	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
AUZ81434.1|3821449_3822121_+	phage shock protein PspA	NA	NA	NA	NA	NA
AUZ81435.1|3822133_3822370_+	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
AUZ81436.1|3822395_3822881_+	PspC domain-containing protein	NA	NA	NA	NA	NA
AUZ81437.1|3822953_3824360_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81438.1|3824409_3825453_+	TIGR01620 family protein	NA	NA	NA	NA	NA
AUZ81439.1|3825619_3826414_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
AUZ81440.1|3826455_3826794_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
AUZ81441.1|3826936_3828484_+	transcriptional regulator TyrR	NA	NA	NA	NA	NA
AUZ81442.1|3828673_3829222_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AUZ81443.1|3829218_3830448_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	36.5	5.6e-19
AUZ81444.1|3830481_3830970_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81445.1|3831605_3832943_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
AUZ81446.1|3834128_3835490_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	34.5	3.9e-29
AUZ81447.1|3835598_3836498_-	EamA family transporter	NA	NA	NA	NA	NA
AUZ81448.1|3838565_3838970_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.0	3.3e-29
>prophage 13
CP026228	Aeromonas sp. ASNIH1 chromosome, complete genome	4984360	4308427	4403328	4984360	transposase,integrase	Escherichia_phage(25.0%)	73	4349943:4349962	4391345:4391450
AUZ81807.1|4308427_4309765_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
AUZ82618.1|4310526_4311972_+	ammonia-forming cytochrome c nitrite reductase subunit c552	NA	NA	NA	NA	NA
AUZ81808.1|4312023_4312617_+	cytochrome c nitrite reductase pentaheme subunit	NA	NA	NA	NA	NA
AUZ81809.1|4312613_4313294_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
AUZ81810.1|4313381_4314335_+	cytochrome c nitrite reductase subunit NrfD	NA	NA	NA	NA	NA
AUZ81811.1|4314497_4316459_+	heme lyase NrfEFG subunit NrfE	NA	NA	NA	NA	NA
AUZ81812.1|4316455_4317055_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AUZ81813.1|4317051_4318242_+	heme lyase NrfEFG subunit NrfF	NA	NA	NA	NA	NA
AUZ81814.1|4318592_4319513_+	peptidase S11	NA	NA	NA	NA	NA
AUZ81815.1|4319674_4319815_+	DUF2256 domain-containing protein	NA	NA	NA	NA	NA
AUZ81816.1|4319814_4321335_+	cryptochrome/photolyase family protein	NA	E3T4R9	Cafeteria_roenbergensis_virus	31.8	7.8e-47
AUZ81817.1|4321488_4322742_+	D-amino acid dehydrogenase small subunit	NA	NA	NA	NA	NA
AUZ82619.1|4322804_4323470_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUZ81818.1|4323686_4325618_+	amidohydrolase	NA	NA	NA	NA	NA
AUZ81819.1|4325648_4326782_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81820.1|4326959_4328072_+	heptosyltransferase	NA	NA	NA	NA	NA
AUZ81821.1|4328165_4330439_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AUZ81822.1|4330591_4331527_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUZ81823.1|4331600_4332389_-	siderophore ferric iron reductase	NA	NA	NA	NA	NA
AUZ81824.1|4332451_4334596_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUZ81825.1|4335021_4336545_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.8	2.8e-12
AUZ81826.1|4336510_4338103_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AUZ82620.1|4338099_4338999_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUZ81827.1|4339115_4340015_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUZ81828.1|4340115_4340754_+	3-beta hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
AUZ81829.1|4341101_4342124_+	2-oxobutyrate oxidase	NA	NA	NA	NA	NA
AUZ81830.1|4342216_4343380_+	methionine gamma-lyase	NA	NA	NA	NA	NA
AUZ81831.1|4343464_4344322_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	31.6	2.3e-27
AUZ81832.1|4345079_4346297_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81833.1|4348973_4349558_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
4349943:4349962	attL	CTTATTCGCACCTTCCCTAA	NA	NA	NA	NA
AUZ81834.1|4350765_4351695_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
4349943:4349962	attL	CTTATTCGCACCTTCCCTAA	NA	NA	NA	NA
AUZ81835.1|4353936_4354425_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81836.1|4354424_4355999_-	curlin	NA	NA	NA	NA	NA
AUZ81837.1|4356033_4356555_-	curlin	NA	NA	NA	NA	NA
AUZ81838.1|4356820_4357675_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	39.6	2.3e-43
AUZ81839.1|4357682_4358081_-	curli production assembly protein CsgF	NA	NA	NA	NA	NA
AUZ81840.1|4358092_4358530_-	CsgE	NA	NA	NA	NA	NA
AUZ81841.1|4358529_4359174_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AUZ81842.1|4360710_4361673_+|transposase	IS5/IS1182 family transposase	transposase	Q38213	Escherichia_phage	83.1	3.6e-154
AUZ81843.1|4361763_4362711_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
AUZ82621.1|4363270_4364023_-	phosphohydrolase	NA	NA	NA	NA	NA
AUZ81844.1|4364144_4365389_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	29.1	4.9e-39
AUZ81845.1|4365404_4365620_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81846.1|4365737_4365965_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUZ81847.1|4367167_4368184_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.9e-186
AUZ81848.1|4369003_4369759_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.9	3.4e-59
4368314:4368333	attR	CTTATTCGCACCTTCCCTAA	NA	NA	NA	NA
AUZ81849.1|4369773_4371315_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	9.8e-130
4368314:4368333	attR	CTTATTCGCACCTTCCCTAA	NA	NA	NA	NA
AUZ81850.1|4373590_4375969_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AUZ81851.1|4375961_4376540_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81852.1|4376871_4377324_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
AUZ82622.1|4377527_4378886_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
AUZ82623.1|4378964_4379216_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AUZ81853.1|4379636_4379885_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81854.1|4380386_4380641_+	transcriptional regulator	NA	NA	NA	NA	NA
AUZ81855.1|4380640_4381951_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
AUZ81856.1|4382906_4385081_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
AUZ81857.1|4385181_4385946_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AUZ81858.1|4386891_4387218_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81859.1|4387214_4387730_+	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AUZ81860.1|4388573_4389660_+|transposase	IS3-like element ISAs22 family transposase	transposase	NA	NA	NA	NA
AUZ81861.1|4389664_4390363_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81862.1|4390378_4391329_-|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
AUZ81863.1|4391638_4392649_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUZ81864.1|4392794_4393811_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.9e-186
AUZ81865.1|4393820_4394486_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ82624.1|4394743_4395694_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81866.1|4396436_4396898_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AUZ81867.1|4397047_4398385_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
AUZ81868.1|4398455_4399037_-	thymidine kinase	NA	A0A0K1Y4R8	Klebsiella_phage	52.7	3.8e-50
AUZ81869.1|4399122_4400703_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
AUZ81870.1|4401279_4401678_+	transcriptional regulator	NA	NA	NA	NA	NA
AUZ81871.1|4401755_4402319_-	ATP:cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
AUZ81872.1|4402377_4403328_-|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
>prophage 14
CP026228	Aeromonas sp. ASNIH1 chromosome, complete genome	4984360	4465938	4473594	4984360		Mycoplasma_phage(33.33%)	8	NA	NA
AUZ81928.1|4465938_4467222_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.4	3.3e-30
AUZ81929.1|4467218_4468520_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	35.9	7.7e-35
AUZ81930.1|4468677_4469016_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AUZ81931.1|4469017_4470865_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	2.2e-104
AUZ81932.1|4470893_4471412_-	co-chaperone HscB	NA	NA	NA	NA	NA
AUZ81933.1|4471602_4471926_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	43.9	1.2e-21
AUZ81934.1|4471941_4472325_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.0	2.8e-54
AUZ81935.1|4472379_4473594_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.3	3.0e-33
>prophage 15
CP026228	Aeromonas sp. ASNIH1 chromosome, complete genome	4984360	4492823	4572130	4984360	transposase	Burkholderia_phage(14.29%)	60	NA	NA
AUZ81953.1|4492823_4494026_+|transposase	ISL3 family transposase ISAeme19	transposase	A9YX10	Burkholderia_phage	53.2	1.0e-102
AUZ81954.1|4493972_4495292_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81955.1|4495288_4498111_-	exonuclease V subunit alpha	NA	A0A1W6DX18	Sphingobium_phage	23.9	1.4e-17
AUZ81956.1|4498519_4498963_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
AUZ81957.1|4499179_4499479_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81958.1|4499539_4501162_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81959.1|4501165_4502125_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81960.1|4502121_4503561_-|transposase	transposase	transposase	NA	NA	NA	NA
AUZ81961.1|4503563_4505720_-|transposase	transposase	transposase	NA	NA	NA	NA
AUZ81962.1|4505709_4506582_-|transposase	transposase	transposase	NA	NA	NA	NA
AUZ81963.1|4507692_4509234_+|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	3.4e-130
AUZ81964.1|4509248_4510004_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	50.6	1.3e-58
AUZ81965.1|4512740_4514681_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81966.1|4517004_4517244_-	hypothetical protein	NA	Q38213	Escherichia_phage	66.2	5.7e-21
AUZ81967.1|4517486_4520363_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.0	4.2e-259
AUZ81968.1|4520595_4520985_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
AUZ81969.1|4521061_4522159_-	glycine cleavage system protein T	NA	NA	NA	NA	NA
AUZ81970.1|4522540_4523719_-	FAD-dependent 2-octaprenylphenol hydroxylase	NA	NA	NA	NA	NA
AUZ81971.1|4523860_4525084_-	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
AUZ81972.1|4525271_4525841_-	YecA family protein	NA	NA	NA	NA	NA
AUZ81973.1|4525972_4526347_+	cell division protein ZapA	NA	NA	NA	NA	NA
AUZ81974.1|4526679_4527879_-	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	24.5	1.2e-13
AUZ81975.1|4528149_4529580_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	33.7	4.2e-10
AUZ81976.1|4529576_4530383_-	ABC transporter permease	NA	NA	NA	NA	NA
AUZ81977.1|4530385_4531348_-	ABC transporter permease	NA	NA	NA	NA	NA
AUZ81978.1|4531344_4532871_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUZ81979.1|4533066_4533729_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUZ81980.1|4533760_4534369_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AUZ81981.1|4534489_4534945_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81982.1|4535145_4535949_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
AUZ82632.1|4536049_4536913_-	flagellar protein MotY	NA	NA	NA	NA	NA
AUZ82633.1|4536993_4538937_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	4.4e-34
AUZ82634.1|4539049_4539775_+	ribonuclease T	NA	NA	NA	NA	NA
AUZ81983.1|4540001_4541324_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AUZ81984.1|4541387_4542629_-	MFS transporter	NA	NA	NA	NA	NA
AUZ81985.1|4542685_4543591_-	transcriptional regulator	NA	NA	NA	NA	NA
AUZ81986.1|4543799_4545716_-	GGDEF-domain containing protein	NA	A0A127AWB9	Bacillus_phage	28.0	1.0e-06
AUZ81987.1|4545717_4546200_-	molybdopterin-binding oxidoreductase	NA	NA	NA	NA	NA
AUZ81988.1|4546531_4548460_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.2	1.3e-59
AUZ81989.1|4548607_4549069_-	esterase	NA	NA	NA	NA	NA
AUZ81990.1|4549205_4549694_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81991.1|4549693_4552849_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ81992.1|4552922_4553849_+	cation transporter	NA	NA	NA	NA	NA
AUZ81993.1|4554249_4554771_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ81994.1|4555409_4556951_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.0	2.6e-37
AUZ81995.1|4557126_4558236_+	alkene reductase	NA	NA	NA	NA	NA
AUZ81996.1|4558376_4559363_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUZ81997.1|4559437_4560457_-	adenosine deaminase	NA	NA	NA	NA	NA
AUZ81998.1|4560658_4561408_+	UMP phosphatase	NA	NA	NA	NA	NA
AUZ81999.1|4561549_4561918_+	DUF861 domain-containing protein	NA	NA	NA	NA	NA
AUZ82000.1|4562123_4563788_+	asparagine synthase B	NA	H8ZJK1	Ostreococcus_tauri_virus	40.8	6.7e-92
AUZ82001.1|4563955_4564456_+	thiol-disulfide isomerase	NA	NA	NA	NA	NA
AUZ82002.1|4564584_4565208_+	glutathione S-transferase	NA	NA	NA	NA	NA
AUZ82003.1|4565280_4565940_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
AUZ82004.1|4565988_4566987_-	FAA hydrolase family protein	NA	NA	NA	NA	NA
AUZ82005.1|4566997_4568146_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
AUZ82006.1|4568138_4569293_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
AUZ82007.1|4569532_4570186_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ82008.1|4570182_4570827_-	TIGR01621 family pseudouridine synthase	NA	NA	NA	NA	NA
AUZ82009.1|4570927_4572130_-|transposase	ISL3 family transposase ISAeme19	transposase	A9YX10	Burkholderia_phage	53.2	1.0e-102
>prophage 17
CP026228	Aeromonas sp. ASNIH1 chromosome, complete genome	4984360	4899709	4958153	4984360	transposase,integrase	Stenotrophomonas_phage(11.76%)	43	4895254:4895272	4932490:4932508
4895254:4895272	attL	CGTACTTGCTCGCGTACTT	NA	NA	NA	NA
AUZ82268.1|4899709_4900741_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
AUZ82658.1|4902101_4903055_+	hypothetical protein	NA	A0A0H4INH5	Stenotrophomonas_phage	41.9	3.1e-57
AUZ82269.1|4903398_4904940_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.6	9.8e-130
AUZ82270.1|4904954_4905710_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.9	3.4e-59
AUZ82271.1|4905918_4906572_-	HNH endonuclease	NA	I6WB06	Burkholderia_virus	49.2	5.1e-11
AUZ82272.1|4906826_4907798_+|integrase	integron integrase	integrase	NA	NA	NA	NA
AUZ82273.1|4908094_4909075_+|transposase	IS5/IS1182 family transposase	transposase	Q38213	Escherichia_phage	97.5	9.8e-184
AUZ82659.1|4909112_4909241_-	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	100.0	1.4e-13
AUZ82274.1|4909783_4912843_-	ATP-dependent helicase	NA	S4W0U8	Pandoravirus	37.2	1.9e-07
AUZ82275.1|4912843_4914904_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ82276.1|4914900_4915668_-	chemotaxis protein MotB	NA	NA	NA	NA	NA
AUZ82277.1|4915667_4917728_-	chemotaxis protein	NA	NA	NA	NA	NA
AUZ82278.1|4917901_4918615_-	M48 family peptidase	NA	NA	NA	NA	NA
AUZ82279.1|4918614_4921746_-	restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.1	1.4e-53
AUZ82280.1|4921820_4922885_-	Appr-1-p processing protein	NA	A0A2I7QNM6	Vibrio_phage	40.5	2.2e-24
AUZ82281.1|4923753_4925082_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AUZ82282.1|4925081_4927529_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	36.9	5.8e-76
AUZ82283.1|4927714_4928161_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ82284.1|4928307_4928496_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ82285.1|4928612_4929056_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	49.6	3.3e-30
AUZ82286.1|4929036_4930296_+	protein UmuC	NA	F1C5A5	Cronobacter_phage	52.5	1.6e-117
AUZ82287.1|4931120_4932479_-|integrase	site-specific integrase	integrase	B7SYF8	Stenotrophomonas_phage	25.0	2.5e-12
AUZ82288.1|4932925_4933921_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
4932490:4932508	attR	CGTACTTGCTCGCGTACTT	NA	NA	NA	NA
AUZ82289.1|4934250_4935666_-	multidrug transporter	NA	NA	NA	NA	NA
AUZ82290.1|4935658_4938808_-	hydrophobe/amphiphile efflux-1 family RND transporter	NA	NA	NA	NA	NA
AUZ82291.1|4938825_4940007_-	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUZ82292.1|4940161_4940797_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUZ82660.1|4940969_4941452_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUZ82293.1|4941619_4942798_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
AUZ82294.1|4942861_4943725_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
AUZ82295.1|4943906_4944278_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ82296.1|4944491_4945415_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
AUZ82297.1|4945407_4946100_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.1	2.6e-21
AUZ82298.1|4946141_4947083_-	segregation/condensation protein A	NA	NA	NA	NA	NA
AUZ82299.1|4947009_4947630_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AUZ82300.1|4947762_4948644_-	phosphatase	NA	NA	NA	NA	NA
AUZ82301.1|4949074_4950709_+	anthranilate synthase component I	NA	NA	NA	NA	NA
AUZ82302.1|4950701_4951301_+	type 1 glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	36.3	3.5e-27
AUZ82303.1|4951311_4952325_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	39.0	2.0e-54
AUZ82661.1|4952444_4953830_+	bifunctional indole-3-glycerol phosphate synthase/phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AUZ82304.1|4954018_4955212_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AUZ82305.1|4955208_4956015_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AUZ82306.1|4957136_4958153_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
>prophage 1
CP026229	Aeromonas sp. ASNIH1 plasmid pAER-cc3e, complete sequence	17473	910	8048	17473	transposase	uncultured_Caudovirales_phage(50.0%)	7	NA	NA
AUZ82664.1|910_1198_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	71.3	4.8e-30
AUZ82665.1|1187_1430_-	type II toxin-antitoxin system antitoxin, RelB/DinJ family	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	57.5	1.1e-19
AUZ82666.1|1608_2238_+	cobyrinic acid a,c-diamide synthase	NA	A2I303	Vibrio_virus	44.2	1.3e-40
AUZ82667.1|2234_2468_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ82668.1|2526_5493_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	98.7	0.0e+00
AUZ82669.1|5496_6057_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	97.6	1.2e-58
AUZ82670.1|6389_8048_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	3.1e-12
>prophage 1
CP026230	Aeromonas sp. ASNIH1 plasmid pKPC-038c, complete sequence	77569	0	31004	77569	transposase,integrase	Escherichia_phage(23.08%)	34	17785:17844	25274:26373
AUZ82684.1|990_1260_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ82685.1|1464_2517_+	kfra protein	NA	NA	NA	NA	NA
AUZ82686.1|2513_2693_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ82687.1|2679_2901_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ82688.1|2936_3356_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ82689.1|3647_3974_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ82761.1|4260_4944_+	oriT recognition protein	NA	NA	NA	NA	NA
AUZ82690.1|4921_7135_+	relaxase	NA	NA	NA	NA	NA
AUZ82762.1|7707_8397_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ82763.1|8642_8843_-	resolvase	NA	NA	NA	NA	NA
AUZ82691.1|8774_10490_+|transposase	transposase	transposase	NA	NA	NA	NA
AUZ82692.1|10492_11485_+|transposase	transposase	transposase	NA	NA	NA	NA
AUZ82693.1|11453_11954_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUZ82694.1|11972_12152_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ82695.1|12081_12921_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AUZ82696.1|12914_13262_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AUZ82697.1|13750_14305_-	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
AUZ82698.1|14356_15184_-	OXA-2 family class D extended-spectrum beta-lactamase OXA-32	NA	NA	NA	NA	NA
AUZ82699.1|15358_16387_-|transposase	IS30-like element ISPsp4 family transposase	transposase	H7BW61	unidentified_phage	32.1	4.8e-24
AUZ82700.1|16456_17164_+|integrase	DNA integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	37.1	1.6e-23
AUZ82764.1|17054_17759_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
17785:17844	attL	GGCGGCCGCAAAAACTGAGTGCAACACCCGACCATTTCGGTAAGGTGTTGCCCCATGTCC	NA	NA	NA	NA
AUZ82701.1|17838_18855_+|transposase	IS30 family transposase IS1394	transposase	Q9MBM9	Staphylococcus_prophage	37.5	3.5e-51
AUZ82765.1|18945_19830_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AUZ82702.1|19888_20905_+|transposase	IS30 family transposase IS1394	transposase	Q9MBM9	Staphylococcus_prophage	37.5	3.5e-51
AUZ82703.1|20988_22464_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
AUZ82704.1|22913_23618_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUZ82705.1|23629_23974_-	hypothetical protein	NA	E5FFF9	Burkholderia_phage	65.7	1.3e-29
AUZ82706.1|24009_24306_-|transposase	transposase	transposase	NA	NA	NA	NA
AUZ82707.1|24244_25258_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AUZ82708.1|25327_26344_+|transposase	IS30 family transposase IS1394	transposase	Q9MBM9	Staphylococcus_prophage	37.5	3.5e-51
AUZ82709.1|26518_27346_+	oxacillin-hydrolyzing class D beta-lactamase OXA-2	NA	NA	NA	NA	NA
25274:26373	attR	GGCGGCCGCAAAAACTGAGTGCAACACCCGACCATTTCGGTAAGGTGTTGCCCCATGTCCTATCACGAACTCAGCGCCACAGAGCGCGTCACGATCCAGATCGGCCTGTGCAATGGCTTCAGCCAGCGCAGGCTTGCCCGGCTGATGAACCGCAGCCCCTCGACGGTCAGCCGTGAGATCCGGCGCAACCGGAATGCTCAAGGCGAGTACGTTGCAGACGATGCCCAGCGCTTGATGCATACACGCCGCGTGGTCTGTCGACCCGCAAAACGGCTGGTGCCCGGCAACGAGTTGTTCGAGCTGGTCGCCCACCTGCTGCGACAGCGCTTTTCTCCCGAGCAGATTGCCGGCAAGCTGCGAACCATGAAATCCCCAAGCTTCGAAGACGCCTACGTCTGCCGCGAGACAATCTACAACGCGATCTATGCCCTGCCGGTCGGCGAGCTGCGCAAGGAGCTGATCATCTGTCTGCGGCAGGGCAAGACTACCCGCCGGCCGCGCTCCGGCGGGGTGGATCGACGTGGCCAGATCCCCGACATGGTCAGCATCCACGTACGCCCACCGGAGATCGAAGACCGCCTGATGCCCGGTCACTGGGAGGGCGATCTGATCAAGGGCAAGGCCAACGCCTCGGCGGTAGCCACCCTGGTCGAGCGTACCAGCGGCTACCTGATCCTGGCGAAGATGAACGATGCGACGGCGACCTCGGCGGTGGAGGGCTTCAGCGCGGCGCTGAACCGCATGCCGCTGGCTGTACGCAAGAGCATGACCTACGACCAGGGGCGAGAGATGGCGCGGCACGCGGAAATCACCCAGAAGACCGGTGTGGCGATCTACTTCTGCGACCCACACAGCCCCTGGCAGCGCGGCAGCAACGAGAACATCAACGGCCTGATCCGCCAGTACCTGCCCAAGGGCACGGACTTGTCGGTGTACAGCCAGGAGCAGTTGGATGCCATTGCCTACGAACTGAACATCCGACCGCGCAAGCGCTTCAATTGGAAATGCCCGATTGAGGTCATGACAGAGGTAGTGGCGTTGCAGCATGATGCACCTGCTTCAATCCAGTAACCGTGTTGCACTCAGCTTCTGCAACCGCC	NA	NA	NA	NA
AUZ82710.1|27481_27829_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AUZ82711.1|28205_28910_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUZ82766.1|29336_31004_+	modification methylase PaeR7I	NA	R4TFP1	Halovirus	24.4	1.1e-20
>prophage 2
CP026230	Aeromonas sp. ASNIH1 plasmid pKPC-038c, complete sequence	77569	35042	36167	77569		Bacillus_phage(100.0%)	1	NA	NA
AUZ82719.1|35042_36167_-	M23 family peptidase	NA	A7KUS1	Bacillus_phage	32.4	3.4e-07
>prophage 3
CP026230	Aeromonas sp. ASNIH1 plasmid pKPC-038c, complete sequence	77569	41434	42067	77569		Burkholderia_phage(100.0%)	1	NA	NA
AUZ82726.1|41434_42067_+	partition protein	NA	E5FFJ3	Burkholderia_phage	38.6	3.6e-22
>prophage 4
CP026230	Aeromonas sp. ASNIH1 plasmid pKPC-038c, complete sequence	77569	46208	56580	77569	transposase	Erysipelothrix_phage(25.0%)	12	NA	NA
AUZ82732.1|46208_47894_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.3	5.5e-41
AUZ82733.1|47911_48277_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AUZ82734.1|48273_48510_+	mercury resistance protein	NA	NA	NA	NA	NA
AUZ82735.1|49212_50142_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	46.9	1.9e-40
AUZ82736.1|50343_50583_+	methionine repressor-like protein	NA	NA	NA	NA	NA
AUZ82737.1|50582_50993_+	PIN domain nuclease	NA	NA	NA	NA	NA
AUZ82738.1|50996_53990_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	47.6	5.7e-259
AUZ82739.1|54002_54215_-	hypothetical protein	NA	NA	NA	NA	NA
AUZ82740.1|54222_54498_-	mercuric transport protein periplasmic component	NA	NA	NA	NA	NA
AUZ82741.1|54510_54861_-	mercury transporter MerT	NA	NA	NA	NA	NA
AUZ82742.1|54935_55334_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AUZ82743.1|55530_56580_-	transcriptional regulator	NA	S5VTK0	Leptospira_phage	31.2	3.2e-07
>prophage 5
CP026230	Aeromonas sp. ASNIH1 plasmid pKPC-038c, complete sequence	77569	60961	61390	77569		Pseudomonas_phage(100.0%)	1	NA	NA
AUZ82752.1|60961_61390_-	antirestriction protein KlcA	NA	A9J566	Pseudomonas_phage	44.2	9.3e-22
>prophage 6
CP026230	Aeromonas sp. ASNIH1 plasmid pKPC-038c, complete sequence	77569	67817	75463	77569	transposase	Salmonella_phage(60.0%)	6	NA	NA
AUZ82755.1|67817_68843_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AUZ82756.1|68839_69619_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AUZ82757.1|70005_70887_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AUZ82758.1|71802_72834_-|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
AUZ82759.1|73061_74639_-	chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
AUZ82760.1|74902_75463_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.8e-50
