The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026383	Serratia sp. SSNIH1 chromosome, complete genome	5268864	2151968	2159326	5268864	transposase	Enterobacteria_phage(33.33%)	6	NA	NA
AUY14226.1|2151968_2153393_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.5	6.9e-53
AUY14227.1|2153407_2154775_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	28.8	4.0e-34
AUY14228.1|2155144_2156158_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	47.9	3.8e-82
AUY14229.1|2156395_2157503_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.5	1.5e-47
AUY14230.1|2157910_2158444_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.2	4.4e-53
AUY14231.1|2158444_2159326_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	35.8	6.4e-41
>prophage 2
CP026383	Serratia sp. SSNIH1 chromosome, complete genome	5268864	2673463	2696532	5268864	coat,protease	Moraxella_phage(50.0%)	20	NA	NA
AUY14691.1|2673463_2674396_-|coat	spore coat protein	coat	NA	NA	NA	NA
AUY17036.1|2674415_2676758_-	hypothetical protein	NA	NA	NA	NA	NA
AUY14692.1|2676909_2677677_-	molecular chaperone	NA	NA	NA	NA	NA
AUY14693.1|2677698_2678241_-|coat	spore coat protein U	coat	NA	NA	NA	NA
AUY14694.1|2678234_2678738_-|coat	spore coat protein U	coat	NA	NA	NA	NA
AUY14695.1|2678740_2679277_-|coat	spore coat protein	coat	NA	NA	NA	NA
AUY14696.1|2679550_2680087_-|coat	spore coat protein	coat	NA	NA	NA	NA
AUY14697.1|2680359_2681796_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AUY17038.1|2681898_2684529_-	MCE family protein	NA	NA	NA	NA	NA
AUY17037.1|2684497_2685745_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AUY14698.1|2686000_2686498_+	Free methionine-R-sulfoxide reductase	NA	NA	NA	NA	NA
AUY14699.1|2686594_2687305_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
AUY14700.1|2687324_2689373_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.9	2.6e-85
AUY14701.1|2689440_2690286_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AUY14702.1|2690282_2691590_-	DUF2338 domain-containing protein	NA	NA	NA	NA	NA
AUY14703.1|2691582_2692380_-	nicotianamine synthase	NA	NA	NA	NA	NA
AUY14704.1|2692367_2693153_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.9	1.2e-09
AUY14705.1|2693149_2694190_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AUY14706.1|2694192_2695284_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUY14707.1|2695653_2696532_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 3
CP026383	Serratia sp. SSNIH1 chromosome, complete genome	5268864	4062715	4083137	5268864	tail,holin	Enterobacteria_phage(27.78%)	23	NA	NA
AUY15878.1|4062715_4062958_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	82.3	5.8e-29
AUY15879.1|4064608_4065415_-	hypothetical protein	NA	I7H419	Xanthomonas_virus	35.0	1.2e-09
AUY15880.1|4065796_4069348_-	host specificity protein	NA	F1C571	Cronobacter_phage	65.0	0.0e+00
AUY15881.1|4069402_4070029_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	50.5	1.7e-48
AUY15882.1|4070071_4070422_-	hypothetical protein	NA	NA	NA	NA	NA
AUY15883.1|4070459_4071164_-	peptidase P60	NA	K7PGR2	Enterobacteria_phage	74.0	3.8e-105
AUY17109.1|4071173_4071923_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	64.5	3.8e-95
AUY15884.1|4071936_4072275_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	60.0	1.1e-33
AUY15885.1|4072274_4074566_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	43.1	2.2e-16
AUY15886.1|4074558_4074780_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	49.3	7.7e-12
AUY15887.1|4074797_4075163_-|tail	phage tail protein	tail	Q7Y401	Yersinia_phage	45.0	5.0e-24
AUY15888.1|4075286_4075742_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	74.8	1.2e-56
AUY15889.1|4075783_4076176_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	47.6	7.2e-21
AUY15890.1|4076172_4076562_-	hypothetical protein	NA	Q7Y405	Yersinia_phage	42.9	2.2e-25
AUY15891.1|4076619_4077060_-	lysozyme	NA	A0A0M5M782	Salmonella_phage	62.3	8.9e-44
AUY15892.1|4077046_4077367_-|holin	holin	holin	F1C5D1	Cronobacter_phage	81.0	2.5e-40
AUY17110.1|4078160_4078523_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	64.6	1.6e-38
AUY15893.1|4078732_4079410_+	S26 family signal peptidase	NA	K7PK07	Enterobacteria_phage	45.7	6.0e-07
AUY15894.1|4079836_4080166_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AUY15895.1|4080293_4080761_-	DUF1348 domain-containing protein	NA	NA	NA	NA	NA
AUY15896.1|4080868_4081447_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUY15897.1|4081440_4081857_-	glyoxalase	NA	NA	NA	NA	NA
AUY15898.1|4082006_4083137_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	53.3	5.7e-103
>prophage 4
CP026383	Serratia sp. SSNIH1 chromosome, complete genome	5268864	5202865	5226963	5268864	transposase	Burkholderia_phage(33.33%)	7	NA	NA
AUY16868.1|5202865_5204071_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	51.1	1.4e-102
AUY16869.1|5204215_5204557_-	hypothetical protein	NA	NA	NA	NA	NA
AUY16870.1|5204804_5205710_+	lipid A hydroxylase LpxO	NA	S4VR59	Pandoravirus	38.4	8.8e-38
AUY16871.1|5206007_5206928_+	lipid A biosynthesis palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	52.3	6.4e-76
AUY17175.1|5207047_5207743_+	hypothetical protein	NA	A0A0R6PHX8	Moraxella_phage	27.1	5.8e-21
AUY16872.1|5207753_5208959_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	50.9	1.2e-101
AUY16873.1|5209110_5226963_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.6	2.4e-163
>prophage 1
CP026385	Serratia sp. SSNIH1 plasmid pKPC-56ce, complete sequence	82860	0	11829	82860		Klebsiella_phage(25.0%)	19	NA	NA
AUY17219.1|532_853_-	chromosome segregation protein ParM	NA	NA	NA	NA	NA
AUY17303.1|997_1237_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17220.1|1703_1913_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17221.1|1915_2134_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17222.1|2178_2862_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17223.1|2878_4153_-	RelB antitoxin	NA	NA	NA	NA	NA
AUY17224.1|4679_5036_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17225.1|5013_5592_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17226.1|5593_6001_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17227.1|6153_6699_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17228.1|6834_7296_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17229.1|7292_7541_+	XRE family transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	56.9	1.2e-10
AUY17230.1|7533_8121_+	restriction endonuclease	NA	NA	NA	NA	NA
AUY17231.1|8117_8603_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17232.1|8599_8848_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17233.1|8866_9607_+	resolvase	NA	I3WFA4	Macacine_betaherpesvirus	51.6	9.5e-22
AUY17234.1|9847_10822_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	52.0	6.1e-85
AUY17235.1|10824_11268_+	plasmid stability family protein	NA	NA	NA	NA	NA
AUY17236.1|11277_11829_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	32.0	1.7e-20
>prophage 2
CP026385	Serratia sp. SSNIH1 plasmid pKPC-56ce, complete sequence	82860	15074	18078	82860		Salmonella_phage(50.0%)	3	NA	NA
AUY17243.1|15074_16358_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	41.2	1.5e-62
AUY17244.1|16965_17145_+	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
AUY17245.1|17217_18078_+	DUF4942 domain-containing protein	NA	I6RTT5	Marinomonas_phage	30.4	5.6e-18
>prophage 3
CP026385	Serratia sp. SSNIH1 plasmid pKPC-56ce, complete sequence	82860	21747	22182	82860		Pseudomonas_phage(100.0%)	1	NA	NA
AUY17253.1|21747_22182_+	single-stranded DNA-binding protein	NA	A0A0U4K5C0	Pseudomonas_phage	48.8	7.5e-27
>prophage 4
CP026385	Serratia sp. SSNIH1 plasmid pKPC-56ce, complete sequence	82860	52558	73922	82860	transposase,integrase	Escherichia_phage(36.36%)	19	72645:72704	73954:74095
AUY17278.1|52558_55456_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AUY17279.1|55550_56156_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AUY17280.1|56469_57789_+|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AUY17281.1|58038_58920_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AUY17282.1|59444_60149_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUY17283.1|60139_60322_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17284.1|60285_61146_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AUY17285.1|61166_61928_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AUY17286.1|63713_64976_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AUY17287.1|65139_65457_+	hypothetical protein	NA	NA	NA	NA	NA
AUY17288.1|65465_66110_-	quinolone resistance pentapeptide repeat protein QnrB19	NA	NA	NA	NA	NA
AUY17289.1|66787_67492_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AUY17290.1|67849_68407_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
AUY17308.1|68640_69195_+	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
AUY17291.1|69264_70053_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AUY17309.1|70112_70937_+	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
AUY17292.1|71636_72497_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
72645:72704	attL	TAGACAAGAAAGTCCGTTAAGTGCCAATTTTCGATTAAAAAGACACCGTTTTGATGGCGT	NA	NA	NA	NA
AUY17310.1|72892_73426_-	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
AUY17293.1|73574_73922_+|integrase	class 1 integron integrase IntI1	integrase	NA	NA	NA	NA
73954:74095	attR	TAGACAAGAAAGTCCGTTAAGTGCCAATTTTCGATTAAAAAGACACCGTTTTGATGGCGTTTTCCAATGTACATTATGTTTCGATATATCAGACAGTTACTTCACTAACGTACGTTTTCGTTCTATTGGCCTTCAGACCCCT	NA	NA	NA	NA
>prophage 5
CP026385	Serratia sp. SSNIH1 plasmid pKPC-56ce, complete sequence	82860	80831	82519	82860		Morganella_phage(100.0%)	2	NA	NA
AUY17300.1|80831_81266_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	55.3	2.1e-29
AUY17301.1|81214_82519_+	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	50.6	1.3e-111
>prophage 1
CP026384	Serratia sp. SSNIH1 plasmid pSER-840e, complete sequence	36870	0	3097	36870		Enterobacteria_phage(100.0%)	2	NA	NA
AUY17179.1|512_1193_-	hypothetical protein	NA	NA	NA	NA	NA
AUY17180.1|2545_3097_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	78.5	6.7e-73
>prophage 2
CP026384	Serratia sp. SSNIH1 plasmid pSER-840e, complete sequence	36870	8101	8659	36870		Shigella_phage(100.0%)	1	NA	NA
AUY17183.1|8101_8659_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
>prophage 3
CP026384	Serratia sp. SSNIH1 plasmid pSER-840e, complete sequence	36870	16676	17268	36870		Escherichia_phage(50.0%)	2	NA	NA
AUY17192.1|16676_16958_-	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
AUY17193.1|16938_17268_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
>prophage 4
CP026384	Serratia sp. SSNIH1 plasmid pSER-840e, complete sequence	36870	31722	32028	36870		Klebsiella_phage(100.0%)	1	NA	NA
AUY17210.1|31722_32028_+	dpoa decarboxylase	NA	A0A248SL90	Klebsiella_phage	39.4	5.4e-08
>prophage 5
CP026384	Serratia sp. SSNIH1 plasmid pSER-840e, complete sequence	36870	35344	35818	36870		Moraxella_phage(100.0%)	1	NA	NA
AUY17214.1|35344_35818_+	nuclease	NA	A0A0R6PHV6	Moraxella_phage	38.0	1.1e-18
