The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024311	Rhizobium sp. NXC24 chromosome, complete genome	4162445	1514287	1557089	4162445	head,tail,tRNA,terminase,portal,integrase	Pseudomonas_phage(20.0%)	41	1539006:1539055	1557105:1557154
AVA21159.1|1514287_1514575_+|tRNA	aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C	tRNA	NA	NA	NA	NA
AVA21160.1|1514631_1516113_+|tRNA	aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit A	tRNA	NA	NA	NA	NA
AVA21161.1|1516187_1516445_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21162.1|1516744_1517254_+	GCN5-related N-acetyltransferase protein	NA	NA	NA	NA	NA
AVA21163.1|1517331_1518837_+|tRNA	aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B	tRNA	NA	NA	NA	NA
AVA21164.1|1518843_1519344_+	GCN5-related N-acetyltransferase protein	NA	NA	NA	NA	NA
AVA21165.1|1520049_1520517_+	GCN5-related N-acetyltransferase protein	NA	NA	NA	NA	NA
AVA21166.1|1520622_1521021_+	NADH dehydrogenase (ubiquinone) protein	NA	NA	NA	NA	NA
AVA21167.1|1521125_1521566_+	hypothetical protein	NA	NA	NA	NA	NA
AVA21168.1|1521647_1522316_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21169.1|1522320_1522488_+	hypothetical protein	NA	NA	NA	NA	NA
AVA21170.1|1522651_1523608_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21171.1|1523678_1524302_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVA21172.1|1524305_1525652_-	acetyl-CoA carboxylase biotin carboxylase subunit AccC 1	NA	NA	NA	NA	NA
AVA21173.1|1525663_1526134_-	acetyl-CoA carboxylase biotin carboxyl carrier subunit AccB 1	NA	NA	NA	NA	NA
AVA21174.1|1526157_1526595_-	3-dehydroquinate dehydratase 1	NA	NA	NA	NA	NA
AVA21175.1|1526821_1527589_-	DSBA-like thioredoxin protein	NA	NA	NA	NA	NA
AVA21176.1|1527800_1528958_+	aspartate aminotransferase protein	NA	NA	NA	NA	NA
AVA21177.1|1529170_1532047_-	ribonuclease E/G protein	NA	NA	NA	NA	NA
AVA21178.1|1532026_1532242_+	hypothetical protein	NA	NA	NA	NA	NA
AVA21179.1|1532788_1533967_+	N-acetylmuramoyl-l-alanine amidase protein	NA	NA	NA	NA	NA
AVA21180.1|1534227_1536693_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
AVA21181.1|1536922_1537951_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	40.0	1.7e-05
AVA21182.1|1538039_1538813_-	NAD(+) kinase	NA	NA	NA	NA	NA
1539006:1539055	attL	CCTGATTTGTAATCAGGGGGTCGCGGGTTCGAACCCTGCCGGGGGCACCA	NA	NA	NA	NA
AVA21183.1|1539969_1540416_+	hypothetical protein	NA	NA	NA	NA	NA
AVA21184.1|1540933_1542838_+	acyltransferase 3 family protein	NA	B5WZU0	Pseudomonas_phage	37.0	1.5e-50
AVA21185.1|1542823_1545007_-	hypothetical protein	NA	A0A076G7H5	Sinorhizobium_phage	62.1	6.8e-60
AVA21186.1|1545294_1546917_-|terminase	phage terminase large subunit protein	terminase	Q6DMU3	Streptococcus_phage	34.9	2.6e-80
AVA21187.1|1546885_1547287_-|terminase	phage terminase small subunit protein	terminase	NA	NA	NA	NA
AVA21188.1|1547286_1547580_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	33.3	1.7e-06
AVA21189.1|1547902_1548262_-	hypothetical protein	NA	Q38456	Bacillus_phage	48.9	2.1e-14
AVA21190.1|1548413_1548794_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21191.1|1548862_1550410_-|head	HK97 family prohead peptidase protein	head	A0A0K1LLG2	Bacillus_phage	31.4	9.5e-32
AVA21192.1|1550406_1551621_-|portal	phage portal protein	portal	M1PLL1	Streptococcus_phage	31.7	1.1e-40
AVA21193.1|1551601_1552213_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21194.1|1552289_1553168_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21195.1|1553335_1554985_-	AAA ATPase domain-containing protein	NA	A0A1B2LRQ1	Wolbachia_phage	41.5	1.6e-37
AVA21196.1|1554965_1555235_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21197.1|1555255_1555465_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21198.1|1555461_1555677_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21199.1|1555850_1557089_+|integrase	integrase family protein	integrase	Q9ZWV7	Corynephage	22.6	1.1e-11
1557105:1557154	attR	CCTGATTTGTAATCAGGGGGTCGCGGGTTCGAACCCTGCCGGGGGCACCA	NA	NA	NA	NA
>prophage 2
CP024311	Rhizobium sp. NXC24 chromosome, complete genome	4162445	1614158	1685562	4162445	holin,transposase,protease	uncultured_Mediterranean_phage(22.22%)	60	NA	NA
AVA21267.1|1614158_1615562_+|protease	serine protease Do 2	protease	A0A1B1IRH0	uncultured_Mediterranean_phage	33.3	6.8e-13
AVA21268.1|1615558_1616875_+	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	38.2	1.2e-75
AVA21269.1|1616883_1617216_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21270.1|1617326_1617629_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21271.1|1617625_1617880_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21272.1|1617964_1618906_-	dihydrodipicolinate synthase 2	NA	NA	NA	NA	NA
AVA21273.1|1618918_1619293_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21274.1|1619319_1620336_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AVA21275.1|1620649_1622098_+	hypothetical protein	NA	NA	NA	NA	NA
AVA21276.1|1622075_1622894_+	hypothetical protein	NA	NA	NA	NA	NA
AVA21277.1|1622893_1623919_+	hypothetical protein	NA	NA	NA	NA	NA
AVA21278.1|1623918_1624926_+	OmpA/MotB family outer membrane protein	NA	NA	NA	NA	NA
AVA21279.1|1624950_1626573_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	6.2e-58
AVA21280.1|1626804_1627932_+	hypothetical protein	NA	NA	NA	NA	NA
AVA21281.1|1628199_1629999_-	TniQ family protein	NA	NA	NA	NA	NA
AVA21282.1|1630007_1631075_-	AAA ATPase domain-containing protein	NA	NA	NA	NA	NA
AVA21283.1|1631090_1633322_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21284.1|1633333_1634176_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21285.1|1634305_1634563_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21286.1|1635326_1637633_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AVA21287.1|1637738_1638785_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21288.1|1639467_1639896_+|transposase	IS66 family insertion sequence transposase protein	transposase	NA	NA	NA	NA
AVA21289.1|1639892_1640243_+|transposase	IS66 family insertion sequence transposase protein	transposase	A0A0P0ZDM8	Stx2-converting_phage	56.7	1.8e-31
AVA21290.1|1640290_1641934_+|transposase	IS66 family insertion sequence transposase protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	41.9	1.5e-99
AVA21291.1|1641902_1642148_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21292.1|1642189_1642354_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21293.1|1643342_1643975_+	cell wall glycoside hydrolase family 25 protein	NA	NA	NA	NA	NA
AVA21294.1|1644194_1645706_+	hypothetical protein	NA	NA	NA	NA	NA
AVA21295.1|1645756_1646200_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21296.1|1646320_1647460_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21297.1|1647460_1647919_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21298.1|1648058_1648493_-	HAD-like domain-containing protein	NA	A0A2I6PFA6	Proteus_phage	34.0	1.8e-17
AVA21299.1|1648498_1648690_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21300.1|1648777_1650145_+	AAA domain-containing protein	NA	NA	NA	NA	NA
AVA21301.1|1650147_1650624_+	very short patch repair endonuclease Vsr protein	NA	E5E3X5	Burkholderia_phage	49.2	4.2e-31
AVA21302.1|1650734_1651790_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21303.1|1652514_1653567_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21304.1|1653563_1655843_-	AAA domain-containing protein	NA	NA	NA	NA	NA
AVA21305.1|1656205_1660954_-	helicase/restriction endonuclease domain-containing protein	NA	NA	NA	NA	NA
AVA21306.1|1661095_1662370_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21307.1|1663031_1664240_+	peptidase PDZ domain-containing protein	NA	A0A1B1IRH0	uncultured_Mediterranean_phage	31.2	1.5e-13
AVA21308.1|1664425_1664749_+	hypothetical protein	NA	NA	NA	NA	NA
AVA21309.1|1664784_1665306_+	hypothetical protein	NA	NA	NA	NA	NA
AVA21310.1|1665562_1666261_+	hypothetical protein	NA	NA	NA	NA	NA
AVA21311.1|1666323_1667346_+	hypothetical protein	NA	NA	NA	NA	NA
AVA21312.1|1667396_1668554_+	hypothetical protein	NA	NA	NA	NA	NA
AVA21313.1|1669029_1669749_-	GntR family transcriptional regulator protein	NA	NA	NA	NA	NA
AVA21314.1|1670027_1670789_+	class II aldolase/adducin domain-containing protein	NA	NA	NA	NA	NA
AVA21315.1|1670867_1671947_+	AraC family transcriptional regulator protein	NA	NA	NA	NA	NA
AVA21316.1|1671975_1672968_-|holin	choline sulfate-utilization transcription factor protein	holin	NA	NA	NA	NA
AVA21317.1|1673208_1674018_-	short-chain dehydrogenase/reductase SDR family protein	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.6	2.6e-17
AVA21318.1|1674029_1674812_-	short-chain dehydrogenase/reductase SDR family protein	NA	NA	NA	NA	NA
AVA21319.1|1674850_1677298_-	glycine-cleavage system T/FAD dependent oxidoreductase domain-containing protein	NA	NA	NA	NA	NA
AVA21320.1|1677311_1678325_-	Zn-dependent alcohol dehydrogenase GroES-like protein	NA	NA	NA	NA	NA
AVA21321.1|1678338_1679844_-	aldehyde dehydrogenase protein	NA	NA	NA	NA	NA
AVA21322.1|1679906_1680791_-	dihydrodipicolinate synthetase-like protein	NA	NA	NA	NA	NA
AVA21323.1|1680820_1682194_-	FAD dependent oxidoreductase protein	NA	NA	NA	NA	NA
AVA21324.1|1682760_1683603_-	proline/glycine betaine ABC transporter permease protein	NA	NA	NA	NA	NA
AVA21325.1|1683602_1684448_-	proline/glycine betaine ABC transporter permease protein	NA	NA	NA	NA	NA
AVA21326.1|1684470_1685562_-|holin	proline/glycine betaine/choline ABC transporter ATP-binding protein	holin	NA	NA	NA	NA
>prophage 3
CP024311	Rhizobium sp. NXC24 chromosome, complete genome	4162445	1773833	1783389	4162445	tRNA	uncultured_Mediterranean_phage(88.89%)	10	NA	NA
AVA21398.1|1773833_1774847_+	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	42.6	1.6e-24
AVA21399.1|1775018_1775816_+	chromosome segregation and condensation ScpA-like protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	36.4	3.4e-33
AVA21400.1|1775856_1776555_+	chromosome segregation/condensation ScpB-like protein	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	44.7	8.0e-39
AVA21401.1|1776790_1776994_+	Sec-independent protein translocase protein TatA	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	64.7	9.5e-09
AVA21402.1|1777049_1777739_+	Sec-independent protein translocase protein TatB	NA	NA	NA	NA	NA
AVA21403.1|1777735_1778563_+	Sec-independent protein translocase protein TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	44.9	3.0e-48
AVA21404.1|1778663_1779947_+|tRNA	seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.0	3.8e-95
AVA21405.1|1780019_1780793_+	5'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	29.8	2.4e-23
AVA21406.1|1780789_1781443_+	protein-L-isoaspartate O-methyltransferase 2	NA	A0A1B1IU40	uncultured_Mediterranean_phage	35.4	3.4e-15
AVA21407.1|1781613_1783389_+	peptidase M23 family protein	NA	I3PV24	Clostridium_phage	33.3	2.3e-13
>prophage 4
CP024311	Rhizobium sp. NXC24 chromosome, complete genome	4162445	1936902	1947412	4162445		uncultured_Mediterranean_phage(66.67%)	9	NA	NA
AVA21549.1|1936902_1939824_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	62.0	0.0e+00
AVA21550.1|1940126_1940687_+	single-stranded DNA-binding protein Ssb	NA	R9TP78	Rhizobium_phage	73.7	1.2e-45
AVA21551.1|1940762_1941395_-	multiple antibiotic resistance MarC-related protein	NA	NA	NA	NA	NA
AVA21552.1|1941620_1944425_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.6	7.3e-99
AVA21553.1|1945093_1945282_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21554.1|1945346_1945745_-	hypothetical protein	NA	NA	NA	NA	NA
AVA21555.1|1945763_1946267_+	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	37.2	4.8e-25
AVA21556.1|1946302_1946875_+	cyclophilin-type peptidylprolyl cis-trans isomerase 1	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	56.4	8.6e-47
AVA21557.1|1946902_1947412_+	cyclophilin-type peptidylprolyl cis-trans isomerase 2	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	61.0	1.0e-46
>prophage 5
CP024311	Rhizobium sp. NXC24 chromosome, complete genome	4162445	2592605	2605350	4162445	tail	Paracoccus_phage(50.0%)	10	NA	NA
AVA22174.1|2592605_2593238_-	glycoside hydrolase family 19 protein	NA	A0A0F6WBX9	Sinorhizobium_phage	60.8	4.8e-67
AVA22175.1|2593394_2593610_-	hypothetical protein	NA	NA	NA	NA	NA
AVA22176.1|2593622_2594276_-	hypothetical protein	NA	NA	NA	NA	NA
AVA22177.1|2594294_2594702_-	hypothetical protein	NA	NA	NA	NA	NA
AVA22178.1|2594703_2595135_-	hypothetical protein	NA	NA	NA	NA	NA
AVA22179.1|2595139_2601163_-|tail	phage tail protein	tail	G8DH58	Emiliania_huxleyi_virus	37.1	1.2e-111
AVA22180.1|2601269_2601695_-	hypothetical protein	NA	A0A0U2C0Z1	Paracoccus_phage	44.9	8.7e-20
AVA22181.1|2601691_2602315_-	hypothetical protein	NA	A0A0U2C133	Paracoccus_phage	34.6	4.4e-20
AVA22182.1|2602318_2602963_-	hypothetical protein	NA	A0A0U2BXF8	Paracoccus_phage	31.6	3.3e-15
AVA22183.1|2602962_2605350_-|tail	phage-related minor tail protein	tail	A0A291AUU3	Sinorhizobium_phage	41.8	4.1e-42
>prophage 6
CP024311	Rhizobium sp. NXC24 chromosome, complete genome	4162445	2608920	2617043	4162445	capsid,terminase	Rhizobium_phage(28.57%)	11	NA	NA
AVA22190.1|2608920_2609406_-	hypothetical protein	NA	W6EKF5	Rhizobium_phage	45.8	2.1e-30
AVA22191.1|2609409_2609841_-	bacteriophage-related domain-containing protein	NA	NA	NA	NA	NA
AVA22192.1|2609879_2610290_-	hypothetical protein	NA	NA	NA	NA	NA
AVA22193.1|2610329_2610542_-	hypothetical protein	NA	NA	NA	NA	NA
AVA22194.1|2610538_2610895_-	hypothetical protein	NA	NA	NA	NA	NA
AVA22195.1|2610894_2611392_-	hypothetical protein	NA	A0A076G6I4	Sinorhizobium_phage	40.9	3.6e-17
AVA22196.1|2611463_2612432_-|capsid	phage capsid family protein	capsid	A0A2H4J526	uncultured_Caudovirales_phage	72.0	3.2e-134
AVA22197.1|2612435_2612906_-	hypothetical protein	NA	A0A2H4J1G1	uncultured_Caudovirales_phage	58.6	1.6e-38
AVA22198.1|2612933_2614049_-	hypothetical protein	NA	A0A2R3UA67	Siphoviridae_environmental_samples	44.0	2.7e-73
AVA22199.1|2614143_2615511_-	phage-associated protein	NA	L7TRA1	Rhizobium_phage	49.4	1.2e-115
AVA22200.1|2615561_2617043_-|terminase	phage terminase large subunit protein	terminase	H9C0U8	Aeromonas_phage	43.3	6.4e-94
>prophage 7
CP024311	Rhizobium sp. NXC24 chromosome, complete genome	4162445	2882287	2891969	4162445		Myxococcus_phage(42.86%)	11	NA	NA
AVA22464.1|2882287_2884651_-	hypothetical protein	NA	Q94MR3	Myxococcus_phage	32.6	2.0e-12
AVA22465.1|2884667_2885681_-	hypothetical protein	NA	X2CY28	Brucella_phage	39.8	1.2e-27
AVA22466.1|2885664_2886063_-	N-acetyltransferase family protein	NA	NA	NA	NA	NA
AVA22467.1|2886059_2887622_-	hypothetical protein	NA	A0A088F6U1	Sulfitobacter_phage	31.3	2.7e-58
AVA22468.1|2887629_2887932_-	hypothetical protein	NA	NA	NA	NA	NA
AVA22469.1|2887949_2888594_-	hypothetical protein	NA	A0A0A8J9W2	Klebsiella_phage	49.5	4.2e-10
AVA22470.1|2888590_2889358_-	hypothetical protein	NA	A0A088FAT4	Sulfitobacter_phage	24.9	1.1e-07
AVA22471.1|2889373_2889964_-	hypothetical protein	NA	Q94MR9	Myxococcus_phage	29.6	9.5e-17
AVA22472.1|2890021_2890180_-	hypothetical protein	NA	NA	NA	NA	NA
AVA22473.1|2890181_2890970_-	hypothetical protein	NA	NA	NA	NA	NA
AVA22474.1|2890994_2891969_-	hypothetical protein	NA	Q94MS1	Myxococcus_phage	51.4	1.0e-84
>prophage 1
CP024313	Rhizobium sp. NXC24 plasmid pRspNXC24b, complete sequence	489086	232033	246985	489086	transposase	Streptococcus_phage(50.0%)	19	NA	NA
AVA24187.1|232033_232402_+|transposase	IS66 family insertion sequence transposase protein	transposase	A0A1B0YZU7	Pseudomonas_phage	40.3	4.0e-05
AVA24188.1|232398_232746_+|transposase	IS66 family insertion sequence transposase protein	transposase	A0A0P0ZBY2	Stx2-converting_phage	54.3	1.1e-25
AVA24189.1|233791_234322_+	hypothetical protein	NA	NA	NA	NA	NA
AVA24190.1|235055_237125_-	resolvase/recombinase protein	NA	K4JU73	Streptococcus_phage	21.0	2.0e-08
AVA24191.1|237111_237291_-	hypothetical protein	NA	NA	NA	NA	NA
AVA24192.1|237292_237676_+	hypothetical protein	NA	NA	NA	NA	NA
AVA24193.1|237830_238172_+	hypothetical protein	NA	NA	NA	NA	NA
AVA24194.1|238168_238348_+	hypothetical protein	NA	NA	NA	NA	NA
AVA24195.1|238392_239634_-	biotin carboxylase-like ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AVA24196.1|239699_240548_-	glutamate 5-kinase 2	NA	A0A1X9I5D0	Streptococcus_phage	35.9	2.0e-39
AVA24197.1|240705_241980_-	biotin carboxylase-like ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AVA24198.1|242216_242645_+|transposase	IS66 family insertion sequence transposase protein	transposase	NA	NA	NA	NA
AVA24199.1|242641_242893_+|transposase	IS66 family insertion sequence transposase domain-containing protein	transposase	NA	NA	NA	NA
AVA24200.1|242863_244981_-	resolvase/recombinase protein	NA	NA	NA	NA	NA
AVA24201.1|244977_245259_-	hypothetical protein	NA	NA	NA	NA	NA
AVA24202.1|245273_245753_-|transposase	IS630 family insertion sequence transposase domain-containing protein	transposase	NA	NA	NA	NA
AVA24203.1|245808_245985_+	hypothetical protein	NA	NA	NA	NA	NA
AVA24204.1|245961_246189_-	hypothetical protein	NA	NA	NA	NA	NA
AVA24205.1|246424_246985_+|transposase	IS66 family insertion sequence transposase domain-containing protein	transposase	NA	NA	NA	NA
>prophage 2
CP024313	Rhizobium sp. NXC24 plasmid pRspNXC24b, complete sequence	489086	250151	269921	489086	transposase	Stx2-converting_phage(50.0%)	18	NA	NA
AVA24209.1|250151_250529_-|transposase	IS110 family insertion sequence transposase domain-containing protein	transposase	NA	NA	NA	NA
AVA24210.1|251038_251827_+	rhamnosyl O-methyltransferase/cephalosporin hydroxylase protein	NA	NA	NA	NA	NA
AVA24211.1|253262_254603_+	nitrilotriacetate monooxygenase component A protein	NA	NA	NA	NA	NA
AVA24212.1|255183_255606_+|transposase	IS3 family insertion sequence transposase domain-containing protein	transposase	NA	NA	NA	NA
AVA24213.1|255602_256472_+|transposase	IS3 family insertion sequence transposase protein	transposase	U5P429	Shigella_phage	35.9	2.8e-33
AVA24214.1|256967_257852_-	RpiR family transcriptional regulator protein	NA	NA	NA	NA	NA
AVA24215.1|258080_259406_+	aminotransferase family protein	NA	NA	NA	NA	NA
AVA24216.1|259416_259968_+	carboxymuconolactone decarboxylase protein	NA	NA	NA	NA	NA
AVA24217.1|260155_260989_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVA24218.1|261045_262020_+	amino acid ABC transporter permease protein	NA	NA	NA	NA	NA
AVA24219.1|262136_262880_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	3.4e-27
AVA24220.1|263582_264419_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVA24221.1|264535_264739_-	hypothetical protein	NA	NA	NA	NA	NA
AVA24222.1|264737_265964_+	endoribonuclease L-PSP protein	NA	NA	NA	NA	NA
AVA24223.1|266111_267254_+	L-lactate dehydrogenase (cytochrome) protein	NA	NA	NA	NA	NA
AVA24224.1|267578_267941_+|transposase	IS66 family insertion sequence transposase protein	transposase	NA	NA	NA	NA
AVA24225.1|267937_268285_+|transposase	IS66 family insertion sequence transposase protein	transposase	A0A0P0ZBY2	Stx2-converting_phage	53.9	7.8e-27
AVA24226.1|268355_269921_+|transposase	IS66 family insertion sequence transposase protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.0	7.2e-112
>prophage 3
CP024313	Rhizobium sp. NXC24 plasmid pRspNXC24b, complete sequence	489086	325724	355473	489086	transposase,protease	Leptospira_phage(40.0%)	28	NA	NA
AVA24269.1|325724_327323_-|transposase	IS66 family insertion sequence transposase protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	35.5	3.0e-73
AVA24270.1|327398_327743_-|transposase	IS66 family insertion sequence transposase protein	transposase	NA	NA	NA	NA
AVA24271.1|327739_328111_-|transposase	IS66 family insertion sequence transposase protein	transposase	NA	NA	NA	NA
AVA24272.1|328533_328716_+	hypothetical protein	NA	NA	NA	NA	NA
AVA24273.1|328869_329418_-	hypothetical protein	NA	NA	NA	NA	NA
AVA24274.1|329495_330902_+	radical SAM domain-containing protein	NA	S5VT21	Leptospira_phage	25.9	3.3e-31
AVA24275.1|330898_331981_+	radical SAM domain-containing protein	NA	S5WIP3	Leptospira_phage	32.6	1.8e-45
AVA24276.1|331977_332604_+	peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AVA24277.1|332643_333795_+|protease	Clp protease family protein	protease	NA	NA	NA	NA
AVA24278.1|333799_334555_-	hypothetical protein	NA	NA	NA	NA	NA
AVA24279.1|334557_336468_-	protein kinase-like domain-containing protein	NA	NA	NA	NA	NA
AVA24280.1|336464_337235_-	protein phosphatase 2C-like protein	NA	NA	NA	NA	NA
AVA24281.1|337231_337912_-	tellurite resistance TerY protein	NA	NA	NA	NA	NA
AVA24282.1|337899_338121_+	hypothetical protein	NA	NA	NA	NA	NA
AVA24283.1|338446_338812_+	hypothetical protein	NA	NA	NA	NA	NA
AVA24284.1|338831_339233_+	hypothetical protein	NA	NA	NA	NA	NA
AVA24285.1|339431_340853_+|transposase	ISNCY family insertion sequence transposase protein	transposase	NA	NA	NA	NA
AVA24286.1|340859_341597_-	hypothetical protein	NA	NA	NA	NA	NA
AVA24287.1|341951_343241_-	HipA-like protein	NA	NA	NA	NA	NA
AVA24288.1|343240_343588_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AVA24289.1|343759_343948_-	hypothetical protein	NA	NA	NA	NA	NA
AVA24290.1|343974_344229_-	hypothetical protein	NA	NA	NA	NA	NA
AVA24291.1|344241_345057_-	pyrroline-5-carboxylate reductase protein	NA	NA	NA	NA	NA
AVA24292.1|345166_345673_-	hypothetical protein	NA	NA	NA	NA	NA
AVA24293.1|345900_352365_+	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	24.0	7.1e-113
AVA24294.1|352361_353771_+	multi antimicrobial extrusion MatE family protein	NA	NA	NA	NA	NA
AVA24295.1|353958_354645_+	4'-phosphopantetheinyl transferase protein	NA	NA	NA	NA	NA
AVA24296.1|354942_355473_+|transposase	IS6 family insertion sequence transposase domain-containing protein	transposase	A0A077SL39	Escherichia_phage	61.5	3.3e-37
>prophage 1
CP024314	Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence	2379650	427313	471513	2379650	transposase	uncultured_virus(16.67%)	53	NA	NA
AVA24824.1|427313_428147_+|transposase	IS5 family insertion sequence transposase protein	transposase	NA	NA	NA	NA
AVA24825.1|428412_428727_+	chaperonin GroES 3	NA	A0A221S4G8	uncultured_virus	54.3	2.0e-21
AVA24826.1|428767_430396_+	chaperonin GroEL 3	NA	A0A219YK78	uncultured_virus	63.5	1.9e-179
AVA24827.1|430491_430908_+	hypothetical protein	NA	NA	NA	NA	NA
AVA24828.1|430997_432092_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AVA24829.1|432468_432942_+	HSP20 family heat shock protein	NA	E3SM62	Prochlorococcus_phage	38.3	8.7e-21
AVA24830.1|433036_433546_+	HSP20 family heat shock protein	NA	A0A1B2LRT2	Wolbachia_phage	37.4	3.1e-16
AVA24831.1|433722_434034_+	hypothetical protein	NA	NA	NA	NA	NA
AVA24832.1|434893_435706_+	short-chain dehydrogenase domain-containing protein	NA	NA	NA	NA	NA
AVA24833.1|435692_436121_+	glutathione S-transferase domain-containing protein	NA	NA	NA	NA	NA
AVA24834.1|436188_437190_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
AVA24835.1|437220_438195_+	LysR family transcriptional regulator protein	NA	NA	NA	NA	NA
AVA24836.1|438340_439663_-	D-serine dehydratase	NA	NA	NA	NA	NA
AVA24837.1|439709_440468_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	6.7e-31
AVA24838.1|440493_441618_-	amino acid ABC transporter permease protein	NA	NA	NA	NA	NA
AVA24839.1|441614_442826_-	amino acid ABC transporter permease protein	NA	NA	NA	NA	NA
AVA24840.1|442886_443918_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	35.4	4.4e-49
AVA24841.1|444219_445116_-	LysR family transcriptional regulator protein	NA	NA	NA	NA	NA
AVA24842.1|445240_446518_+	serine hydroxymethyltransferase 2	NA	A0A240F3L3	Aeromonas_phage	46.6	1.0e-87
AVA24843.1|446632_447529_+	bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/cyclohydrolase FolD 2	NA	A0A249XZQ2	Enterococcus_phage	34.3	7.9e-23
AVA24844.1|447550_448450_+	formyltetrahydrofolate deformylase 3	NA	M4QRX9	Synechococcus_phage	34.3	3.5e-10
AVA24845.1|448702_449227_-	hypothetical protein	NA	NA	NA	NA	NA
AVA24846.1|449448_449958_-	hypothetical protein	NA	NA	NA	NA	NA
AVA24847.1|450176_450644_-	activator of Hsp90 ATPase 1 family protein	NA	NA	NA	NA	NA
AVA24848.1|450636_450984_-	ArsR family transcriptional regulator protein	NA	NA	NA	NA	NA
AVA24849.1|451407_451953_-	N-acetyltransferase family protein	NA	NA	NA	NA	NA
AVA24850.1|451952_452261_-	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
AVA24851.1|452360_452564_+	hypothetical protein	NA	NA	NA	NA	NA
AVA24852.1|452588_452843_+	hypothetical protein	NA	NA	NA	NA	NA
AVA24853.1|452839_453262_+	toxin/antitoxin system PilT domain-containing protein	NA	NA	NA	NA	NA
AVA24854.1|453774_454272_+	hypothetical protein	NA	NA	NA	NA	NA
AVA24855.1|454274_454772_+	hypothetical protein	NA	NA	NA	NA	NA
AVA24856.1|455079_455697_+	hypothetical protein	NA	NA	NA	NA	NA
AVA24857.1|455952_457467_-|transposase	ISNCY family insertion sequence transposase protein	transposase	NA	NA	NA	NA
AVA24858.1|457582_457810_+	hypothetical protein	NA	NA	NA	NA	NA
AVA24859.1|458110_458620_-	hypothetical protein	NA	NA	NA	NA	NA
AVA24860.1|458830_459334_-	activator of Hsp90 ATPase 1 family protein	NA	NA	NA	NA	NA
AVA24861.1|459424_460153_-	SMP-30/gluconolaconase/LRE domain-containing protein	NA	NA	NA	NA	NA
AVA24862.1|460593_460773_-	hypothetical protein	NA	NA	NA	NA	NA
AVA24863.1|460813_461065_-|transposase	IS21 family insertion sequence transposase domain-containing protein	transposase	NA	NA	NA	NA
AVA24864.1|461965_462160_+	hypothetical protein	NA	NA	NA	NA	NA
AVA24865.1|462213_462435_+	hypothetical protein	NA	NA	NA	NA	NA
AVA24866.1|462443_462998_-	L,D-transpeptidase domain-containing protein	NA	NA	NA	NA	NA
AVA24867.1|463008_463389_+	hypothetical protein	NA	NA	NA	NA	NA
AVA24868.1|463409_464474_-	ATP-dependent DNA ligase protein	NA	A0A068CDF3	Rhizobium_phage	66.1	1.4e-127
AVA24869.1|464477_465296_-	ATP-dependent DNA helicase Ku-type protein	NA	NA	NA	NA	NA
AVA24870.1|465308_466208_-	ATP-dependent DNA helicase Ku-type protein	NA	NA	NA	NA	NA
AVA24871.1|466902_467544_-	thioredoxin-like protein	NA	NA	NA	NA	NA
AVA24872.1|467749_468022_+	hypothetical protein	NA	NA	NA	NA	NA
AVA24873.1|468668_469892_+	P-loop NTPase domain-containing protein	NA	NA	NA	NA	NA
AVA24874.1|470108_470477_-|transposase	IS256 family insertion sequence transposase domain-containing protein	transposase	A0A220NQR7	Corynebacterium_phage	38.9	3.3e-15
AVA24875.1|470788_471169_+|transposase	IS66 family insertion sequence transposase protein	transposase	NA	NA	NA	NA
AVA24876.1|471165_471513_+|transposase	IS66 family insertion sequence transposase protein	transposase	S5VXZ8	Leptospira_phage	34.7	3.8e-13
>prophage 2
CP024314	Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence	2379650	1338793	1409008	2379650	transposase,holin	Stx2-converting_phage(22.22%)	62	NA	NA
AVA25702.1|1338793_1340470_+|holin	glucose-methanol-choline oxidoreductase protein	holin	NA	NA	NA	NA
AVA25703.1|1341004_1341910_+	hypothetical protein	NA	NA	NA	NA	NA
AVA25704.1|1342216_1343413_-	hypothetical protein	NA	NA	NA	NA	NA
AVA25705.1|1343685_1344360_+	AraC family transcriptional regulator domain-containing protein	NA	NA	NA	NA	NA
AVA25706.1|1344514_1345234_+	GntR family transcriptional regulator protein	NA	NA	NA	NA	NA
AVA25707.1|1345243_1346023_+	pyrroline-5-carboxylate reductase protein	NA	NA	NA	NA	NA
AVA25708.1|1346023_1346572_-	XRE family transcriptional regulator protein	NA	NA	NA	NA	NA
AVA25709.1|1346719_1348054_+	beta alanine--pyruvate transaminase protein	NA	NA	NA	NA	NA
AVA25710.1|1348243_1350184_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.2	4.9e-09
AVA25711.1|1350876_1351128_+	hypothetical protein	NA	NA	NA	NA	NA
AVA25712.1|1351124_1351523_+	toxin/antitoxin system PilT domain-containing protein	NA	NA	NA	NA	NA
AVA25713.1|1351807_1352008_-	hypothetical protein	NA	NA	NA	NA	NA
AVA25714.1|1352098_1352989_+	sulfate adenylyltransferase subunit 2	NA	NA	NA	NA	NA
AVA25715.1|1352988_1354896_+	bifunctional sulfate adenylyltransferase subunit 1/adenylylsulfate kinase	NA	A0A2K9L4R9	Tupanvirus	39.6	1.6e-25
AVA25716.1|1355833_1356664_+|transposase	IS66 family insertion sequence transposase domain-containing protein	transposase	A0A218MNE7	uncultured_virus	32.1	3.0e-24
AVA25717.1|1356660_1357224_+	hypothetical protein	NA	NA	NA	NA	NA
AVA25718.1|1357267_1357450_+	hypothetical protein	NA	NA	NA	NA	NA
AVA25719.1|1357461_1357758_-	hypothetical protein	NA	NA	NA	NA	NA
AVA25720.1|1357757_1359383_-|transposase	IS66 family insertion sequence transposase protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.6	2.5e-99
AVA25721.1|1359446_1359794_-|transposase	IS66 family insertion sequence transposase protein	transposase	S5VXZ8	Leptospira_phage	34.7	3.8e-13
AVA25722.1|1359790_1360174_-|transposase	IS66 family insertion sequence transposase protein	transposase	NA	NA	NA	NA
AVA25723.1|1360352_1360598_+	hypothetical protein	NA	NA	NA	NA	NA
AVA25724.1|1360566_1362210_-|transposase	IS66 family insertion sequence transposase protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	41.9	1.5e-99
AVA25725.1|1362257_1362608_-|transposase	IS66 family insertion sequence transposase protein	transposase	A0A0P0ZDM8	Stx2-converting_phage	56.7	1.8e-31
AVA25726.1|1362604_1363033_-|transposase	IS66 family insertion sequence transposase protein	transposase	NA	NA	NA	NA
AVA25727.1|1363582_1364428_-	NAD-dependent epimerase/dehydratase family protein	NA	M4QPK0	Synechococcus_phage	21.4	1.8e-08
AVA25728.1|1364424_1365651_-	methyltransferase domain-containing protein	NA	A0A1V0SJ68	Klosneuvirus	27.4	9.2e-30
AVA25729.1|1365647_1366199_-	dTDP-4-dehydrorhamnose 3,5-epimerase 2	NA	I7HJC4	Enterobacteria_phage	40.8	2.8e-26
AVA25730.1|1366195_1367272_-	CDP-glucose 4,6-dehydratase	NA	J7Q7J8	Aeropyrum_coil-shaped_virus	28.7	9.6e-15
AVA25731.1|1367274_1368042_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AVA25732.1|1368093_1369776_-	hypothetical protein	NA	NA	NA	NA	NA
AVA25733.1|1369772_1371074_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AVA25734.1|1371098_1372271_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AVA25735.1|1372280_1373198_-	glycosyltransferase family protein	NA	NA	NA	NA	NA
AVA25736.1|1373208_1374321_-	SAM-dependent methyltransferase protein	NA	NA	NA	NA	NA
AVA25737.1|1374317_1375643_-	polysaccharide ABC transporter Wzt-like ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	27.5	3.2e-12
AVA25738.1|1375639_1376434_-	polysaccharide ABC transporter permease protein	NA	NA	NA	NA	NA
AVA25739.1|1376475_1377429_-	NAD-dependent epimerase/dehydratase family protein	NA	M1NML0	Moumouvirus	30.9	9.0e-17
AVA25740.1|1377439_1378423_-	GDP-mannose 4,6-dehydratase	NA	M1HVB5	Paramecium_bursaria_Chlorella_virus	50.9	2.7e-88
AVA25741.1|1378441_1379623_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AVA25742.1|1379962_1381255_-	hypothetical protein	NA	NA	NA	NA	NA
AVA25743.1|1381278_1381803_-	hypothetical protein	NA	NA	NA	NA	NA
AVA25744.1|1381812_1384968_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AVA25745.1|1385347_1386157_+	ABC-2 type transporter permease protein	NA	NA	NA	NA	NA
AVA25746.1|1387180_1387462_+|transposase	IS3 family insertion sequence transposase domain-containing protein	transposase	S5WIU1	Leptospira_phage	42.0	4.8e-11
AVA25747.1|1387479_1387938_+|transposase	IS66 family insertion sequence transposase protein	transposase	A0A0P0ZBP6	Stx2-converting_phage	39.5	4.1e-07
AVA25748.1|1388158_1390258_-	resolvase/recombinase protein	NA	NA	NA	NA	NA
AVA25749.1|1390550_1391030_-|transposase	IS630 family insertion sequence transposase domain-containing protein	transposase	NA	NA	NA	NA
AVA25750.1|1391706_1393296_+|transposase	IS66 family insertion sequence transposase protein	transposase	NA	NA	NA	NA
AVA25751.1|1393315_1393690_+|transposase	IS3 family insertion sequence transposase domain-containing protein	transposase	S5WIU1	Leptospira_phage	47.1	2.6e-12
AVA25752.1|1393898_1395152_-	hypothetical protein	NA	NA	NA	NA	NA
AVA25753.1|1395193_1396321_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AVA25754.1|1396679_1397600_-	nucleotidyltransferase HEPN domain-containing protein	NA	NA	NA	NA	NA
AVA25755.1|1397876_1398584_-|transposase	IS3 family insertion sequence transposase domain-containing protein	transposase	NA	NA	NA	NA
AVA25756.1|1398618_1398885_-|transposase	IS3 family insertion sequence transposase protein	transposase	NA	NA	NA	NA
AVA25757.1|1399152_1400064_-|transposase	IS110 family insertion sequence transposase domain-containing protein	transposase	NA	NA	NA	NA
AVA25758.1|1400164_1400383_-	hypothetical protein	NA	NA	NA	NA	NA
AVA25759.1|1401781_1403455_-	hypothetical protein	NA	NA	NA	NA	NA
AVA25760.1|1403514_1404588_-	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	35.9	9.4e-47
AVA25761.1|1404722_1405892_-	acyltransferase 3 family protein	NA	NA	NA	NA	NA
AVA25762.1|1406186_1406477_-	hypothetical protein	NA	NA	NA	NA	NA
AVA25763.1|1408114_1409008_+|transposase	ISNCY family insertion sequence transposase domain-containing protein	transposase	NA	NA	NA	NA
>prophage 3
CP024314	Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence	2379650	1704330	1718873	2379650	transposase	Stx2-converting_phage(50.0%)	11	NA	NA
AVA26050.1|1704330_1704774_+|transposase	IS66 family insertion sequence transposase protein	transposase	NA	NA	NA	NA
AVA26051.1|1704770_1705124_+|transposase	IS66 family insertion sequence transposase protein	transposase	NA	NA	NA	NA
AVA26052.1|1705188_1706388_+|transposase	IS66 family insertion sequence transposase domain-containing protein	transposase	S5VTD3	Leptospira_phage	33.6	2.2e-28
AVA26053.1|1706369_1707665_-	reverse transcriptase protein	NA	A0A0U4J920	Pseudomonas_phage	41.0	3.4e-27
AVA26054.1|1708304_1708880_+|transposase	IS66 family insertion sequence transposase domain-containing protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	41.4	2.1e-32
AVA26055.1|1709563_1709917_-	hypothetical protein	NA	NA	NA	NA	NA
AVA26056.1|1711470_1716129_+	helicase/restriction endonuclease domain-containing protein	NA	NA	NA	NA	NA
AVA26057.1|1716274_1717261_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
AVA26058.1|1717543_1717825_+	hypothetical protein	NA	NA	NA	NA	NA
AVA26059.1|1718097_1718526_+|transposase	IS66 family insertion sequence transposase protein	transposase	NA	NA	NA	NA
AVA26060.1|1718522_1718873_+|transposase	IS66 family insertion sequence transposase protein	transposase	A0A0P0ZDM8	Stx2-converting_phage	56.7	1.8e-31
