The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	691736	736296	4021165	protease,tRNA,transposase	uncultured_Mediterranean_phage(23.08%)	43	NA	NA
AVA39076.1|691736_692810_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AVA39077.1|692990_694133_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.2	4.2e-93
AVA39078.1|694219_694555_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.9e-10
AVA39079.1|694587_696435_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
AVA39080.1|696445_697414_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	41.1	2.0e-48
AVA39081.1|697532_697982_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AVA39082.1|698030_699188_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	2.3e-51
AVA39083.1|699400_699871_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.7	1.6e-30
AVA39084.1|699899_700313_+	N utilization substance protein B	NA	NA	NA	NA	NA
AVA39085.1|700406_701387_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
AVA39086.1|701472_701808_-	hypothetical protein	NA	NA	NA	NA	NA
AVA39087.1|702280_702697_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	61.3	2.9e-44
AVA39088.1|702719_703928_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	81.5	1.1e-189
AVA39089.1|703950_704952_-	transcriptional regulator RbsR	NA	NA	NA	NA	NA
AVA39090.1|704965_705892_-	ribokinase	NA	NA	NA	NA	NA
AVA39091.1|705969_706860_-	ribose ABC transporter substrate-binding protein RbsB	NA	NA	NA	NA	NA
AVA39092.1|706899_707865_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
AVA39093.1|707866_709375_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	2.7e-15
AVA39094.1|709382_709802_-	D-ribose pyranase	NA	NA	NA	NA	NA
AVA39095.1|710142_712017_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AVA39096.1|712083_713007_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
AVA41994.1|713007_713271_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AVA39097.1|713470_714922_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
AVA39098.1|715227_715650_-	hypothetical protein	NA	NA	NA	NA	NA
AVA39099.1|716116_716734_-	protein deglycase YajL	NA	NA	NA	NA	NA
AVA39100.1|716702_717626_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AVA41995.1|717879_718371_+	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
AVA39101.1|718434_719805_-	MFS transporter	NA	NA	NA	NA	NA
AVA39102.1|719978_720863_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AVA39103.1|720874_721207_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
AVA39104.1|721206_721818_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AVA39105.1|721817_723800_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AVA39106.1|723804_724755_-	cytochrome o ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AVA39107.1|725251_726013_-	hypothetical protein	NA	NA	NA	NA	NA
AVA39108.1|726369_727743_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.3e-61
AVA39109.1|727842_729363_-	muropeptide transporter AmpG	NA	NA	NA	NA	NA
AVA39110.1|729421_730000_-	hypothetical protein	NA	NA	NA	NA	NA
AVA39111.1|730194_730611_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.0	2.6e-45
AVA41996.1|730633_731842_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	81.2	5.2e-187
AVA39112.1|732058_732373_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
AVA39113.1|732695_734000_+	trigger factor	NA	NA	NA	NA	NA
AVA39114.1|734256_734880_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	64.1	2.9e-64
AVA39115.1|735024_736296_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.8	7.3e-131
>prophage 2
CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	1071983	1083337	4021165		Mycobacterium_phage(25.0%)	12	NA	NA
AVA39380.1|1071983_1073183_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
AVA39381.1|1073792_1074761_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
AVA39382.1|1074786_1076913_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.2e-205
AVA39383.1|1076941_1077346_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	6.3e-12
AVA39384.1|1077357_1077582_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
AVA39385.1|1077863_1078337_+	cysteine methyltransferase	NA	NA	NA	NA	NA
AVA39386.1|1078501_1078744_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	6.9e-22
AVA39387.1|1079200_1079575_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
AVA39388.1|1079590_1080556_-	lipoyl synthase	NA	NA	NA	NA	NA
AVA39389.1|1080657_1081302_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
AVA42002.1|1081663_1081927_-	hypothetical protein	NA	NA	NA	NA	NA
AVA39390.1|1082125_1083337_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
>prophage 3
CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	1392986	1430708	4021165	portal,head,terminase,tRNA,holin,lysis	Pectobacterium_phage(21.62%)	52	NA	NA
AVA39647.1|1392986_1394162_-	recombinase	NA	A0A2H4J1K3	uncultured_Caudovirales_phage	30.1	2.7e-31
AVA39648.1|1394163_1394376_-	hypothetical protein	NA	NA	NA	NA	NA
AVA39649.1|1394350_1394548_-	hypothetical protein	NA	NA	NA	NA	NA
AVA39650.1|1394988_1395168_-	hypothetical protein	NA	NA	NA	NA	NA
AVA39651.1|1395215_1395716_-	hypothetical protein	NA	H9C156	Pectobacterium_phage	55.2	1.2e-39
AVA39652.1|1395715_1397683_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	39.4	8.4e-118
AVA39653.1|1397695_1397956_-	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	45.3	7.9e-08
AVA39654.1|1397955_1398288_-	hypothetical protein	NA	H9C158	Pectobacterium_phage	38.1	4.7e-05
AVA39655.1|1398744_1399503_-	XRE family transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	39.0	1.5e-27
AVA39656.1|1399607_1399865_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVA39657.1|1399905_1400361_+|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	55.4	9.9e-30
AVA39658.1|1400378_1400603_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	55.4	9.5e-18
AVA39659.1|1400604_1401435_+	replication protein	NA	H9C164	Pectobacterium_phage	59.3	4.4e-36
AVA39660.1|1401424_1402843_+	helicase DnaB	NA	H9C165	Pectobacterium_phage	60.8	6.8e-170
AVA39661.1|1402897_1403074_+	palmdelphin	NA	NA	NA	NA	NA
AVA39662.1|1403076_1403310_+	hypothetical protein	NA	NA	NA	NA	NA
AVA39663.1|1403313_1403655_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	51.4	2.1e-24
AVA39664.1|1403685_1404588_+	hypothetical protein	NA	NA	NA	NA	NA
AVA39665.1|1404701_1405295_+	DUF1367 domain-containing protein	NA	K7PKS6	Enterobacteria_phage	54.7	1.5e-57
AVA39666.1|1405306_1405618_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	68.8	1.0e-33
AVA39667.1|1405652_1406201_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	44.9	6.3e-31
AVA39668.1|1406316_1406649_+	hypothetical protein	NA	NA	NA	NA	NA
AVA39669.1|1406783_1406981_+	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	65.4	1.1e-09
AVA42010.1|1407135_1408170_+	DNA adenine methylase	NA	A0A1W6JP25	Morganella_phage	70.8	3.7e-141
AVA39670.1|1408483_1409053_+	hypothetical protein	NA	NA	NA	NA	NA
AVA42012.1|1409344_1409650_+|holin	holin	holin	F1C5D1	Cronobacter_phage	52.4	5.1e-22
AVA42011.1|1409681_1410035_+	peptidase M15	NA	A0A1P8DTE2	Proteus_phage	79.8	6.7e-42
AVA39671.1|1410040_1410487_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	33.1	1.4e-12
AVA39672.1|1410826_1411849_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	39.8	3.2e-36
AVA39673.1|1411970_1412447_+	hypothetical protein	NA	NA	NA	NA	NA
AVA39674.1|1412729_1414127_+|terminase	terminase	terminase	A0A2K9V3I6	Faecalibacterium_phage	40.3	3.3e-84
AVA39675.1|1414131_1415634_+|portal	portal protein	portal	A0A2H4P6S9	Pseudomonas_phage	42.7	1.1e-101
AVA42013.1|1415671_1416385_+|head	phage head morphogenesis protein	head	A0A2H5BG15	Pseudoalteromonas_phage	34.8	2.0e-32
AVA39676.1|1416381_1417641_+	hypothetical protein	NA	Q6IWU4	Burkholderia_phage	51.3	1.6e-45
AVA39677.1|1417640_1418138_+	hypothetical protein	NA	NA	NA	NA	NA
AVA39678.1|1418137_1419205_+	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	39.3	1.1e-52
AVA39679.1|1419274_1419616_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	33.6	2.7e-08
AVA39680.1|1419618_1420050_+	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	31.7	2.0e-11
AVA39681.1|1420049_1420508_+	hypothetical protein	NA	Q6IWU9	Burkholderia_phage	37.6	3.2e-12
AVA39682.1|1420507_1420879_+	hypothetical protein	NA	NA	NA	NA	NA
AVA39683.1|1420865_1421381_+	hypothetical protein	NA	NA	NA	NA	NA
AVA39684.1|1421389_1422877_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.7	2.5e-82
AVA39685.1|1422887_1423340_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.1	5.8e-22
AVA39686.1|1423380_1423839_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	6.7e-26
AVA39687.1|1423922_1426217_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	27.5	8.8e-18
AVA39688.1|1426213_1426741_+	hypothetical protein	NA	NA	NA	NA	NA
AVA39689.1|1426740_1427058_+	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	32.3	3.3e-08
AVA39690.1|1427023_1427839_+	hypothetical protein	NA	A1Z005	Burkholderia_virus	26.0	1.8e-10
AVA39691.1|1427841_1428534_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	39.4	9.1e-35
AVA39692.1|1428530_1428875_+	hypothetical protein	NA	NA	NA	NA	NA
AVA39693.1|1428867_1430055_+	hypothetical protein	NA	Q6IWQ3	Burkholderia_phage	40.9	3.0e-70
AVA39694.1|1430051_1430708_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.9	1.3e-38
>prophage 4
CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	1509574	1547037	4021165	portal,head,capsid,tail,integrase,tRNA,terminase,protease,lysis	Morganella_phage(25.81%)	48	1513086:1513145	1555009:1555219
AVA39763.1|1509574_1510678_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AVA39764.1|1510783_1511236_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AVA39765.1|1511228_1511858_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AVA39766.1|1511996_1513250_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
1513086:1513145	attL	ATGCTACGCCACATGGGGTGGACAGAAGCCGCTGACTTAATCATTAAAGGTATGGAAGGC	NA	NA	NA	NA
AVA39767.1|1513359_1514493_-|integrase	integrase	integrase	Q77Z04	Phage_21	72.2	1.4e-154
AVA39768.1|1514467_1514719_-	excisionase	NA	NA	NA	NA	NA
AVA39769.1|1514804_1515329_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	61.0	2.3e-54
AVA39770.1|1515850_1516282_-	hypothetical protein	NA	NA	NA	NA	NA
AVA39771.1|1516271_1518146_-	helicase	NA	A0A2I5ARD8	Synechococcus_phage	26.7	5.4e-13
AVA39772.1|1518242_1518899_-	helix-turn-helix domain-containing protein	NA	A0A1W6JNY2	Morganella_phage	73.5	1.3e-86
AVA39773.1|1518994_1519222_+	helix-turn-helix domain-containing protein	NA	A0A1C9IHV8	Salmonella_phage	50.0	7.9e-12
AVA39774.1|1519260_1519737_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	60.4	1.8e-45
AVA39775.1|1519799_1520009_+	hypothetical protein	NA	NA	NA	NA	NA
AVA39776.1|1519998_1520178_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	3.4e-10
AVA42016.1|1520735_1521251_+	hypothetical protein	NA	U5P0A0	Shigella_phage	44.2	3.5e-23
AVA39777.1|1521272_1522079_+	DNA-binding protein	NA	A0A1W6JP13	Morganella_phage	62.1	4.0e-90
AVA39778.1|1522075_1523101_+	hypothetical protein	NA	A0A1W6JP62	Morganella_phage	47.1	6.4e-85
AVA39779.1|1523128_1523527_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	53.5	1.6e-31
AVA39780.1|1523867_1524080_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	81.4	3.1e-26
AVA39781.1|1524411_1524870_+	heat-shock protein	NA	NA	NA	NA	NA
AVA39782.1|1525482_1527036_+	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	26.4	2.4e-19
AVA42017.1|1527122_1528157_+	hypothetical protein	NA	NA	NA	NA	NA
AVA39783.1|1528637_1529060_+	hypothetical protein	NA	NA	NA	NA	NA
AVA39784.1|1529125_1529395_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	2.7e-19
AVA39785.1|1529394_1529865_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	61.8	8.9e-50
AVA39786.1|1530007_1530469_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.2	4.8e-24
AVA39787.1|1530741_1530945_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
AVA39788.1|1531771_1532284_+	hypothetical protein	NA	A0A1V0E5P7	Salmonella_phage	65.7	1.9e-58
AVA39789.1|1532365_1532773_+	hypothetical protein	NA	NA	NA	NA	NA
AVA39790.1|1532769_1533108_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	68.8	8.3e-42
AVA39791.1|1533225_1533693_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	1.6e-43
AVA39792.1|1533646_1535380_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.6	3.1e-148
AVA39793.1|1535379_1536648_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.4	1.8e-201
AVA39794.1|1536665_1537334_+|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.8	6.6e-83
AVA39795.1|1537337_1538504_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.5	1.6e-169
AVA39796.1|1538542_1538842_+	hypothetical protein	NA	K7PKV5	Enterobacterial_phage	65.3	5.7e-34
AVA39797.1|1538841_1539171_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AVA39798.1|1539160_1539634_+	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	30.2	8.2e-11
AVA39799.1|1539639_1539981_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AVA39800.1|1539990_1540656_+	hypothetical protein	NA	NA	NA	NA	NA
AVA39801.1|1540720_1541137_+	hypothetical protein	NA	NA	NA	NA	NA
AVA39802.1|1541133_1541412_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
AVA39803.1|1541436_1541628_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
AVA39804.1|1541754_1545030_+|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	46.7	2.9e-54
AVA39805.1|1545030_1545627_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.3	1.6e-51
AVA39806.1|1545626_1546208_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.5	8.1e-53
AVA39807.1|1546224_1546560_+	hypothetical protein	NA	Q775B6	Bordetella_phage	35.3	3.7e-10
AVA39808.1|1546638_1547037_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	46.2	7.1e-32
1555009:1555219	attR	ATGCTACGCCACATGGGGTGGACAGAAGCCGCTGACTTAATCATTAAAGGTATGGAAGGCGCGATTGCCGCTAAGACTGTAACTTATGATTTCGAACGTCAGTTAGAAGGCGCTAAACTACTGAAATGTAGCGAGTTTGGTGACGCGATTATCAAACATATGTAATTGTTGATTTGATAAATAGTTAACGGGAGCTTATTAGTTCCCGTTT	NA	NA	NA	NA
>prophage 5
CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	1811749	1821741	4021165		Escherichia_phage(66.67%)	9	NA	NA
AVA40028.1|1811749_1813807_-	K(+)-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	26.1	2.2e-31
AVA40029.1|1813818_1815519_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AVA40030.1|1815521_1815605_-	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AVA40031.1|1815854_1816541_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
AVA40032.1|1816540_1817002_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
AVA40033.1|1817054_1817666_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	5.6e-28
AVA40034.1|1817805_1818666_-	dimethylsulfoxide reductase	NA	A0A077SK59	Escherichia_phage	35.5	3.7e-25
AVA40035.1|1818667_1819285_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
AVA40036.1|1819296_1821741_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.4	5.6e-220
>prophage 6
CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	2156320	2165148	4021165	holin	Salmonella_phage(25.0%)	10	NA	NA
AVA40344.1|2156320_2157373_-	nucleotidyltransferase	NA	A0A067XQU1	Caulobacter_phage	22.8	1.2e-06
AVA40345.1|2157356_2158136_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	39.3	1.1e-31
AVA40346.1|2158514_2159009_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40347.1|2159008_2159353_-	hypothetical protein	NA	F1BUL3	Cronobacter_phage	84.3	2.6e-43
AVA40348.1|2159355_2159628_-|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	37.8	3.2e-12
AVA40349.1|2159624_2159996_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	39.1	3.9e-16
AVA40350.1|2160082_2161537_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40351.1|2161523_2162453_-	glycosyltransferase	NA	M1FQW5	Enterobacteria_phage	83.0	1.2e-146
AVA40352.1|2162452_2162815_-	translocase	NA	S5FXN2	Shigella_phage	53.8	4.0e-26
AVA40353.1|2162955_2165148_-	hypothetical protein	NA	A0A2P0QGN7	Salmonella_phage	48.6	1.9e-126
>prophage 7
CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	2169288	2201299	4021165	terminase,integrase,tail	Escherichia_coli_O157_typing_phage(21.43%)	40	2184862:2184877	2207066:2207081
AVA40357.1|2169288_2172372_-	hypothetical protein	NA	T1SBJ1	Salmonella_phage	51.1	1.9e-164
AVA40358.1|2172374_2172923_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	60.2	1.2e-45
AVA40359.1|2172922_2173411_-	hypothetical protein	NA	A0A0F6R7N6	Escherichia_coli_O157_typing_phage	59.9	2.7e-49
AVA40360.1|2173394_2175857_-	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	70.1	0.0e+00
AVA40361.1|2175856_2176462_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	60.7	6.7e-66
AVA40362.1|2176461_2176773_-	hypothetical protein	NA	Q858G5	Salmonella_phage	38.5	8.8e-14
AVA40363.1|2176836_2177178_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40364.1|2177186_2177618_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	54.8	2.5e-30
AVA40365.1|2177676_2178657_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	59.4	6.5e-111
AVA40366.1|2178672_2179350_-	peptidase	NA	T1SAP9	Salmonella_phage	64.3	4.0e-43
AVA40367.1|2179379_2179694_-	hypothetical protein	NA	Q2A090	Sodalis_phage	45.5	6.8e-14
AVA40368.1|2179690_2181355_-|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	65.2	3.7e-199
AVA40369.1|2181364_2181577_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40370.1|2181761_2183243_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	76.7	3.4e-228
AVA40371.1|2183242_2183812_-|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	48.1	2.0e-43
AVA40372.1|2183857_2184505_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40373.1|2184533_2184875_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	57.1	4.8e-29
2184862:2184877	attL	GGTGATTTAGCCATTA	NA	NA	NA	NA
AVA40374.1|2184934_2185285_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40375.1|2185404_2185800_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.0	2.0e-34
AVA40376.1|2185796_2186210_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40377.1|2186456_2187182_-	DNA replication protein DnaC	NA	A0A1W6JP39	Morganella_phage	78.8	6.7e-105
AVA40378.1|2187181_2188024_-	hypothetical protein	NA	A0A0D4DBT2	Acinetobacter_phage	59.7	3.8e-51
AVA40379.1|2188034_2188220_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	50.8	6.0e-10
AVA40380.1|2188359_2188638_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40381.1|2188714_2189323_+	DNA-binding protein	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	35.4	1.5e-28
AVA40382.1|2189719_2191444_+	DNA breaking-rejoining protein	NA	A0A0U2I1R6	Escherichia_phage	47.6	1.2e-112
AVA40383.1|2191489_2192530_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	50.4	3.5e-99
AVA40384.1|2192573_2192831_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AVA40385.1|2192884_2193079_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40386.1|2193115_2193400_+	hypothetical protein	NA	A0A1P8DTG9	Proteus_phage	90.4	2.0e-44
AVA40387.1|2193399_2193894_+	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	26.4	2.9e-11
AVA40388.1|2193893_2194427_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40389.1|2194496_2195213_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40390.1|2195247_2195721_+	class I SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	78.7	1.2e-70
AVA40391.1|2195717_2196359_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	60.6	8.6e-72
AVA40392.1|2196361_2196559_+	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	65.1	3.4e-19
AVA40393.1|2196558_2196747_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40394.1|2196754_2197951_-|integrase	integrase	integrase	T1S9J3	Salmonella_phage	61.4	3.1e-139
AVA40395.1|2198170_2199748_-	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AVA40396.1|2199832_2201299_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.7e-89
2207066:2207081	attR	TAATGGCTAAATCACC	NA	NA	NA	NA
>prophage 8
CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	2384523	2403412	4021165	holin,lysis	Escherichia_phage(21.43%)	21	NA	NA
AVA40553.1|2384523_2386962_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
AVA40554.1|2386973_2387591_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
AVA40555.1|2387594_2388371_+	diguanylate cyclase	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
AVA40556.1|2388486_2389029_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.2	2.7e-18
AVA40557.1|2389597_2389777_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
AVA40558.1|2391176_2391833_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.9	2.3e-35
AVA40559.1|2391829_2393017_-	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.9	1.3e-73
AVA40560.1|2393009_2393354_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40561.1|2393350_2394043_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	37.1	1.6e-34
AVA40562.1|2394045_2394858_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
AVA40563.1|2394826_2395147_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40564.1|2395159_2395648_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40565.1|2395650_2397954_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.3	1.1e-15
AVA40566.1|2398036_2398495_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
AVA40567.1|2398554_2399007_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40568.1|2399017_2400505_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	4.2e-77
AVA40569.1|2400513_2401026_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40570.1|2401062_2401512_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AVA40571.1|2401508_2401913_-	structural protein	NA	A0A0E3JJ20	Enterobacteria_phage	45.8	3.8e-25
AVA40572.1|2401915_2402215_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
AVA40573.1|2402596_2403412_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	3.5e-54
>prophage 9
CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	2592505	2674189	4021165	portal,head,capsid,tail,transposase,protease,tRNA,terminase,integrase,lysis	Yersinia_phage(13.33%)	101	2614621:2614636	2662912:2662927
AVA40726.1|2592505_2593036_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	31.5	1.4e-06
AVA40727.1|2593348_2593609_+	4Fe-4S dicluster domain-containing protein	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	47.7	4.6e-16
AVA40728.1|2593638_2594019_-	holo-ACP synthase	NA	NA	NA	NA	NA
AVA40729.1|2594018_2594750_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AVA40730.1|2594819_2595560_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AVA40731.1|2595572_2596481_-	GTPase Era	NA	NA	NA	NA	NA
AVA40732.1|2596477_2597158_-	ribonuclease 3	NA	A0A0P0BX11	Ostreococcus_lucimarinus_virus	31.9	8.1e-20
AVA40733.1|2597353_2598325_-	signal peptidase I	NA	NA	NA	NA	NA
AVA40734.1|2598339_2600136_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.2	2.7e-22
AVA40735.1|2600457_2600922_-	SoxR reducing system protein RseC	NA	NA	NA	NA	NA
AVA40736.1|2600934_2601906_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
AVA40737.1|2601954_2602614_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
AVA40738.1|2602615_2603194_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
AVA40739.1|2603494_2604253_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AVA40740.1|2604521_2605877_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.1	2.3e-42
AVA40741.1|2606027_2606411_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	67.0	2.0e-31
AVA40742.1|2606422_2606647_+	hypothetical protein	NA	NA	NA	NA	NA
AVA42038.1|2606745_2607426_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	47.2	1.7e-57
AVA40743.1|2607517_2608129_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AVA40744.1|2608230_2609130_+	NAD(+) kinase	NA	NA	NA	NA	NA
AVA40745.1|2609215_2610877_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AVA40746.1|2610990_2611353_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AVA40747.1|2611485_2611779_-	RnfH family protein	NA	NA	NA	NA	NA
AVA40748.1|2611771_2612206_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AVA40749.1|2612362_2612845_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	49.4	4.3e-31
AVA40750.1|2613631_2614006_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40751.1|2614396_2614702_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
2614621:2614636	attL	AAAAGAGATAATTAAA	NA	NA	NA	NA
AVA40752.1|2616362_2616629_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40753.1|2616625_2617312_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40754.1|2617311_2617644_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40755.1|2617633_2620423_-|tail	phage tail protein	tail	Q7Y3Z3	Yersinia_phage	48.0	9.3e-187
AVA40756.1|2620423_2620822_-	hypothetical protein	NA	A0A2H4IYI8	uncultured_Caudovirales_phage	47.7	8.3e-33
AVA40757.1|2620875_2621151_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40758.1|2621164_2621746_-	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	1.9e-49
AVA40759.1|2621742_2622342_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	54.9	1.5e-54
AVA40760.1|2622342_2625648_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	43.1	3.2e-186
AVA40761.1|2625650_2625851_-|tail	tail assembly chaperone	tail	NA	NA	NA	NA
AVA40762.1|2625904_2626255_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	40.5	6.2e-16
AVA40763.1|2626254_2626731_-|tail	phage tail protein	tail	Q7Y403	Yersinia_phage	75.5	6.9e-58
AVA42039.1|2626753_2627146_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	57.9	1.2e-31
AVA40764.1|2627154_2627544_-	hypothetical protein	NA	Q7Y405	Yersinia_phage	50.0	2.2e-30
AVA40765.1|2627530_2627857_-|head,tail	head-tail adaptor protein	head,tail	Q7Y406	Yersinia_phage	44.5	2.6e-16
AVA42040.1|2627863_2628166_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	70.0	6.8e-35
AVA42041.1|2628218_2629481_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	82.0	5.1e-185
AVA40766.1|2629496_2630102_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	5.3e-87
AVA40767.1|2630091_2631321_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	87.8	4.8e-212
AVA40768.1|2631468_2633202_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	98.2	0.0e+00
AVA40769.1|2633205_2633679_-|terminase	phage terminase small subunit P27 family	terminase	A0A1P8DTK5	Proteus_phage	66.9	9.2e-55
AVA40770.1|2633826_2634024_-	hypothetical protein	NA	A0A1P8DTB8	Proteus_phage	87.7	6.4e-26
AVA40771.1|2634020_2634371_-	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	93.0	2.4e-60
AVA40772.1|2634430_2634808_-	hypothetical protein	NA	A0A1P8DTD7	Proteus_phage	72.4	2.5e-39
AVA40773.1|2635416_2635881_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	79.1	3.1e-47
AVA40774.1|2636023_2636494_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	57.5	2.9e-48
AVA40775.1|2636493_2636763_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	47.8	3.3e-17
AVA40776.1|2637126_2637390_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
AVA40777.1|2637369_2637549_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AVA40778.1|2637629_2638151_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
AVA40779.1|2638447_2638831_-	antitermination protein	NA	A0A088CD47	Shigella_phage	72.2	5.5e-50
AVA40780.1|2638830_2639805_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	55.4	3.4e-104
AVA40781.1|2639801_2641367_-	helicase	NA	A0A286N2P9	Klebsiella_phage	69.9	2.5e-221
AVA40782.1|2641627_2641876_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	56.0	1.8e-17
AVA40783.1|2641868_2642126_-	transcriptional regulator	NA	G8C7U2	Escherichia_phage	60.8	2.1e-16
AVA40784.1|2642251_2642950_+	hypothetical protein	NA	E7C9R0	Salmonella_phage	44.2	6.6e-49
AVA40785.1|2643256_2644126_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40786.1|2644148_2644400_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40787.1|2644389_2644806_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40788.1|2644965_2645430_+	transcriptional regulator	NA	A0A059VK24	Pseudomonas_phage	35.0	2.3e-05
AVA40789.1|2645431_2645638_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40790.1|2645640_2645838_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40791.1|2645824_2646022_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40792.1|2646014_2646299_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40793.1|2646261_2646552_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40794.1|2646544_2646967_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40795.1|2647041_2647395_+	hypothetical protein	NA	NA	NA	NA	NA
AVA42042.1|2647372_2647588_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40796.1|2647584_2648061_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40797.1|2648072_2648771_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	57.0	6.1e-63
AVA40798.1|2648770_2649304_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	35.9	1.1e-22
AVA40799.1|2649312_2649540_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40800.1|2649536_2649788_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40801.1|2649774_2650173_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40802.1|2650159_2650483_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40803.1|2650469_2650682_+	excisionase	NA	I6PBM8	Cronobacter_phage	61.8	3.1e-18
AVA40804.1|2650636_2651818_+|integrase	integrase	integrase	I6PDJ1	Cronobacter_phage	69.4	1.1e-152
AVA40805.1|2652134_2653376_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	46.8	2.4e-102
AVA40806.1|2653590_2654901_-	hypothetical protein	NA	Q858S9	Enterobacteria_phage	33.6	5.7e-62
AVA40807.1|2655076_2655367_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40808.1|2655430_2656510_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40809.1|2657118_2658702_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40810.1|2660049_2660229_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40811.1|2660594_2661290_+	fimbrial protein	NA	NA	NA	NA	NA
AVA40812.1|2661416_2662544_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40813.1|2663076_2663781_+	fimbrial protein	NA	NA	NA	NA	NA
2662912:2662927	attR	TTTAATTATCTCTTTT	NA	NA	NA	NA
AVA40814.1|2667483_2667912_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40815.1|2667901_2668159_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40816.1|2668362_2668593_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40817.1|2668851_2669538_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AVA40818.1|2670129_2670525_+	hypothetical protein	NA	NA	NA	NA	NA
AVA40819.1|2670536_2672033_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AVA42043.1|2672982_2673135_+	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	97.3	9.6e-14
AVA40820.1|2673172_2674189_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	7.0e-185
>prophage 10
CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	2714568	2749638	4021165	portal,head,tail,capsid,integrase,tRNA,plate,holin,lysis	Salmonella_phage(27.78%)	45	2740602:2740617	2747210:2747225
AVA40857.1|2714568_2714787_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	70.3	1.7e-19
AVA40858.1|2714839_2715937_-	late control protein D	NA	E5G6Q3	Salmonella_phage	56.2	7.3e-111
AVA40859.1|2715936_2716401_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	56.2	8.8e-42
AVA40860.1|2716400_2719235_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	41.6	5.8e-112
AVA42044.1|2719227_2719401_-|tail	GpE family phage tail protein	tail	A0A2I8TV82	Erwinia_phage	50.9	1.6e-09
AVA40861.1|2719361_2719709_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	56.8	3.5e-19
AVA40862.1|2719728_2720244_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	58.5	1.6e-55
AVA40863.1|2720247_2721420_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	71.4	1.0e-166
AVA40864.1|2721519_2723151_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	72.4	1.8e-57
AVA40865.1|2723140_2723752_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	69.4	3.2e-76
AVA40866.1|2723744_2724653_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	66.6	1.3e-108
AVA40867.1|2724654_2724993_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	49.5	1.4e-25
AVA40868.1|2724989_2725616_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	59.8	9.0e-58
AVA40869.1|2725681_2726317_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	35.8	1.5e-28
AVA40870.1|2726306_2726744_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	48.6	1.2e-32
AVA40871.1|2726718_2727222_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	30.1	1.4e-05
AVA40872.1|2727218_2727623_-	peptidase M15	NA	K4F776	Cronobacter_phage	57.4	4.6e-39
AVA40873.1|2727615_2727930_-|holin	holin	holin	NA	NA	NA	NA
AVA40874.1|2727949_2728156_-|tail	phage tail protein	tail	K4PAW7	Burkholderia_phage	51.5	8.1e-16
AVA40875.1|2728155_2728611_-|head	head protein	head	E5E3S2	Burkholderia_phage	45.3	2.4e-28
AVA40876.1|2728688_2729357_-	hypothetical protein	NA	F1BUQ7	Erwinia_phage	46.6	7.2e-45
AVA40877.1|2729356_2730502_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	67.7	6.8e-128
AVA40878.1|2730517_2731327_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	48.8	3.4e-65
AVA40879.1|2731499_2733254_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	73.2	2.3e-260
AVA40880.1|2733253_2734282_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	67.5	4.0e-135
AVA40881.1|2734761_2735157_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVA40882.1|2735227_2735908_-	hypothetical protein	NA	V9IQL5	Stenotrophomonas_phage	27.2	1.9e-16
AVA40883.1|2735909_2736122_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40884.1|2736114_2738493_-	replication protein	NA	Q7Y4B8	Escherichia_virus	47.3	1.1e-164
AVA40885.1|2738492_2738816_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40886.1|2738815_2739643_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	47.8	3.0e-61
AVA40887.1|2739642_2739951_-	DUF3850 domain-containing protein	NA	A0A218M496	Shigella_phage	41.1	6.5e-09
AVA40888.1|2739952_2740174_-	hypothetical protein	NA	F1BUS2	Erwinia_phage	52.1	2.6e-12
AVA40889.1|2740166_2740424_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40890.1|2740441_2740837_-	hypothetical protein	NA	NA	NA	NA	NA
2740602:2740617	attL	ATACGATTATTTTCAT	NA	NA	NA	NA
AVA40891.1|2740886_2741162_-	hypothetical protein	NA	NA	NA	NA	NA
AVA42045.1|2741320_2741506_-	hypothetical protein	NA	NA	NA	NA	NA
AVA40892.1|2741523_2741799_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	47.0	3.7e-16
AVA40893.1|2741901_2742201_+	XRE family transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	70.7	4.8e-33
AVA40894.1|2742267_2743251_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	56.2	8.2e-98
AVA40895.1|2743419_2744934_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	38.0	4.1e-88
AVA40896.1|2744942_2746041_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.3	4.1e-05
AVA40897.1|2746212_2747946_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.1	4.7e-64
2747210:2747225	attR	ATACGATTATTTTCAT	NA	NA	NA	NA
AVA40898.1|2747955_2748663_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AVA40899.1|2748696_2749638_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	4.1e-30
>prophage 11
CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	2938091	2998408	4021165	portal,tail,coat,integrase,terminase,tRNA,holin,lysis	Proteus_phage(23.08%)	79	2953615:2953661	2994018:2994064
AVA41039.1|2938091_2941322_-	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	42.2	4.6e-105
AVA41040.1|2941338_2941680_-	hypothetical protein	NA	NA	NA	NA	NA
AVA41041.1|2941679_2941853_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVA41042.1|2942034_2942544_-	hypothetical protein	NA	NA	NA	NA	NA
AVA41043.1|2943528_2946249_-	DNA primase	NA	A0A1W6JPG0	Morganella_phage	66.1	0.0e+00
AVA41044.1|2946245_2946590_-	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	71.9	2.8e-45
AVA41045.1|2946604_2947201_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.8	2.9e-29
AVA41046.1|2947200_2947386_-	hypothetical protein	NA	NA	NA	NA	NA
AVA41047.1|2947555_2948167_-	toxin Bro	NA	A0A1B5FPC0	Escherichia_phage	46.3	4.3e-20
AVA41048.1|2948163_2948373_-	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	52.2	4.7e-11
AVA41049.1|2948369_2948564_-	hypothetical protein	NA	NA	NA	NA	NA
AVA41050.1|2948566_2948740_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AVA42052.1|2948732_2949743_-	hypothetical protein	NA	A0A1W6JPK3	Morganella_phage	52.2	3.3e-78
AVA41051.1|2949763_2950372_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	68.8	1.8e-71
AVA41052.1|2950384_2950780_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	57.0	1.4e-27
AVA41053.1|2950779_2950998_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	45.3	8.6e-08
AVA41054.1|2951114_2952038_-	hypothetical protein	NA	NA	NA	NA	NA
AVA41055.1|2952239_2953451_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	55.7	3.8e-129
2953615:2953661	attL	AATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AVA41056.1|2953847_2954054_+	DNA polymerase II	NA	A0A1P8DTI0	Proteus_phage	97.1	3.8e-29
AVA41057.1|2954133_2955129_+	hypothetical protein	NA	NA	NA	NA	NA
AVA41058.1|2957194_2959138_-	DNA transfer protein	NA	C6ZR18	Salmonella_phage	56.5	5.5e-146
AVA42053.1|2959122_2960691_-	acyltransferase	NA	B6SCW4	Bacteriophage	44.0	1.1e-88
AVA41059.1|2960700_2961360_-	DNA transfer protein	NA	Q2A0B2	Sodalis_phage	68.1	8.6e-59
AVA41060.1|2961353_2961815_-	DUF2824 domain-containing protein	NA	Q2A0B3	Sodalis_phage	71.3	9.3e-60
AVA41061.1|2961814_2962513_-|tail	phage tail protein	tail	C6ZR14	Salmonella_phage	66.5	7.0e-35
AVA42054.1|2962512_2963751_-	hypothetical protein	NA	Q9T1S0	Acyrthosiphon_pisum_secondary_endosymbiont_phage	69.3	2.4e-147
AVA41062.1|2964265_2964763_-	recombinase RmuC	NA	A0A2D1GLR5	Escherichia_phage	61.9	3.3e-47
AVA41063.1|2964740_2964950_-	hypothetical protein	NA	NA	NA	NA	NA
AVA41064.1|2965001_2966285_-|coat	coat protein	coat	G5DA99	Enterobacteria_phage	67.6	4.4e-168
AVA41065.1|2966284_2967199_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	61.5	3.7e-92
AVA41066.1|2967213_2969304_-|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	66.7	4.7e-236
AVA41067.1|2969306_2970803_-|terminase	terminase	terminase	A0A0M4S5Z3	Salmonella_phage	81.8	8.9e-253
AVA41068.1|2970777_2971269_-	DNA-packaging protein	NA	I6S1J2	Salmonella_phage	79.8	1.5e-71
AVA41069.1|2971457_2971907_-	hypothetical protein	NA	NA	NA	NA	NA
AVA42055.1|2971916_2972141_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	53.4	3.9e-11
AVA41070.1|2972488_2972854_-	hypothetical protein	NA	NA	NA	NA	NA
AVA41071.1|2972853_2973306_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	80.4	2.6e-54
AVA41072.1|2973302_2973707_-	structural protein	NA	A0A0E3JJ20	Enterobacteria_phage	45.6	2.2e-25
AVA41073.1|2973699_2973987_-|holin	phage holin family protein	holin	NA	NA	NA	NA
AVA41074.1|2973983_2974373_-	hypothetical protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
AVA41075.1|2974857_2975613_-	antitermination protein	NA	G0ZNC6	Cronobacter_phage	46.2	2.7e-48
AVA41076.1|2975609_2975801_-	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	96.8	1.0e-28
AVA41077.1|2975800_2976421_-	hypothetical protein	NA	A0A2I7RAC0	Vibrio_phage	53.6	6.7e-45
AVA41078.1|2976694_2977138_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	55.3	8.1e-37
AVA41079.1|2977139_2977349_-	hypothetical protein	NA	A0A1P8DTG8	Proteus_phage	96.8	1.6e-30
AVA41080.1|2977341_2977521_-	hypothetical protein	NA	NA	NA	NA	NA
AVA41081.1|2977517_2977742_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
AVA41082.1|2977953_2978175_-	hypothetical protein	NA	NA	NA	NA	NA
AVA41083.1|2978377_2979289_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	61.2	9.0e-99
AVA41084.1|2979299_2979986_-	DNA replication protein	NA	A0A1P8DTF3	Proteus_phage	88.6	1.2e-108
AVA41085.1|2979982_2980921_-	replication protein 15	NA	A0A1P8DTG2	Proteus_phage	52.9	6.0e-82
AVA41086.1|2980917_2981601_-	phage regulatory protein/antirepressor Ant	NA	A0A1P8DTE1	Proteus_phage	93.0	8.2e-113
AVA41087.1|2981622_2981967_-	hypothetical protein	NA	A0A1P8DTF0	Proteus_phage	38.6	4.7e-08
AVA41088.1|2982102_2982288_-	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	58.3	2.3e-09
AVA41089.1|2982383_2983094_+	LexA family transcriptional repressor	NA	A4KWV9	Enterobacteria_phage	62.1	2.5e-80
AVA41090.1|2983334_2984252_+	serine dehydrogenasease	NA	NA	NA	NA	NA
AVA41091.1|2984803_2985073_+	hypothetical protein	NA	A0A1P8DTK1	Proteus_phage	70.3	6.9e-23
AVA41092.1|2985088_2985604_-	hypothetical protein	NA	NA	NA	NA	NA
AVA41093.1|2986031_2986265_+	hypothetical protein	NA	A0A1P8DTG4	Proteus_phage	79.7	6.4e-25
AVA41094.1|2986266_2986566_+	hypothetical protein	NA	NA	NA	NA	NA
AVA41095.1|2986634_2986895_+	hypothetical protein	NA	NA	NA	NA	NA
AVA41096.1|2987112_2987367_+	hypothetical protein	NA	NA	NA	NA	NA
AVA41097.1|2987363_2987615_+	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	95.2	4.1e-38
AVA41098.1|2987611_2988496_+	recombinase RecT	NA	A0A2L1IV84	Escherichia_phage	61.9	1.1e-93
AVA41099.1|2988492_2989191_+	exonuclease	NA	A0A2R2Z325	Escherichia_phage	57.3	2.6e-74
AVA41100.1|2989180_2989714_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	58.8	2.7e-55
AVA41101.1|2989729_2990038_+	hypothetical protein	NA	NA	NA	NA	NA
AVA41102.1|2990293_2990482_+	hypothetical protein	NA	NA	NA	NA	NA
AVA41103.1|2990474_2990768_+	hypothetical protein	NA	NA	NA	NA	NA
AVA41104.1|2991234_2991552_+	recombinase	NA	A0A2I7S0T5	Vibrio_phage	37.8	3.2e-11
AVA41105.1|2991529_2991712_+	hypothetical protein	NA	NA	NA	NA	NA
AVA41106.1|2991740_2992343_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	58.1	6.4e-61
AVA41107.1|2992427_2992622_+	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	89.1	3.0e-28
AVA41108.1|2992631_2992964_+	DNA-binding protein	NA	NA	NA	NA	NA
AVA41109.1|2992840_2994004_+|integrase	integrase	integrase	G8C7S0	Escherichia_phage	75.7	9.5e-178
AVA41110.1|2994286_2995159_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	5.7e-34
2994018:2994064	attR	AATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AVA41111.1|2995162_2995375_+	ribosome-associated protein	NA	NA	NA	NA	NA
AVA41112.1|2996010_2996952_+	1-phosphofructokinase	NA	NA	NA	NA	NA
AVA41113.1|2997016_2998408_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.3	2.7e-38
>prophage 12
CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	3258581	3267437	4021165		Caulobacter_phage(50.0%)	9	NA	NA
AVA41319.1|3258581_3260150_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	1.6e-10
AVA41320.1|3260550_3261231_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AVA41321.1|3261327_3261903_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
AVA41322.1|3261979_3262558_-	chemical-damaging agent resistance protein C	NA	K4JRX3	Caulobacter_phage	43.1	3.2e-33
AVA41323.1|3262625_3263651_-	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	47.9	1.0e-74
AVA41324.1|3263685_3264141_-	Tellurium resistance protein TerB	NA	NA	NA	NA	NA
AVA41325.1|3264165_3265314_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AVA41326.1|3265314_3265899_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
AVA41327.1|3266291_3267437_+	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	1.2e-31
>prophage 13
CP026571	Proteus mirabilis strain BC11-24 chromosome, complete genome	4021165	3912305	3971353	4021165	protease,tRNA,transposase,integrase	uncultured_Caudovirales_phage(22.22%)	46	3950006:3950022	3969596:3969612
AVA41880.1|3912305_3912890_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AVA41881.1|3912984_3913896_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AVA41882.1|3915338_3915734_+	hypothetical protein	NA	NA	NA	NA	NA
AVA41883.1|3915881_3917996_+	cellulose synthase catalytic subunit (UDP-forming)	NA	NA	NA	NA	NA
AVA41884.1|3917998_3920347_+	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
AVA41885.1|3924059_3924530_+	cellulose biosynthesis protein	NA	NA	NA	NA	NA
AVA41886.1|3924568_3925474_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
AVA41887.1|3925647_3926610_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	45.1	8.7e-60
AVA41888.1|3926683_3927721_+	endoglucanase	NA	NA	NA	NA	NA
AVA41889.1|3927859_3929509_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
AVA41890.1|3929617_3931480_-|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	26.0	1.1e-13
AVA41891.1|3931476_3932868_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
AVA41892.1|3932883_3933804_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
AVA41893.1|3934002_3934659_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
AVA41894.1|3934655_3935594_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
AVA41895.1|3935605_3938653_-	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
AVA41896.1|3938832_3939663_+	sulfurtransferase FdhD	NA	NA	NA	NA	NA
AVA41897.1|3939659_3940430_-	transferase	NA	NA	NA	NA	NA
AVA41898.1|3940440_3941316_-	glycosyltransferase	NA	NA	NA	NA	NA
AVA41899.1|3941607_3942150_-	flagellar protein	NA	NA	NA	NA	NA
AVA41900.1|3942364_3943336_+	acyltransferase	NA	NA	NA	NA	NA
AVA41901.1|3943460_3944348_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVA41902.1|3944762_3945563_+	hypothetical protein	NA	NA	NA	NA	NA
AVA41903.1|3945737_3947090_+	DUF560 domain-containing protein	NA	NA	NA	NA	NA
3950006:3950022	attL	GCTATTTTGGCATAAAT	NA	NA	NA	NA
AVA41904.1|3950238_3951042_+	energy transducer TonB	NA	NA	NA	NA	NA
AVA41905.1|3951095_3952961_-	hypothetical protein	NA	NA	NA	NA	NA
AVA41906.1|3953088_3954018_-	phosphoesterase	NA	NA	NA	NA	NA
AVA41907.1|3954202_3954667_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
AVA41908.1|3955527_3957015_+	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	78.5	3.3e-215
AVA41909.1|3957025_3957877_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	36.4	1.6e-52
AVA41910.1|3958137_3958731_-	hypothetical protein	NA	NA	NA	NA	NA
AVA41911.1|3958936_3959701_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AVA41912.1|3959788_3959902_+	NTP-binding protein	NA	NA	NA	NA	NA
AVA41913.1|3960207_3960708_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVA41914.1|3960726_3960906_+	hypothetical protein	NA	NA	NA	NA	NA
AVA41915.1|3960835_3961675_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AVA41916.1|3961668_3962016_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVA41917.1|3962163_3962985_-	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
AVA42070.1|3963116_3963908_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AVA41918.1|3964053_3965067_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
AVA41919.1|3965005_3965620_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AVA41920.1|3965745_3966306_+	DNA resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AVA41921.1|3966308_3969260_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
AVA42071.1|3969268_3969670_+	hypothetical protein	NA	NA	NA	NA	NA
3969596:3969612	attR	ATTTATGCCAAAATAGC	NA	NA	NA	NA
AVA41922.1|3969754_3970459_-|transposase	IS6 family transposase IS1006	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
AVA41923.1|3970516_3971353_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
