The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026544	Cupriavidus metallidurans strain Ni-2 chromosome, complete genome	6543877	352878	393173	6543877	integrase,tRNA,protease,transposase	Tupanvirus(14.29%)	35	361937:361954	395750:395767
AVA32442.1|352878_353475_-|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AVA32443.1|353649_354261_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AVA32444.1|354431_355385_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	33.8	2.4e-41
AVA32445.1|355624_356503_-	4-diphosphocytidyl-2C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AVA32446.1|356499_357114_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
AVA37579.1|357199_359107_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AVA32447.1|359377_360271_+	formamidopyrimidine-DNA glycosylase	NA	NA	NA	NA	NA
AVA32448.1|360603_362547_+	GTPase	NA	NA	NA	NA	NA
361937:361954	attL	CGATGCGCGATGCGCGCG	NA	NA	NA	NA
AVA37580.1|362677_363829_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AVA32449.1|363850_364504_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AVA32450.1|364550_365441_-	RNase adaptor protein RapZ	NA	A0A1P8D5W0	Corynebacterium_phage	37.4	1.1e-08
AVA32451.1|365555_365897_-	hypothetical protein	NA	NA	NA	NA	NA
AVA32452.1|366102_367074_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
AVA32453.1|367142_367598_-	PTS IIA-like nitrogen-regulatory protein PtsN	NA	NA	NA	NA	NA
AVA32454.1|368074_368428_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AVA32455.1|368478_369957_-	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AVA32456.1|370080_370872_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	2.5e-20
AVA32457.1|370897_371542_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
AVA32458.1|371604_372231_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AVA37581.1|372234_373218_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	33.7	2.0e-35
AVA32459.1|373368_375348_+	potassium transporter	NA	NA	NA	NA	NA
AVA32460.1|375337_375766_-	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
AVA32461.1|375824_376454_-|protease	protease	protease	NA	NA	NA	NA
AVA32462.1|376529_377102_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	1.6e-29
AVA32463.1|377381_379058_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
AVA32464.1|379111_381979_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.8	6.2e-303
AVA32465.1|382253_383510_+	MFS transporter	NA	NA	NA	NA	NA
AVA32466.1|383785_384331_+	single-stranded DNA-binding protein	NA	C5IHK5	Burkholderia_virus	85.3	2.3e-49
AVA32467.1|384563_385430_+	hypothetical protein	NA	NA	NA	NA	NA
AVA32468.1|385617_386814_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AVA32469.1|386810_388451_+	hypothetical protein	NA	NA	NA	NA	NA
AVA32470.1|388455_390459_+|integrase	integrase	integrase	NA	NA	NA	NA
AVA32471.1|390415_390838_+	hypothetical protein	NA	NA	NA	NA	NA
AVA32472.1|391310_391622_+|transposase	transposase	transposase	NA	NA	NA	NA
AVA32473.1|391733_393173_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
395750:395767	attR	CGCGCGCATCGCGCATCG	NA	NA	NA	NA
>prophage 2
CP026544	Cupriavidus metallidurans strain Ni-2 chromosome, complete genome	6543877	821840	833036	6543877	tRNA	Ralstonia_phage(90.91%)	15	NA	NA
AVA32818.1|821840_823148_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.2	3.5e-96
AVA32819.1|823527_824118_+	resolvase	NA	A0JC18	Ralstonia_phage	76.5	9.1e-76
AVA37608.1|824419_824875_-	pilus assembly protein PilA	NA	NA	NA	NA	NA
AVA32820.1|825088_825979_-	hypothetical protein	NA	A0JC16	Ralstonia_phage	42.1	6.2e-52
AVA32821.1|826673_826988_+	hypothetical protein	NA	W6CM42	Ralstonia_phage	67.4	3.6e-31
AVA32822.1|827182_828397_-	zonular occludens toxin	NA	A0A097ZIG6	Ralstonia_phage	59.9	4.1e-131
AVA32823.1|828549_828876_-	DUF2523 domain-containing protein	NA	A0A097ZIJ0	Ralstonia_phage	58.9	7.3e-27
AVA32824.1|828872_830336_-	hypothetical protein	NA	A0A1W5LU35	Ralstonia_phage	33.3	9.6e-26
AVA32825.1|830496_830718_-	hypothetical protein	NA	A0A1W5LU14	Ralstonia_phage	50.0	2.2e-06
AVA32826.1|830721_830961_-	hypothetical protein	NA	NA	NA	NA	NA
AVA32827.1|830963_831209_-	hypothetical protein	NA	NA	NA	NA	NA
AVA32828.1|831511_831778_-	hypothetical protein	NA	NA	NA	NA	NA
AVA32829.1|831830_832139_-	hypothetical protein	NA	W6CMZ9	Ralstonia_phage	50.0	2.9e-17
AVA32830.1|832301_832589_+	XRE family transcriptional regulator	NA	A0A1W5LU58	Ralstonia_phage	50.0	3.4e-12
AVA32831.1|832724_833036_+	recombinase family protein	NA	A0JC18	Ralstonia_phage	77.7	7.2e-32
>prophage 3
CP026544	Cupriavidus metallidurans strain Ni-2 chromosome, complete genome	6543877	867128	875971	6543877		Bacillus_phage(16.67%)	8	NA	NA
AVA32859.1|867128_868502_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	35.2	5.4e-71
AVA32860.1|868581_869526_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.5	3.8e-15
AVA32861.1|869552_870548_+	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	R9S880	Prochlorococcus_phage	33.4	3.1e-28
AVA32862.1|870757_871138_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
AVA32863.1|871235_872684_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	64.4	1.3e-144
AVA32864.1|872794_873697_+	cysteine synthase CysM	NA	C3U2M1	Lactococcus_phage	41.2	6.3e-52
AVA37610.1|873776_874883_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
AVA32865.1|875047_875971_+	deacetylase	NA	A0A2K9KZC4	Tupanvirus	34.0	8.7e-41
>prophage 4
CP026544	Cupriavidus metallidurans strain Ni-2 chromosome, complete genome	6543877	998285	1006734	6543877		Pseudomonas_virus(28.57%)	12	NA	NA
AVA32975.1|998285_998507_-	transcriptional regulator	NA	A0A077K9Z8	Ralstonia_phage	68.4	1.9e-15
AVA32976.1|998566_998773_-	hypothetical protein	NA	NA	NA	NA	NA
AVA32977.1|998769_999201_-	hypothetical protein	NA	G1FTZ6	Mycobacterium_phage	42.6	3.1e-17
AVA32978.1|999214_999859_-	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	44.3	3.4e-36
AVA32979.1|1000140_1000365_+	hypothetical protein	NA	NA	NA	NA	NA
AVA32980.1|1000376_1002161_-	DNA cytosine methyltransferase	NA	L7TH64	Pseudomonas_virus	61.1	2.1e-176
AVA32981.1|1002157_1002766_-	hypothetical protein	NA	NA	NA	NA	NA
AVA32982.1|1002762_1003176_-	hypothetical protein	NA	NA	NA	NA	NA
AVA32983.1|1003177_1004050_-	hypothetical protein	NA	A0A067XQE4	Caulobacter_phage	32.7	1.0e-27
AVA32984.1|1004239_1004887_-	hypothetical protein	NA	NA	NA	NA	NA
AVA32985.1|1004914_1005106_-	hypothetical protein	NA	A9YX20	Burkholderia_phage	50.0	5.2e-09
AVA32986.1|1005102_1006734_-	endonuclease	NA	A0A2H4J6P1	uncultured_Caudovirales_phage	46.0	5.0e-92
>prophage 5
CP026544	Cupriavidus metallidurans strain Ni-2 chromosome, complete genome	6543877	1010091	1042091	6543877	integrase,head,terminase	Aeromonas_phage(17.24%)	44	1033568:1033583	1047379:1047394
AVA32993.1|1010091_1010850_-	hypothetical protein	NA	A0A0U4JEE2	Pseudomonas_phage	49.0	1.4e-36
AVA32994.1|1011158_1011347_+	hypothetical protein	NA	NA	NA	NA	NA
AVA32995.1|1011336_1011528_+	hypothetical protein	NA	NA	NA	NA	NA
AVA32996.1|1011599_1011932_-	hypothetical protein	NA	NA	NA	NA	NA
AVA32997.1|1012009_1012387_+	hypothetical protein	NA	NA	NA	NA	NA
AVA37617.1|1012425_1013448_+	site-specific DNA-methyltransferase	NA	Q8W6P4	Burkholderia_virus	59.4	5.9e-115
AVA32998.1|1013444_1014518_+	hypothetical protein	NA	H2BD69	Pseudomonas_phage	46.6	6.3e-35
AVA32999.1|1014521_1015268_+	hypothetical protein	NA	U6C6D0	Ralstonia_phage	37.7	3.0e-31
AVA33000.1|1015452_1015890_+	hypothetical protein	NA	NA	NA	NA	NA
AVA37618.1|1015904_1016435_+	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
AVA33001.1|1016827_1017151_+	hypothetical protein	NA	A0A0S4L5D5	Pseudomonas_phage	75.2	4.2e-35
AVA33002.1|1017189_1017618_+	hypothetical protein	NA	A0A1W6DY69	Salmonella_phage	43.6	8.4e-23
AVA33003.1|1017753_1019217_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1W6DY05	Salmonella_phage	43.4	2.0e-116
AVA33004.1|1019266_1019752_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33005.1|1019768_1021382_+	hypothetical protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	36.9	1.9e-75
AVA33006.1|1021381_1022191_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	45.8	1.8e-50
AVA37619.1|1022177_1023410_+	hypothetical protein	NA	A0A2R3UAL3	Myoviridae_environmental_samples	33.0	2.9e-47
AVA33007.1|1023422_1023899_+	hypothetical protein	NA	A0A077KAW3	Edwardsiella_phage	40.5	2.2e-19
AVA33008.1|1023895_1024906_+	DUF2184 domain-containing protein	NA	Q8HAP7	Burkholderia_phage	42.1	9.8e-70
AVA33009.1|1024907_1025309_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33010.1|1025312_1025723_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
AVA33011.1|1025709_1026189_+	hypothetical protein	NA	A0A190XCA2	Acinetobacter_phage	38.4	4.1e-18
AVA33012.1|1026185_1026581_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	37.4	1.7e-17
AVA33013.1|1026583_1027129_+	hypothetical protein	NA	A6N3B1	Burkholderia_virus	25.4	1.3e-07
AVA33014.1|1027132_1028854_+	hypothetical protein	NA	A0A077KGV4	Edwardsiella_phage	31.6	3.5e-35
AVA33015.1|1028866_1029301_+	hypothetical protein	NA	H9C0W6	Aeromonas_phage	46.5	6.5e-31
AVA33016.1|1029302_1029743_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	48.0	5.8e-19
AVA33017.1|1029739_1029910_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AVA33018.1|1029918_1031907_+	hypothetical protein	NA	U5PVY0	Bacillus_phage	41.3	7.2e-16
AVA33019.1|1031908_1032559_+	hypothetical protein	NA	A0A1X9SFH6	Acinetobacter_phage	39.7	6.8e-24
AVA33020.1|1032558_1032858_+	hypothetical protein	NA	K4I3B0	Acinetobacter_phage	38.4	2.0e-07
AVA33021.1|1032854_1033724_+	hypothetical protein	NA	NA	NA	NA	NA
1033568:1033583	attL	GGACATCAAGCCGGGA	NA	NA	NA	NA
AVA33022.1|1033716_1034484_+	oxidoreductase	NA	A0A2R3UAK1	Myoviridae_environmental_samples	45.7	1.8e-36
AVA33023.1|1034490_1034844_+	hypothetical protein	NA	A0A2R3UAP1	Myoviridae_environmental_samples	46.0	1.1e-15
AVA33024.1|1034852_1036085_+	hypothetical protein	NA	H9C0X9	Aeromonas_phage	41.1	4.2e-75
AVA33025.1|1036084_1036741_+	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	49.3	2.9e-46
AVA33026.1|1036754_1038125_+	hypothetical protein	NA	Q8HAM8	Burkholderia_phage	34.8	3.6e-51
AVA33027.1|1038133_1038706_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33028.1|1038723_1039218_+	lysozyme	NA	D5LH07	Escherichia_phage	71.1	4.6e-57
AVA33029.1|1039220_1039523_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33030.1|1039526_1039790_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33031.1|1039786_1040302_+	hypothetical protein	NA	U6C7Z8	Ralstonia_phage	42.2	2.6e-18
AVA33032.1|1040305_1040791_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33033.1|1040837_1042091_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	64.2	6.7e-153
1047379:1047394	attR	TCCCGGCTTGATGTCC	NA	NA	NA	NA
>prophage 7
CP026544	Cupriavidus metallidurans strain Ni-2 chromosome, complete genome	6543877	1767824	1788945	6543877	integrase,transposase	Wolbachia_phage(25.0%)	18	1758371:1758384	1777887:1777900
1758371:1758384	attL	GGCGTTGCGGCGCC	NA	NA	NA	NA
AVA33661.1|1767824_1769828_+|integrase	integrase	integrase	NA	NA	NA	NA
AVA33662.1|1769857_1770835_+	ATP-binding protein	NA	NA	NA	NA	NA
AVA37669.1|1770902_1771454_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33663.1|1771627_1771840_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33664.1|1772213_1772435_-	hypothetical protein	NA	NA	NA	NA	NA
AVA33665.1|1772862_1774536_-|integrase	integrase	integrase	NA	NA	NA	NA
AVA33666.1|1774834_1775275_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AVA33667.1|1775290_1775698_+	heat-shock protein	NA	A0A1B2LRT2	Wolbachia_phage	29.2	1.5e-05
AVA33668.1|1775893_1776463_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AVA33669.1|1776582_1776972_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33670.1|1777113_1779054_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.0	2.1e-145
1777887:1777900	attR	GGCGCCGCAACGCC	NA	NA	NA	NA
AVA33671.1|1779145_1779418_+	hypothetical protein	NA	NA	NA	NA	NA
AVA37670.1|1779745_1780312_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AVA33672.1|1781492_1782365_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33673.1|1782392_1783578_+|transposase	IS3-like element ISRme13 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.7	3.2e-56
AVA33674.1|1784989_1786200_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.7	1.1e-99
AVA33675.1|1787082_1787394_+|transposase	transposase	transposase	NA	NA	NA	NA
AVA33676.1|1787505_1788945_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 8
CP026544	Cupriavidus metallidurans strain Ni-2 chromosome, complete genome	6543877	1807213	1848635	6543877	integrase,transposase	Burkholderia_phage(33.33%)	32	1826287:1826303	1837765:1837781
AVA33693.1|1807213_1808887_-|integrase	integrase	integrase	NA	NA	NA	NA
AVA33694.1|1809162_1809381_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33695.1|1809488_1809692_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33696.1|1809751_1810219_-	hypothetical protein	NA	NA	NA	NA	NA
AVA33697.1|1810930_1811131_-	hypothetical protein	NA	NA	NA	NA	NA
AVA33698.1|1811649_1812636_+|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	82.3	4.2e-150
AVA37673.1|1813414_1814233_-	copper resistance protein CopB	NA	NA	NA	NA	NA
AVA33699.1|1816508_1816835_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
AVA33700.1|1818900_1819197_-	hypothetical protein	NA	NA	NA	NA	NA
AVA33701.1|1820267_1820516_-	hypothetical protein	NA	NA	NA	NA	NA
AVA33702.1|1821060_1823172_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AVA33703.1|1823540_1823786_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33704.1|1824015_1824225_-	hypothetical protein	NA	NA	NA	NA	NA
AVA33705.1|1824497_1824920_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
1826287:1826303	attL	GTAATTTCCCCGTCATG	NA	NA	NA	NA
AVA37674.1|1826598_1827378_+	methyltransferase	NA	NA	NA	NA	NA
AVA33706.1|1827436_1827637_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33707.1|1828184_1828580_+	phosphoesterase	NA	NA	NA	NA	NA
AVA33708.1|1828759_1829629_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AVA33709.1|1829625_1831251_+	glycosyl transferase	NA	NA	NA	NA	NA
AVA33710.1|1831247_1831631_+	GtrA family protein	NA	NA	NA	NA	NA
AVA33711.1|1831627_1832716_+	glycosyl transferase family 2	NA	U5P087	Shigella_phage	47.5	9.2e-74
AVA33712.1|1832952_1834020_+	porin	NA	NA	NA	NA	NA
AVA37675.1|1835132_1835777_-|integrase	integrase	integrase	NA	NA	NA	NA
AVA33713.1|1836265_1837672_-	TolC family protein	NA	NA	NA	NA	NA
AVA33714.1|1839978_1840353_+	NUDIX hydrolase	NA	NA	NA	NA	NA
1837765:1837781	attR	CATGACGGGGAAATTAC	NA	NA	NA	NA
AVA33715.1|1840856_1841591_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33716.1|1841953_1842163_-	hypothetical protein	NA	NA	NA	NA	NA
AVA33717.1|1842708_1843170_+	CopH protein	NA	NA	NA	NA	NA
AVA33718.1|1844042_1845229_-|transposase	IS3-like element ISRme13 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.7	3.2e-56
AVA33719.1|1846146_1846413_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33720.1|1846772_1847084_+|transposase	transposase	transposase	NA	NA	NA	NA
AVA33721.1|1847195_1848635_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 9
CP026544	Cupriavidus metallidurans strain Ni-2 chromosome, complete genome	6543877	1874995	1938218	6543877	integrase,transposase	Bacillus_phage(27.27%)	58	1912218:1912255	1938223:1938260
AVA33743.1|1874995_1877962_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
AVA33744.1|1878313_1878601_+	nickel-cobalt-cadmium resistance protein NccY	NA	NA	NA	NA	NA
AVA33745.1|1878597_1879044_+	nickel-cobalt-cadmium resistance protein NccX	NA	NA	NA	NA	NA
AVA37677.1|1879115_1879601_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AVA33746.1|1879791_1881048_+	TolC family protein	NA	NA	NA	NA	NA
AVA33747.1|1881044_1882241_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVA33748.1|1882237_1885468_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
AVA33749.1|1885538_1886180_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
AVA33750.1|1886199_1886877_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVA33751.1|1886878_1887316_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33752.1|1887380_1888106_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33753.1|1888116_1888887_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33754.1|1889144_1889414_+	nickel resistance protein	NA	NA	NA	NA	NA
AVA33755.1|1889501_1890842_+	MFS transporter	NA	NA	NA	NA	NA
AVA33756.1|1891114_1891294_-	hypothetical protein	NA	NA	NA	NA	NA
AVA33757.1|1891309_1891660_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
AVA33758.1|1891882_1893484_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
AVA33759.1|1893480_1893864_+	GtrA family protein	NA	NA	NA	NA	NA
AVA37678.1|1893875_1894964_+	glycosyltransferase	NA	U5P087	Shigella_phage	47.7	3.0e-72
AVA33760.1|1895109_1896342_+	RimK family alpha-L-glutamate ligase	NA	NA	NA	NA	NA
AVA33761.1|1896383_1897418_+	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVA33762.1|1897424_1898252_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	6.8e-29
AVA33763.1|1898238_1899102_+	taurine ABC transporter permease	NA	NA	NA	NA	NA
AVA33764.1|1899147_1899840_+	VIT family protein	NA	NA	NA	NA	NA
AVA33765.1|1900021_1901221_-	chromate transporter	NA	NA	NA	NA	NA
AVA33766.1|1902387_1902765_-	hypothetical protein	NA	NA	NA	NA	NA
AVA33767.1|1902838_1905943_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	23.5	1.2e-62
AVA33768.1|1905952_1907065_-	hypothetical protein	NA	NA	NA	NA	NA
AVA33769.1|1907634_1908840_-	transporter	NA	NA	NA	NA	NA
AVA33770.1|1908933_1909296_-	hypothetical protein	NA	NA	NA	NA	NA
AVA33771.1|1909445_1910528_-	porin	NA	NA	NA	NA	NA
AVA33772.1|1910594_1911780_+|transposase	IS3-like element ISRme13 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.7	3.2e-56
AVA33773.1|1912001_1912217_-	hypothetical protein	NA	NA	NA	NA	NA
1912218:1912255	attL	GAGGGTCGGCAGGGATTCATGTAAAACCCAGCAGAAAC	NA	NA	NA	NA
AVA33774.1|1912265_1915259_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
AVA33775.1|1915301_1916612_-	Tn3 family resolvase	NA	NA	NA	NA	NA
AVA33776.1|1916917_1917538_-	superoxide dismutase	NA	NA	NA	NA	NA
AVA33777.1|1917537_1917885_-	hypothetical protein	NA	NA	NA	NA	NA
AVA37679.1|1918034_1919210_-	chromate transporter	NA	NA	NA	NA	NA
AVA33778.1|1919601_1919871_+	type II toxin-antitoxin system antitoxin, RelB/DinJ family	NA	NA	NA	NA	NA
AVA33779.1|1919857_1920139_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
AVA33780.1|1920354_1920927_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	51.4	1.2e-37
AVA33781.1|1920923_1921307_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33782.1|1921354_1922086_-	hypothetical protein	NA	NA	NA	NA	NA
AVA33783.1|1922084_1922354_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33784.1|1922396_1923179_+	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	39.6	1.6e-35
AVA33785.1|1923122_1924193_-	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
AVA33786.1|1924208_1926011_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.3	5.9e-33
AVA33787.1|1926007_1927834_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.7	1.0e-24
AVA33788.1|1927880_1928240_-	hypothetical protein	NA	NA	NA	NA	NA
AVA33789.1|1928299_1929202_-	DUF1259 domain-containing protein	NA	NA	NA	NA	NA
AVA33790.1|1929274_1929664_-	hypothetical protein	NA	NA	NA	NA	NA
AVA33791.1|1929679_1930138_-	chromate resistance protein	NA	NA	NA	NA	NA
AVA33792.1|1930142_1931051_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	35.5	1.0e-09
AVA33793.1|1931112_1932309_-	chromate transporter	NA	NA	NA	NA	NA
AVA33794.1|1932348_1933311_-	hypothetical protein	NA	NA	NA	NA	NA
AVA33795.1|1933542_1935081_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.5	1.2e-47
AVA37680.1|1935379_1936402_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVA33796.1|1937120_1938218_+|integrase	integrase	integrase	NA	NA	NA	NA
1938223:1938260	attR	GTTTCTGCTGGGTTTTACATGAATCCCTGCCGACCCTC	NA	NA	NA	NA
>prophage 10
CP026544	Cupriavidus metallidurans strain Ni-2 chromosome, complete genome	6543877	1975337	2031395	6543877	integrase,transposase	Salmonella_phage(40.0%)	39	2022802:2022817	2038696:2038711
AVA33827.1|1975337_1977017_-|integrase	integrase	integrase	NA	NA	NA	NA
AVA33828.1|1977809_1978955_+	PAS domain S-box protein	NA	NA	NA	NA	NA
AVA33829.1|1978951_1979596_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVA33830.1|1979626_1980079_-	universal stress protein	NA	NA	NA	NA	NA
AVA33831.1|1980299_1983266_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
AVA37681.1|1983268_1983838_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.2e-50
AVA33832.1|1983743_1984745_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AVA33833.1|1984741_1984978_-	mercury resistance protein	NA	NA	NA	NA	NA
AVA33834.1|1984974_1985340_-	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AVA33835.1|1985357_1987043_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	2.1e-40
AVA33836.1|1987114_1987390_-	mercuric transport protein periplasmic component	NA	NA	NA	NA	NA
AVA33837.1|1987402_1987753_-	mercuric transporter	NA	NA	NA	NA	NA
AVA33838.1|1987824_1988259_+	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AVA33839.1|1989776_1991894_-	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	40.1	1.5e-24
AVA33840.1|1991903_1992239_-	hypothetical protein	NA	NA	NA	NA	NA
AVA33841.1|1993923_1994346_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
AVA33842.1|1994617_1994863_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33843.1|1998307_1998541_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33844.1|1998885_1999278_+	hypothetical protein	NA	A4PE56	Ralstonia_virus	38.6	1.5e-10
AVA33845.1|1999643_2000879_+	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
AVA33846.1|2001821_2002109_+	hypothetical protein	NA	NA	NA	NA	NA
AVA37682.1|2003649_2003859_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33847.1|2004983_2005388_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33848.1|2005457_2006759_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33849.1|2006755_2008291_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVA33850.1|2008287_2011458_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
AVA33851.1|2011454_2011829_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33852.1|2011890_2012076_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33853.1|2012182_2012362_-	hypothetical protein	NA	NA	NA	NA	NA
AVA33854.1|2013278_2015396_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AVA33855.1|2017011_2018064_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AVA33856.1|2018111_2018594_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
AVA37683.1|2019246_2019525_+	transcriptional regulator	NA	NA	NA	NA	NA
AVA37684.1|2019566_2020574_+	cation transporter	NA	NA	NA	NA	NA
AVA33857.1|2022140_2022452_+|transposase	transposase	transposase	NA	NA	NA	NA
AVA33858.1|2022563_2024003_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
2022802:2022817	attL	GACTGCGCGACGATTG	NA	NA	NA	NA
AVA33859.1|2023999_2024833_+	general secretion pathway protein GspA	NA	NA	NA	NA	NA
AVA33860.1|2024829_2025102_+	hypothetical protein	NA	NA	NA	NA	NA
AVA33861.1|2029709_2031395_-|integrase	integrase	integrase	NA	NA	NA	NA
2038696:2038711	attR	CAATCGTCGCGCAGTC	NA	NA	NA	NA
>prophage 11
CP026544	Cupriavidus metallidurans strain Ni-2 chromosome, complete genome	6543877	2648650	2762905	6543877	integrase,transposase	Bacillus_phage(15.79%)	95	2647484:2647501	2684317:2684334
2647484:2647501	attL	GCGGTGGACCGGATGCGG	NA	NA	NA	NA
AVA34376.1|2648650_2650090_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AVA34377.1|2650201_2650513_-|transposase	transposase	transposase	NA	NA	NA	NA
AVA34378.1|2650859_2652011_-	hypothetical protein	NA	NA	NA	NA	NA
AVA34379.1|2652486_2653032_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
AVA34380.1|2653044_2653581_-	nitronate monooxygenase	NA	NA	NA	NA	NA
AVA34381.1|2653605_2654202_-	hypothetical protein	NA	NA	NA	NA	NA
AVA34382.1|2654712_2655078_+	hypothetical protein	NA	NA	NA	NA	NA
AVA34383.1|2655400_2655637_+	antitoxin VapB	NA	NA	NA	NA	NA
AVA34384.1|2655623_2655836_+	hypothetical protein	NA	NA	NA	NA	NA
AVA34385.1|2655846_2656062_+	hypothetical protein	NA	NA	NA	NA	NA
AVA34386.1|2656379_2656661_-	hypothetical protein	NA	NA	NA	NA	NA
AVA34387.1|2656983_2657175_+	hypothetical protein	NA	NA	NA	NA	NA
AVA34388.1|2657248_2657875_+|integrase	integrase	integrase	A0A0A8WI70	Clostridium_phage	31.5	2.5e-07
AVA34389.1|2658306_2658951_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVA34390.1|2659120_2659387_-	hypothetical protein	NA	NA	NA	NA	NA
AVA34391.1|2659581_2659935_-	copper resistance protein CopV	NA	NA	NA	NA	NA
AVA37728.1|2660002_2660767_-	cytochrome c	NA	NA	NA	NA	NA
AVA34392.1|2662073_2662358_+	copper resistance protein K	NA	NA	NA	NA	NA
AVA34393.1|2662382_2662835_-	copper resistance protein CopN	NA	NA	NA	NA	NA
AVA34394.1|2662927_2664319_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.9	3.3e-07
AVA34395.1|2664315_2665002_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.9	4.6e-31
AVA34396.1|2665205_2667050_+	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
AVA37729.1|2667621_2668569_+	copper resistance protein B	NA	NA	NA	NA	NA
AVA34397.1|2668612_2668999_+	copper resistance protein CopC	NA	NA	NA	NA	NA
AVA34398.1|2669005_2669923_+	copper resistance protein CopD	NA	NA	NA	NA	NA
AVA34399.1|2670194_2670629_-	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AVA34400.1|2670700_2671051_+	mercuric transporter	NA	NA	NA	NA	NA
AVA34401.1|2671063_2671339_+	mercuric transport protein periplasmic component	NA	NA	NA	NA	NA
AVA34402.1|2671410_2673096_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	2.1e-40
AVA34403.1|2673113_2673479_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AVA34404.1|2673475_2673712_+	mercury resistance protein	NA	NA	NA	NA	NA
AVA34405.1|2673708_2674710_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AVA37730.1|2674615_2675185_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.2e-50
AVA34406.1|2675187_2678154_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
AVA34407.1|2678766_2679942_+|integrase	integrase	integrase	A0A166YH27	Gordonia_phage	27.8	1.4e-06
AVA34408.1|2679981_2683308_+	helicase	NA	A0A0N7D8L3	Dasychira_pudibunda_nucleopolyhedrovirus	32.5	1.7e-54
AVA34409.1|2683877_2684648_-	hypothetical protein	NA	NA	NA	NA	NA
2684317:2684334	attR	GCGGTGGACCGGATGCGG	NA	NA	NA	NA
AVA34410.1|2684644_2685583_-	transcriptional regulator	NA	NA	NA	NA	NA
AVA34411.1|2686961_2687420_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	36.2	3.2e-12
AVA34412.1|2687603_2688320_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
AVA34413.1|2688349_2688529_+	hypothetical protein	NA	NA	NA	NA	NA
AVA34414.1|2688592_2688916_-	hypothetical protein	NA	NA	NA	NA	NA
AVA34415.1|2689057_2690314_+	cobalt-zinc-cadmium resistance protein CzcC	NA	NA	NA	NA	NA
AVA34416.1|2690331_2691894_+	cobalt-zinc-cadmium resistance protein CzcB	NA	NA	NA	NA	NA
AVA34417.1|2691910_2695102_+	cation efflux system protein CzcA	NA	NA	NA	NA	NA
AVA34418.1|2695152_2696103_+	metal cation efflux system protein CzcD	NA	NA	NA	NA	NA
AVA34419.1|2696104_2696782_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.8	4.9e-33
AVA34420.1|2696753_2698217_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	21.9	1.9e-13
AVA34421.1|2698285_2699471_+|transposase	IS3-like element ISRme13 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.7	3.2e-56
AVA34422.1|2699620_2700688_-	porin	NA	NA	NA	NA	NA
AVA34423.1|2700804_2701991_-|transposase	IS3-like element ISRme13 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.7	3.2e-56
AVA34424.1|2702275_2702698_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
AVA34425.1|2703197_2705687_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	39.0	3.9e-112
AVA34426.1|2705744_2706047_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AVA34427.1|2706275_2707397_-	glycosyltransferase	NA	U5P087	Shigella_phage	48.3	1.6e-73
AVA34428.1|2707393_2707777_-	GtrA family protein	NA	NA	NA	NA	NA
AVA34429.1|2707773_2709381_-	glycosyl transferase	NA	NA	NA	NA	NA
AVA34430.1|2709481_2709706_+	hypothetical protein	NA	NA	NA	NA	NA
AVA34431.1|2710815_2711061_+	hypothetical protein	NA	NA	NA	NA	NA
AVA34432.1|2711780_2713418_+	glycosyl transferase	NA	NA	NA	NA	NA
AVA34433.1|2713414_2713798_+	GtrA family protein	NA	NA	NA	NA	NA
AVA34434.1|2713794_2714916_+	glycosyltransferase	NA	U5P087	Shigella_phage	48.3	1.6e-73
AVA34435.1|2714961_2715483_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVA34436.1|2716280_2716505_-	hypothetical protein	NA	NA	NA	NA	NA
AVA34437.1|2717027_2717306_+	hypothetical protein	NA	NA	NA	NA	NA
AVA34438.1|2717900_2718122_+	hypothetical protein	NA	NA	NA	NA	NA
AVA34439.1|2718283_2718682_+	copper resistance protein	NA	NA	NA	NA	NA
AVA34440.1|2718754_2719756_+	hypothetical protein	NA	NA	NA	NA	NA
AVA34441.1|2719842_2720115_-	hypothetical protein	NA	NA	NA	NA	NA
AVA34442.1|2720111_2720945_-	general secretion pathway protein GspA	NA	NA	NA	NA	NA
AVA34443.1|2720941_2722381_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AVA34444.1|2722492_2722804_-|transposase	transposase	transposase	NA	NA	NA	NA
AVA34445.1|2722737_2723583_+	hypothetical protein	NA	NA	NA	NA	NA
AVA34446.1|2723579_2725142_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVA34447.1|2725138_2728309_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
AVA34448.1|2728305_2728644_+	hypothetical protein	NA	NA	NA	NA	NA
AVA34449.1|2729132_2729780_-	cytochrome c	NA	NA	NA	NA	NA
AVA34450.1|2729787_2730012_-	hypothetical protein	NA	NA	NA	NA	NA
AVA34451.1|2730323_2730650_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
AVA37731.1|2732075_2732444_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AVA34452.1|2732419_2732635_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AVA34453.1|2732708_2732912_+	hypothetical protein	NA	NA	NA	NA	NA
AVA34454.1|2734405_2735416_-|transposase	IS30 family transposase ISRme10	transposase	Q9MBM9	Staphylococcus_prophage	34.3	1.2e-40
AVA34455.1|2735500_2735764_+	hypothetical protein	NA	NA	NA	NA	NA
AVA37732.1|2739611_2739917_-	hypothetical protein	NA	NA	NA	NA	NA
AVA34456.1|2740369_2740570_+	hypothetical protein	NA	NA	NA	NA	NA
AVA34457.1|2740644_2741721_-	signal peptidase II	NA	NA	NA	NA	NA
AVA34458.1|2741717_2744117_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	48.1	6.2e-147
AVA34459.1|2744203_2744641_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AVA34460.1|2755242_2756334_+	signal peptidase II	NA	NA	NA	NA	NA
AVA37733.1|2756382_2758299_+	iron permease	NA	NA	NA	NA	NA
AVA34461.1|2758386_2759001_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	49.0	2.8e-35
AVA34462.1|2759061_2760279_-|transposase	transposase	transposase	NA	NA	NA	NA
AVA34463.1|2760275_2761184_-|transposase	transposase	transposase	NA	NA	NA	NA
AVA34464.1|2761186_2762905_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
CP026544	Cupriavidus metallidurans strain Ni-2 chromosome, complete genome	6543877	4476083	4527127	6543877	integrase,transposase	Salmonella_phage(28.57%)	34	4499305:4499321	4527537:4527553
AVA35853.1|4476083_4479050_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
AVA35854.1|4479770_4481408_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AVA35855.1|4481670_4482258_+	peroxiredoxin	NA	NA	NA	NA	NA
AVA35856.1|4482303_4483446_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVA35857.1|4483442_4484789_+	rubredoxin	NA	NA	NA	NA	NA
AVA35858.1|4484847_4486245_+	nitrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVA35859.1|4486264_4487149_+	nitrate ABC transporter, permease protein	NA	NA	NA	NA	NA
AVA35860.1|4487138_4488089_+	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.2	9.9e-32
AVA35861.1|4488136_4488586_+	cyanase	NA	NA	NA	NA	NA
AVA35862.1|4488627_4489428_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AVA35863.1|4489441_4490305_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AVA35864.1|4490959_4491382_-	DNA-binding protein	NA	NA	NA	NA	NA
AVA35865.1|4491465_4492524_-	hypothetical protein	NA	NA	NA	NA	NA
AVA35866.1|4492563_4493001_-	hypothetical protein	NA	NA	NA	NA	NA
AVA37863.1|4493185_4493875_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AVA35867.1|4497861_4498422_-|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	87.1	1.6e-50
AVA35868.1|4498834_4501774_+	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
4499305:4499321	attL	TCCGGGCCCGCGCCAGC	NA	NA	NA	NA
AVA35869.1|4501770_4502658_+	hypothetical protein	NA	NA	NA	NA	NA
AVA35870.1|4502654_4504223_+	hypothetical protein	NA	NA	NA	NA	NA
AVA35871.1|4504324_4506010_+|integrase	integrase	integrase	NA	NA	NA	NA
AVA35872.1|4507005_4508982_-	cellulose synthase	NA	M1HVH2	Acanthocystis_turfacea_Chlorella_virus	27.9	3.1e-27
AVA35873.1|4508996_4510352_-	hypothetical protein	NA	NA	NA	NA	NA
AVA35874.1|4510422_4511754_-	multidrug transporter	NA	NA	NA	NA	NA
AVA35875.1|4511875_4513085_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.7	1.1e-99
AVA35876.1|4513555_4513987_+	universal stress protein	NA	NA	NA	NA	NA
AVA35877.1|4514199_4515039_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AVA35878.1|4515038_4515896_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVA35879.1|4515928_4517782_-	acyl-CoA synthetase	NA	NA	NA	NA	NA
AVA35880.1|4518217_4518763_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AVA35881.1|4519128_4519662_-	ATP-binding protein	NA	NA	NA	NA	NA
AVA35882.1|4519890_4521357_-	RND transporter	NA	NA	NA	NA	NA
AVA35883.1|4521356_4522553_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVA35884.1|4522549_4525747_-	RND transporter	NA	S5VTK5	Leptospira_phage	21.8	4.8e-62
AVA35885.1|4525940_4527127_-|transposase	IS3-like element ISRme13 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.7	3.2e-56
4527537:4527553	attR	GCTGGCGCGGGCCCGGA	NA	NA	NA	NA
>prophage 13
CP026544	Cupriavidus metallidurans strain Ni-2 chromosome, complete genome	6543877	5763284	5773682	6543877		Roseobacter_phage(14.29%)	9	NA	NA
AVA36918.1|5763284_5764874_+	polynucleotide adenylyltransferase PcnB	NA	A0A1B0V011	Roseobacter_phage	31.2	4.5e-21
AVA36919.1|5764875_5765397_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AVA36920.1|5765420_5766062_+	deoxynucleoside kinase	NA	A0A1J0F9Q3	Only_Syngen_Nebraska_virus	27.0	6.3e-06
AVA36921.1|5766198_5767020_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0P0BXC9	Ostreococcus_lucimarinus_virus	33.3	1.5e-36
AVA36922.1|5767027_5767726_+	ABC transporter permease	NA	NA	NA	NA	NA
AVA36923.1|5767722_5768412_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	1.9e-16
AVA37927.1|5768442_5770338_-	aminodeoxychorismate synthase, component I	NA	S4VT78	Pandoravirus	34.9	1.1e-50
AVA36924.1|5770421_5771561_-	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	35.5	1.2e-23
AVA36925.1|5771735_5773682_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.5	1.4e-144
>prophage 14
CP026544	Cupriavidus metallidurans strain Ni-2 chromosome, complete genome	6543877	6294611	6300665	6543877		uncultured_Caudovirales_phage(33.33%)	9	NA	NA
AVA37364.1|6294611_6295199_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	34.0	2.0e-14
AVA37960.1|6295229_6295634_-	YraN family protein	NA	NA	NA	NA	NA
AVA37365.1|6295686_6296586_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	40.6	6.3e-36
AVA37366.1|6296670_6297324_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	53.9	1.9e-18
AVA37367.1|6297722_6298373_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AVA37368.1|6298376_6299024_+	exonuclease	NA	A0A2L0UZL4	Agrobacterium_phage	40.5	3.5e-36
AVA37369.1|6299231_6299462_+	hypothetical protein	NA	NA	NA	NA	NA
AVA37370.1|6299553_6299913_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	44.4	1.4e-18
AVA37961.1|6300104_6300665_+	GNAT family N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	39.3	1.2e-21
>prophage 1
CP026546	Cupriavidus metallidurans strain Ni-2 plasmid unnamed2	197700	96948	148177	197700	protease,integrase,transposase	Mycobacterium_phage(14.29%)	59	112796:112812	130215:130231
AVA38086.1|96948_98118_+|protease	metalloprotease	protease	NA	NA	NA	NA
AVA38087.1|98182_98362_-	hypothetical protein	NA	NA	NA	NA	NA
AVA38088.1|98358_98631_-	hypothetical protein	NA	NA	NA	NA	NA
AVA38089.1|99385_100009_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38090.1|101250_101499_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38091.1|101495_101720_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38092.1|101726_102125_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38093.1|102365_102689_-	hypothetical protein	NA	NA	NA	NA	NA
AVA38094.1|102754_102982_-	hypothetical protein	NA	NA	NA	NA	NA
AVA38095.1|103059_103704_-	hypothetical protein	NA	NA	NA	NA	NA
AVA38096.1|103720_103912_-	hypothetical protein	NA	NA	NA	NA	NA
AVA38097.1|104045_104624_-	hypothetical protein	NA	NA	NA	NA	NA
AVA38098.1|104671_105400_-	hypothetical protein	NA	NA	NA	NA	NA
AVA38099.1|105661_106189_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38100.1|106529_107063_-	hypothetical protein	NA	NA	NA	NA	NA
AVA38101.1|107186_107921_-	hypothetical protein	NA	NA	NA	NA	NA
AVA38102.1|107985_108927_-	hypothetical protein	NA	NA	NA	NA	NA
AVA38103.1|108899_109304_-	hypothetical protein	NA	NA	NA	NA	NA
AVA38104.1|109434_109671_-	hypothetical protein	NA	NA	NA	NA	NA
AVA38105.1|110119_110476_-	hypothetical protein	NA	NA	NA	NA	NA
AVA38106.1|110498_110777_-	hypothetical protein	NA	NA	NA	NA	NA
AVA38107.1|111036_112473_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
112796:112812	attL	GGCGACGATTTTGCGTA	NA	NA	NA	NA
AVA38108.1|112914_113217_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38109.1|113219_113699_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AVA38110.1|113722_114103_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38111.1|114282_114588_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38112.1|114636_115485_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVA38113.1|115991_116831_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38114.1|116888_117614_-	hypothetical protein	NA	NA	NA	NA	NA
AVA38115.1|117830_118217_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38116.1|118240_118498_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38117.1|118516_118888_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38118.1|119101_119473_-	hypothetical protein	NA	NA	NA	NA	NA
AVA38119.1|119608_119884_-	hypothetical protein	NA	NA	NA	NA	NA
AVA38120.1|120116_121373_+	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
AVA38121.1|121664_121952_+	DNA-binding protein	NA	NA	NA	NA	NA
AVA38122.1|122060_122447_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38123.1|122620_123100_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38124.1|123326_123890_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38125.1|124060_125032_+	hypothetical protein	NA	A0A1D8EVK5	Mycobacterium_phage	29.3	8.1e-13
AVA38126.1|125434_126613_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AVA38127.1|126609_128103_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38128.1|128099_130028_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38129.1|130024_130507_+	hypothetical protein	NA	NA	NA	NA	NA
130215:130231	attR	TACGCAAAATCGTCGCC	NA	NA	NA	NA
AVA38130.1|130724_131609_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVA38131.1|131605_132616_-	hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.8	5.6e-25
AVA38192.1|132640_133438_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
AVA38132.1|133450_134311_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVA38193.1|134313_135132_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	5.4e-26
AVA38133.1|135908_136778_-|transposase	IS5/IS1182 family transposase	transposase	A0A077K814	Ralstonia_phage	69.3	7.5e-103
AVA38134.1|137218_137917_+	Urease subunit alpha	NA	NA	NA	NA	NA
AVA38135.1|138862_139174_+|transposase	transposase	transposase	NA	NA	NA	NA
AVA38136.1|139285_140725_+|transposase	IS481 family transposase	transposase	O12274	Simian_T-lymphotropic_virus	37.8	4.1e-05
AVA38137.1|140721_141555_+	general secretion pathway protein GspA	NA	NA	NA	NA	NA
AVA38138.1|141551_141824_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38139.1|142095_142968_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	37.8	7.3e-05
AVA38140.1|142960_143986_-	hydroxyacid dehydrogenase	NA	M1NSB9	Streptococcus_phage	26.0	5.7e-17
AVA38141.1|144698_145115_-	DUF1772 domain-containing protein	NA	NA	NA	NA	NA
AVA38142.1|147865_148177_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
CP026547	Cupriavidus metallidurans strain Ni-2 plasmid unnamed3	180778	8324	57011	180778	transposase,integrase	Salmonella_phage(20.0%)	39	41621:41637	52101:52117
AVA38208.1|8324_10010_-|integrase	integrase	integrase	A0A0K2CP59	Brevibacillus_phage	26.8	8.8e-07
AVA38209.1|10111_11680_-	hypothetical protein	NA	NA	NA	NA	NA
AVA38210.1|11676_12564_-	hypothetical protein	NA	NA	NA	NA	NA
AVA38211.1|12560_15500_-	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
AVA38212.1|15620_15971_-	transcriptional regulator	NA	NA	NA	NA	NA
AVA38213.1|16158_16719_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	9.6e-51
AVA38214.1|16721_19691_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.3	0.0e+00
AVA38215.1|20386_21346_+|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	45.3	1.8e-65
AVA38216.1|21432_22452_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	3.2e-44
AVA38383.1|23198_23540_-	hypothetical protein	NA	NA	NA	NA	NA
AVA38217.1|23612_24323_-	hypothetical protein	NA	NA	NA	NA	NA
AVA38218.1|24319_25606_-	ABC transporter permease	NA	NA	NA	NA	NA
AVA38219.1|25688_26468_-	ABC transporter	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	6.9e-15
AVA38220.1|26546_26729_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38221.1|27339_28158_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AVA38222.1|28322_29243_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVA38223.1|29309_30107_+	sulfate ABC transporter permease	NA	NA	NA	NA	NA
AVA38224.1|30111_31161_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	34.0	1.3e-13
AVA38384.1|31545_32508_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38225.1|32538_33747_+	chromate transporter	NA	NA	NA	NA	NA
AVA38226.1|33770_34364_+	superoxide dismutase	NA	NA	NA	NA	NA
AVA38227.1|34381_34720_+	sulfurtransferase	NA	NA	NA	NA	NA
AVA38228.1|34719_35178_+	chromate resistance protein	NA	NA	NA	NA	NA
AVA38229.1|35284_35845_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38385.1|36007_36334_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38230.1|36349_36667_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38231.1|36988_37912_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38232.1|37963_39106_+	c-type cytochrome biogenesis protein CcsB	NA	NA	NA	NA	NA
AVA38233.1|39329_40346_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38234.1|40607_41120_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38235.1|41429_43592_-	cytochrome C biogenesis protein ResB	NA	NA	NA	NA	NA
41621:41637	attL	CGAACACACCCAGCACC	NA	NA	NA	NA
AVA38386.1|43742_45125_-	chromate transporter	NA	A0A219VHC2	Ochrobactrum_phage	77.4	1.3e-37
AVA38236.1|45841_46570_+	peptidase	NA	NA	NA	NA	NA
AVA38237.1|46836_48540_+|integrase	integrase	integrase	NA	NA	NA	NA
AVA38238.1|48681_52947_+	hypothetical protein	NA	H2DE57	Erwinia_phage	37.3	1.4e-221
52101:52117	attR	GGTGCTGGGTGTGTTCG	NA	NA	NA	NA
AVA38239.1|52992_53295_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38240.1|53401_54724_+	hypothetical protein	NA	NA	NA	NA	NA
AVA38241.1|55148_55460_+|transposase	transposase	transposase	NA	NA	NA	NA
AVA38242.1|55571_57011_+|transposase	IS481 family transposase	transposase	O12274	Simian_T-lymphotropic_virus	37.8	4.1e-05
