The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	271013	339096	3602752	transposase	Bacillus_phage(30.0%)	60	NA	NA
AVD54911.1|271013_272189_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	42.6	3.6e-84
AVD54912.1|273245_275480_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	61.0	1.0e-260
AVD54913.1|275464_275947_+	flavodoxin	NA	A0A060AL80	Listeria_phage	36.9	6.2e-14
AVD54914.1|275891_276935_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A059T7I4	Listeria_phage	56.9	5.8e-110
AVD54915.1|277257_277872_-	hypothetical protein	NA	NA	NA	NA	NA
AVD54916.1|277868_278954_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
AVD54917.1|279222_280152_+|transposase	transposase	transposase	NA	NA	NA	NA
AVD54918.1|280153_280390_+	hypothetical protein	NA	NA	NA	NA	NA
AVD54919.1|280386_280650_+	hypothetical protein	NA	NA	NA	NA	NA
AVD54920.1|280782_281280_+	thioesterase	NA	NA	NA	NA	NA
AVD54921.1|281336_282353_+	EamA family transporter	NA	NA	NA	NA	NA
AVD57779.1|282366_282681_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AVD57780.1|282680_283022_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AVD54922.1|283115_283898_-	hypothetical protein	NA	NA	NA	NA	NA
AVD54923.1|284037_285063_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AVD54924.1|285062_286109_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AVD54925.1|286265_287228_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVD54926.1|287250_287475_+	hypothetical protein	NA	NA	NA	NA	NA
AVD54927.1|287556_288372_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.2	1.2e-17
AVD54928.1|288409_289441_+	thioredoxin reductase	NA	G3MA85	Bacillus_virus	26.6	2.9e-21
AVD54929.1|289580_290219_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57781.1|290647_291268_+	membrane-spanning protein	NA	NA	NA	NA	NA
AVD54930.1|291260_291848_+	hypothetical protein	NA	NA	NA	NA	NA
AVD54931.1|291936_292140_-	hypothetical protein	NA	NA	NA	NA	NA
AVD54932.1|292232_292952_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AVD54933.1|293150_294170_+	STAS domain-containing protein	NA	NA	NA	NA	NA
AVD54934.1|294357_295602_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVD54935.1|295579_296353_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
AVD54936.1|298121_298685_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVD54937.1|298837_299026_+	hypothetical protein	NA	NA	NA	NA	NA
AVD54938.1|299411_299816_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AVD54939.1|299858_300917_+	phosphotransferase family protein	NA	NA	NA	NA	NA
AVD54940.1|301300_302719_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AVD54941.1|305762_307166_-	pectate lyase	NA	D6R401	Bacillus_phage	47.8	1.3e-99
AVD54942.1|307335_307641_+	hypothetical protein	NA	NA	NA	NA	NA
AVD54943.1|308162_308888_+	phosphoadenylyl-sulfate reductase	NA	M4W6M9	Bacillus_phage	24.5	5.3e-09
AVD54944.1|309111_309291_+	hypothetical protein	NA	NA	NA	NA	NA
AVD54945.1|309287_310046_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
AVD54946.1|310052_310793_+	sirohydrochlorin chelatase	NA	NA	NA	NA	NA
AVD54947.1|310835_311060_+	hypothetical protein	NA	NA	NA	NA	NA
AVD54948.1|311079_311706_+	siroheme synthase	NA	NA	NA	NA	NA
AVD54949.1|311838_312369_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
AVD54950.1|313977_315081_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
AVD54951.1|315313_316906_+	AMP-dependent synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	27.5	1.3e-44
AVD57782.1|317553_318594_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AVD54952.1|318885_319110_-	hypothetical protein	NA	NA	NA	NA	NA
AVD54953.1|319232_320162_-	EamA family transporter	NA	NA	NA	NA	NA
AVD54954.1|320383_321277_+	NERD nuclease	NA	NA	NA	NA	NA
AVD54955.1|321994_322936_-	cation transporter	NA	NA	NA	NA	NA
AVD54956.1|323232_325068_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	38.1	4.9e-104
AVD57783.1|326812_327754_+	mevalonate kinase	NA	NA	NA	NA	NA
AVD54957.1|327801_328038_-	hypothetical protein	NA	NA	NA	NA	NA
AVD54958.1|328096_329077_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
AVD54959.1|329073_329307_-	hypothetical protein	NA	NA	NA	NA	NA
AVD54960.1|330669_331314_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVD54961.1|331675_333070_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AVD54962.1|333241_334270_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AVD54963.1|334326_334896_+	dihydrofolate reductase	NA	NA	NA	NA	NA
AVD54964.1|335486_336797_+|transposase	transposase	transposase	NA	NA	NA	NA
AVD54965.1|337758_339096_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	974650	980835	3602752		Streptococcus_phage(33.33%)	7	NA	NA
AVD55451.1|974650_975598_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.8	7.0e-86
AVD55452.1|976387_976846_+	8-oxo-dGTP diphosphatase	NA	K4F7D9	Cronobacter_phage	33.3	6.9e-07
AVD55453.1|976882_977773_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	4.3e-05
AVD55454.1|977769_978750_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	44.6	1.2e-67
AVD55455.1|978830_979784_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.1	9.2e-54
AVD55456.1|979894_980164_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AVD55457.1|980250_980835_-	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.0	1.3e-53
>prophage 3
CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	1583529	1591960	3602752	transposase	Ostreococcus_lucimarinus_virus(16.67%)	9	NA	NA
AVD56024.1|1583529_1585200_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRP3	Ostreococcus_lucimarinus_virus	34.5	9.2e-49
AVD56025.1|1585265_1585562_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56026.1|1585658_1586189_-	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AVD56027.1|1586436_1586688_+	hypothetical protein	NA	NA	NA	NA	NA
AVD56028.1|1586836_1587040_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	5.9e-19
AVD56029.1|1587212_1588262_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	27.8	2.0e-25
AVD56030.1|1588577_1589225_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	53.0	8.5e-59
AVD56031.1|1589387_1590611_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	46.5	3.7e-79
AVD56032.1|1591021_1591960_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	34.3	1.4e-30
>prophage 4
CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	1770313	1834964	3602752	protease,terminase,capsid,tRNA,integrase,transposase,tail,portal,holin,head	Bacillus_phage(26.67%)	74	1772306:1772365	1808184:1808282
AVD56198.1|1770313_1770967_-	resolvase	NA	D7RWL2	Brochothrix_phage	25.3	3.2e-05
AVD56199.1|1770963_1771302_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
AVD56200.1|1771508_1772129_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	2.5e-15
1772306:1772365	attL	ACAAAAACCCCTCAAAGCCTTACGCTTCAAGGGGTTTCTTGCTTAATACATTTCGATATA	NA	NA	NA	NA
AVD56201.1|1772578_1773295_+	hypothetical protein	NA	NA	NA	NA	NA
AVD56202.1|1773399_1774239_-	LysM peptidoglycan-binding domain-containing protein	NA	Q5ILA1	Bacillus_phage	29.8	4.8e-14
AVD57844.1|1774293_1774527_-|holin	phage holin	holin	M4ZR48	Bacillus_phage	67.5	3.9e-22
AVD57845.1|1774544_1774802_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56203.1|1774935_1775190_-	hypothetical protein	NA	A0A2H4J8H2	uncultured_Caudovirales_phage	41.5	5.5e-06
AVD56204.1|1775430_1775721_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56205.1|1775736_1776465_-	hypothetical protein	NA	A0A2P0ZL22	Lactobacillus_phage	38.2	4.8e-34
AVD56206.1|1776474_1777944_-	hypothetical protein	NA	A0A0U4JVA9	Exiguobacterium_phage	43.4	4.5e-15
AVD56207.1|1777943_1779350_-	hypothetical protein	NA	Q9T1A5	Listeria_phage	41.1	2.9e-72
AVD56208.1|1779358_1780183_-	hypothetical protein	NA	A8ATA8	Listeria_phage	34.3	4.7e-30
AVD56209.1|1780191_1784385_-	hypothetical protein	NA	A0A059T5F4	Listeria_phage	33.0	1.2e-89
AVD56210.1|1784666_1784993_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56211.1|1785046_1785655_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVD56212.1|1785667_1786054_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56213.1|1786050_1786485_-|head,tail	head-tail adaptor protein	head,tail	A0A1B1P9Z7	Enterococcus_phage	33.3	4.9e-10
AVD56214.1|1786481_1786814_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AVD56215.1|1786816_1787098_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A6M953	Geobacillus_virus	60.9	5.9e-25
AVD56216.1|1787111_1788275_-|capsid	phage major capsid protein	capsid	A0A0A7S154	Clostridium_phage	43.4	3.9e-78
AVD56217.1|1788274_1788994_-|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	53.6	2.8e-55
AVD56218.1|1788980_1790267_-|portal	phage portal protein	portal	Q0SPK2	Clostridium_phage	54.3	5.7e-131
AVD56219.1|1790285_1791854_-|terminase	terminase large subunit	terminase	A0A2I7SBY8	Paenibacillus_phage	74.7	7.6e-247
AVD56220.1|1791843_1792380_-	hypothetical protein	NA	A0A2I7SBY3	Paenibacillus_phage	34.3	1.9e-16
AVD56221.1|1792487_1792859_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	52.3	1.9e-31
AVD56222.1|1792864_1793083_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56223.1|1793406_1793706_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56224.1|1793867_1794410_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	60.6	8.7e-57
AVD56225.1|1794406_1794862_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	54.9	1.5e-38
AVD56226.1|1794964_1795651_-	hypothetical protein	NA	A0A2P1JTZ2	Anoxybacillus_phage	39.1	4.8e-36
AVD56227.1|1795713_1795953_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56228.1|1795970_1796171_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56229.1|1796176_1796479_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56230.1|1796493_1796808_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56231.1|1796944_1797133_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56232.1|1797265_1797475_-|terminase	terminase	terminase	NA	NA	NA	NA
AVD56233.1|1797736_1798732_-	replication protein	NA	A0A0U4JX08	Bacillus_phage	59.8	1.3e-37
AVD56234.1|1798744_1799044_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56235.1|1799272_1799464_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56236.1|1799550_1799832_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57846.1|1799844_1800114_-	group-specific protein	NA	A0A1B1P7U4	Bacillus_phage	62.8	3.5e-27
AVD56237.1|1800138_1800660_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVD56238.1|1800948_1801176_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVD56239.1|1801321_1801741_+	XRE family transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	51.7	3.0e-09
AVD56240.1|1801869_1802787_+	NAD-dependent DNA ligase	NA	NA	NA	NA	NA
AVD56241.1|1802816_1803779_+	hypothetical protein	NA	A0A0A8WJ41	Clostridium_phage	39.2	1.9e-30
AVD56242.1|1803924_1805439_+	hypothetical protein	NA	NA	NA	NA	NA
AVD56243.1|1805469_1806333_+	DNA methyltransferase	NA	M4SNK2	Cyanophage	24.5	1.0e-06
AVD56244.1|1806431_1806941_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AVD56245.1|1806977_1808117_+|integrase	site-specific integrase	integrase	A0A0S2SXP1	Bacillus_phage	71.9	2.0e-71
AVD56246.1|1808225_1809563_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
1808184:1808282	attR	ACAAAAACCCCTCAAAGCCTTACGCTTCAAGGGGTTTCTTGCTTAATACATTTCGATATACTGGTCGCGTTCCCATTGGTGGACTTGTGTGCGGAACAT	NA	NA	NA	NA
AVD56247.1|1809632_1810022_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AVD56248.1|1810114_1813714_-	dynamin	NA	NA	NA	NA	NA
AVD56249.1|1813879_1814083_+	methionine aminopeptidase	NA	NA	NA	NA	NA
AVD56250.1|1815092_1816406_-	purine permease	NA	NA	NA	NA	NA
AVD56251.1|1816402_1816990_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AVD56252.1|1817318_1817522_+	hypothetical protein	NA	NA	NA	NA	NA
AVD56253.1|1817536_1819057_-	carboxypeptidase M32	NA	NA	NA	NA	NA
AVD56254.1|1819138_1820284_-	RNA methyltransferase	NA	NA	NA	NA	NA
AVD56255.1|1821013_1821316_-	cell division regulator GpsB	NA	NA	NA	NA	NA
AVD56256.1|1821396_1821948_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
AVD56257.1|1822017_1822269_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56258.1|1822607_1823906_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56259.1|1823886_1826187_-	DUF1998 domain-containing protein	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	32.5	1.5e-09
AVD56260.1|1826336_1826780_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AVD56261.1|1827410_1827773_-	DUF1798 domain-containing protein	NA	NA	NA	NA	NA
AVD56262.1|1827840_1828080_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56263.1|1828108_1828345_-|transposase	transposase	transposase	NA	NA	NA	NA
AVD56264.1|1828636_1829242_+	Holliday junction resolvase RecU	NA	NA	NA	NA	NA
AVD56265.1|1829334_1832070_+	penicillin-binding protein	NA	NA	NA	NA	NA
AVD56266.1|1832157_1832817_-	endonuclease III	NA	NA	NA	NA	NA
AVD56267.1|1832864_1833560_-	DnaD domain protein	NA	A0A0N7AE27	Bacillus_phage	48.7	2.3e-25
AVD57847.1|1833671_1834964_-|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	30.8	2.7e-56
>prophage 5
CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	1843167	1886769	3602752	tRNA,protease,coat	Bacillus_phage(22.22%)	54	NA	NA
AVD56275.1|1843167_1844370_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	46.6	1.7e-41
AVD56276.1|1844323_1845508_-	N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA	NA	NA	NA	NA	NA
AVD56277.1|1845504_1846212_-	bacillithiol biosynthesis deacetylase BshB1	NA	NA	NA	NA	NA
AVD56278.1|1846230_1847031_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AVD56279.1|1847037_1847382_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
AVD56280.1|1847533_1848397_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	44.8	4.7e-73
AVD56281.1|1848423_1848906_-	QueT transporter family protein	NA	NA	NA	NA	NA
AVD56282.1|1849059_1849746_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AVD56283.1|1849809_1850601_-	sporulation protein YpjB	NA	NA	NA	NA	NA
AVD56284.1|1850715_1851312_-	DUF1405 domain-containing protein	NA	NA	NA	NA	NA
AVD56285.1|1851399_1852164_-	cytochrome C oxidase Cbb3	NA	NA	NA	NA	NA
AVD56286.1|1852202_1852877_-	cytochrome b/b6	NA	NA	NA	NA	NA
AVD56287.1|1852887_1853400_-	menaquinol-cytochrome C reductase	NA	NA	NA	NA	NA
AVD56288.1|1853562_1854024_-	DUF2487 domain-containing protein	NA	NA	NA	NA	NA
AVD56289.1|1854069_1854615_-	hypothetical protein	NA	G3MAV7	Bacillus_virus	53.6	7.6e-45
AVD56290.1|1854750_1856016_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AVD56291.1|1856237_1856516_+	hypothetical protein	NA	NA	NA	NA	NA
AVD56292.1|1856474_1857758_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AVD56293.1|1857773_1858874_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
AVD56294.1|1858937_1860032_-	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	27.9	2.5e-26
AVD56295.1|1860123_1860486_-	chorismate mutase	NA	NA	NA	NA	NA
AVD56296.1|1860482_1861565_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
AVD56297.1|1861565_1862735_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	38.0	4.6e-47
AVD56298.1|1862817_1863606_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
AVD56299.1|1863709_1864156_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	42.7	1.7e-26
AVD56300.1|1864307_1865270_-	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	23.0	6.1e-05
AVD56301.1|1865288_1865993_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
AVD56302.1|1865995_1866805_-	heptaprenyl diphosphate synthase	NA	NA	NA	NA	NA
AVD56303.1|1866901_1867132_-	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
AVD56304.1|1867175_1867379_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56305.1|1867385_1867658_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	77.8	2.0e-30
AVD56306.1|1867947_1869426_-	stage IV sporulation protein A	NA	NA	NA	NA	NA
AVD56307.1|1869669_1870389_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56308.1|1870407_1870614_-	DUF2768 domain-containing protein	NA	NA	NA	NA	NA
AVD56309.1|1870853_1871894_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AVD56310.1|1871914_1873225_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AVD56311.1|1873313_1873910_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56312.1|1874010_1874139_+	YpzI family protein	NA	NA	NA	NA	NA
AVD56313.1|1874233_1875370_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AVD56314.1|1875482_1876187_-	(d)CMP kinase	NA	NA	NA	NA	NA
AVD56315.1|1876308_1876953_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
AVD56316.1|1877074_1878424_-	germination protein YpeB	NA	NA	NA	NA	NA
AVD56317.1|1878439_1879234_-	spore cortex-lytic enzyme	NA	A0A0E3XAL9	Bacillus_phage	46.8	8.3e-24
AVD56318.1|1879345_1880026_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVD57848.1|1880133_1881117_-	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
AVD56319.1|1881274_1882552_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
AVD56320.1|1882649_1883195_-	NDP-hexose 2,3-dehydratase	NA	NA	NA	NA	NA
AVD56321.1|1883254_1884034_-	metallophosphoesterase	NA	NA	NA	NA	NA
AVD56322.1|1884210_1884438_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
AVD56323.1|1884434_1884695_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
AVD56324.1|1884718_1885288_+|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
AVD56325.1|1885352_1885799_-	DUF2663 domain-containing protein	NA	NA	NA	NA	NA
AVD56326.1|1885926_1886166_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56327.1|1886190_1886769_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 6
CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	2138600	2198257	3602752	tRNA,transposase,protease,coat	Moraxella_phage(25.0%)	60	NA	NA
AVD56582.1|2138600_2139629_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AVD56583.1|2139664_2139871_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
AVD56584.1|2139867_2140866_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.6	2.1e-08
AVD56585.1|2140882_2141485_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AVD56586.1|2141501_2141681_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56587.1|2141765_2141981_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56588.1|2141983_2142703_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AVD56589.1|2142815_2143784_-	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
AVD56590.1|2143783_2145055_-|coat	spore coat protein	coat	S6BFI4	Thermus_phage	55.6	6.2e-05
AVD56591.1|2145241_2145799_+	transcription repressor NadR	NA	NA	NA	NA	NA
AVD56592.1|2145925_2146771_-	prephenate dehydratase	NA	NA	NA	NA	NA
AVD56593.1|2146796_2147249_-	ACT domain-containing protein	NA	NA	NA	NA	NA
AVD56594.1|2147297_2148590_-	GTPase ObgE	NA	NA	NA	NA	NA
AVD56595.1|2148624_2149161_-	sporulation protein	NA	NA	NA	NA	NA
AVD57859.1|2149366_2149660_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
AVD56596.1|2149669_2149999_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
AVD56597.1|2150011_2150320_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AVD56598.1|2150462_2151941_-	ribonuclease E/G	NA	NA	NA	NA	NA
AVD56599.1|2151992_2152859_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
AVD56600.1|2152851_2153604_-	M23 family peptidase	NA	NA	NA	NA	NA
AVD56601.1|2153730_2154540_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
AVD56602.1|2154532_2155225_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
AVD56603.1|2155449_2155968_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AVD56604.1|2155967_2156834_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AVD56605.1|2156940_2157957_-	rod shape-determining protein	NA	NA	NA	NA	NA
AVD56606.1|2158130_2158814_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56607.1|2158798_2158993_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56608.1|2159225_2160449_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	46.2	1.1e-78
AVD56609.1|2160791_2161775_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56610.1|2161893_2162655_-	prepilin peptidase	NA	NA	NA	NA	NA
AVD56611.1|2162760_2163465_-	pilus assembly protein PilO	NA	NA	NA	NA	NA
AVD56612.1|2163461_2164340_-	fimbrial protein	NA	NA	NA	NA	NA
AVD56613.1|2164340_2165339_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
AVD56614.1|2165441_2165876_-	pilus assembly protein	NA	NA	NA	NA	NA
AVD56615.1|2165958_2167164_-	type II secretion system F family protein	NA	NA	NA	NA	NA
AVD56616.1|2167150_2168203_-	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AVD56617.1|2168212_2169874_-	type II secretion system protein GspE	NA	NA	NA	NA	NA
AVD56618.1|2169919_2171374_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56619.1|2171390_2172119_-	photosystem reaction center subunit H	NA	NA	NA	NA	NA
AVD56620.1|2172145_2173918_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57860.1|2174045_2175707_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56621.1|2175706_2176216_-	pilin	NA	NA	NA	NA	NA
AVD56622.1|2176212_2176632_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AVD56623.1|2176750_2178073_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AVD56624.1|2178135_2180781_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	43.7	3.4e-162
AVD56625.1|2181207_2181399_+	hypothetical protein	NA	NA	NA	NA	NA
AVD56626.1|2181415_2182600_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
AVD56627.1|2182630_2184448_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
AVD56628.1|2184833_2186123_-	glutamate-1-semialdehyde-2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	27.6	4.4e-06
AVD56629.1|2186138_2187116_-	porphobilinogen synthase	NA	NA	NA	NA	NA
AVD56630.1|2187148_2187367_+	hypothetical protein	NA	NA	NA	NA	NA
AVD56631.1|2187352_2188141_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AVD56632.1|2188137_2189070_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AVD56633.1|2189082_2189907_-	cytochrome C assembly protein	NA	NA	NA	NA	NA
AVD56634.1|2189922_2191254_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
AVD56635.1|2191439_2191934_+	hypothetical protein	NA	NA	NA	NA	NA
AVD56636.1|2192110_2192695_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
AVD56637.1|2192691_2195016_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.5	4.8e-181
AVD56638.1|2195059_2196697_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	36.4	2.9e-15
AVD56639.1|2196988_2198257_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	67.4	5.4e-150
>prophage 7
CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	2400737	2472934	3602752	transposase,bacteriocin	Staphylococcus_phage(23.08%)	58	NA	NA
AVD56817.1|2400737_2402153_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AVD56818.1|2404141_2404912_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.4	1.3e-37
AVD56819.1|2404898_2405705_+	ABC transporter permease	NA	NA	NA	NA	NA
AVD56820.1|2406236_2406701_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	37.7	4.4e-25
AVD56821.1|2406869_2407118_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
AVD56822.1|2407190_2407640_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	52.4	1.5e-38
AVD56823.1|2407756_2407993_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	63.8	1.1e-19
AVD56824.1|2408084_2408213_+	DUF4021 domain-containing protein	NA	NA	NA	NA	NA
AVD56825.1|2408332_2409223_+	adhesin	NA	NA	NA	NA	NA
AVD56826.1|2409285_2409444_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
AVD56827.1|2409814_2410918_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
AVD56828.1|2412945_2413764_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
AVD56829.1|2413804_2414608_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
AVD56830.1|2414604_2416350_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
AVD57866.1|2416351_2417686_-	isochorismate synthase	NA	NA	NA	NA	NA
AVD56831.1|2417951_2418875_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AVD56832.1|2426759_2426945_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56833.1|2427234_2428398_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AVD56834.1|2428725_2429376_-|bacteriocin	bacteriocin ABC transporter ATP-binding protein	bacteriocin	G9BWD6	Planktothrix_phage	30.7	1.6e-20
AVD56835.1|2429377_2431567_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56836.1|2431864_2432044_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56837.1|2432046_2432292_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56838.1|2432344_2433250_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AVD56839.1|2433340_2434030_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	35.7	3.0e-14
AVD56840.1|2434165_2435290_-	DUF1646 domain-containing protein	NA	NA	NA	NA	NA
AVD56841.1|2435799_2436186_-	MFS transporter	NA	NA	NA	NA	NA
AVD56842.1|2436489_2438901_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.0	4.8e-115
AVD56843.1|2438994_2439201_-	copper resistance protein CopZ	NA	NA	NA	NA	NA
AVD56844.1|2439215_2439560_-	CsoR family transcriptional regulator	NA	NA	NA	NA	NA
AVD56845.1|2439839_2441255_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AVD56846.1|2442048_2442495_+	XRE family transcriptional regulator	NA	A0A0A7RUJ5	Clostridium_phage	51.8	3.4e-06
AVD56847.1|2442770_2444075_+|transposase	IS1380-like element ISBco2 family transposase	transposase	NA	NA	NA	NA
AVD56848.1|2444229_2444502_+	cytosolic protein	NA	NA	NA	NA	NA
AVD56849.1|2444602_2445013_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AVD56850.1|2445119_2445539_+	alkylhydroperoxidase	NA	NA	NA	NA	NA
AVD56851.1|2445566_2445749_+	hypothetical protein	NA	NA	NA	NA	NA
AVD56852.1|2445819_2447007_+	amidohydrolase	NA	NA	NA	NA	NA
AVD56853.1|2447067_2447262_+	DUF3311 domain-containing protein	NA	NA	NA	NA	NA
AVD56854.1|2447258_2448728_+	sodium:solute symporter	NA	NA	NA	NA	NA
AVD56855.1|2449399_2449618_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56856.1|2449834_2450272_+	hypothetical protein	NA	NA	NA	NA	NA
AVD56857.1|2450302_2451700_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.8	9.8e-36
AVD56858.1|2451674_2452349_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	3.8e-38
AVD56859.1|2452420_2452975_-	DUF1541 domain-containing protein	NA	NA	NA	NA	NA
AVD56860.1|2453155_2453767_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVD56861.1|2453780_2454434_-	hypothetical protein	NA	NA	NA	NA	NA
AVD56862.1|2454430_2455366_-	polysaccharide deacetylase	NA	A0A1V0SLN0	Klosneuvirus	25.7	3.7e-07
AVD56863.1|2458943_2459240_-	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	39.6	4.2e-13
AVD56864.1|2459321_2459582_-	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
AVD56865.1|2460163_2460952_+	endonuclease	NA	A0A1P8CWK6	Bacillus_phage	65.2	1.4e-60
AVD56866.1|2461054_2461564_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
AVD56867.1|2461921_2463337_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AVD56868.1|2463792_2465394_-	ATPase	NA	NA	NA	NA	NA
AVD56869.1|2465411_2466818_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
AVD56870.1|2467302_2468001_+	L-ribulose-5-phosphate 4-epimerase AraD	NA	NA	NA	NA	NA
AVD57867.1|2468032_2469457_+	L-arabinose isomerase	NA	NA	NA	NA	NA
AVD56871.1|2469629_2470769_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVD56872.1|2471623_2472934_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	2642917	2695497	3602752	tRNA,transposase,bacteriocin	Planktothrix_phage(20.0%)	46	NA	NA
AVD57015.1|2642917_2644141_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	46.5	3.7e-79
AVD57016.1|2644507_2646403_-	protein prkA	NA	A0MN77	Thermus_phage	37.3	1.1e-103
AVD57017.1|2646578_2646764_+	hypothetical protein	NA	NA	NA	NA	NA
AVD57018.1|2646802_2647039_+	hypothetical protein	NA	NA	NA	NA	NA
AVD57019.1|2647056_2647530_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
AVD57020.1|2647565_2648447_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57021.1|2648766_2649897_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AVD57022.1|2650272_2650896_+	hypothetical protein	NA	NA	NA	NA	NA
AVD57023.1|2650966_2651248_+	hypothetical protein	NA	NA	NA	NA	NA
AVD57024.1|2651224_2652154_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
AVD57025.1|2652326_2652791_+	rubrerythrin family protein	NA	NA	NA	NA	NA
AVD57026.1|2652799_2653657_-	proline iminopeptidase	NA	A0A2K9KZN8	Tupanvirus	30.9	1.9e-05
AVD57027.1|2653807_2654605_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVD57028.1|2654591_2655284_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVD57029.1|2655296_2656034_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.6	1.7e-31
AVD57030.1|2656096_2656933_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
AVD57031.1|2657292_2658453_-	L-threonine dehydrogenase	NA	NA	NA	NA	NA
AVD57032.1|2658831_2661096_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.2	6.6e-183
AVD57033.1|2661185_2661923_+	pyruvate formate lyase-activating protein	NA	NA	NA	NA	NA
AVD57034.1|2662183_2662741_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
AVD57035.1|2662759_2663293_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57036.1|2663411_2664392_-	ABC transporter permease	NA	NA	NA	NA	NA
AVD57037.1|2664388_2665300_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.4	7.5e-37
AVD57038.1|2665296_2666100_-	GDSL family lipase	NA	NA	NA	NA	NA
AVD57039.1|2666534_2666765_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57040.1|2667027_2668713_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AVD57041.1|2669354_2670335_+	hypothetical protein	NA	NA	NA	NA	NA
AVD57042.1|2670741_2671779_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57043.1|2672210_2672909_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.0	3.1e-30
AVD57044.1|2674445_2675078_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57045.1|2675370_2675898_+	folate family ECF transporter S component	NA	NA	NA	NA	NA
AVD57046.1|2677760_2678483_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVD57047.1|2678615_2680127_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	40.2	1.2e-76
AVD57874.1|2680152_2681280_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AVD57048.1|2681652_2681844_+	hypothetical protein	NA	NA	NA	NA	NA
AVD57049.1|2681833_2682439_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.3	1.5e-09
AVD57050.1|2682454_2683975_-|transposase	IS5-like element ISBco3 family transposase	transposase	NA	NA	NA	NA
AVD57051.1|2684247_2684904_+	hypothetical protein	NA	NA	NA	NA	NA
AVD57052.1|2686710_2687175_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVD57053.1|2687320_2688754_+|transposase	transposase	transposase	NA	NA	NA	NA
AVD57054.1|2689130_2689946_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
AVD57875.1|2689954_2690437_-	DUF2243 domain-containing protein	NA	NA	NA	NA	NA
AVD57055.1|2690790_2691429_-|bacteriocin	bacteriocin ABC transporter ATP-binding protein	bacteriocin	G9BWD6	Planktothrix_phage	38.1	1.8e-24
AVD57056.1|2691435_2693682_-	DUF1430 domain-containing protein	NA	NA	NA	NA	NA
AVD57057.1|2693790_2693925_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57058.1|2694186_2695497_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	2957254	3110455	3602752	transposase,integrase	Streptococcus_phage(17.24%)	112	3043523:3043541	3110142:3110160
AVD57257.1|2957254_2958478_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	46.2	1.1e-78
AVD57258.1|2958926_2959112_-	type Z 30S ribosomal protein S14	NA	NA	NA	NA	NA
AVD57259.1|2959402_2959633_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57260.1|2959951_2960515_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AVD57261.1|2960685_2961144_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57262.1|2961246_2961693_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVD57263.1|2961841_2963359_-	carboxylase	NA	NA	NA	NA	NA
AVD57264.1|2963363_2964143_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AVD57265.1|2964349_2964727_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57266.1|2964737_2965646_-	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	36.3	3.5e-34
AVD57267.1|2965672_2965882_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
AVD57268.1|2966176_2967532_-	biotin carboxylase	NA	NA	NA	NA	NA
AVD57269.1|2967753_2968896_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVD57270.1|2969146_2971102_-	acetyl-coenzyme A synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	39.4	9.7e-82
AVD57271.1|2971757_2973308_-	AMP-dependent synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	28.5	8.3e-28
AVD57272.1|2973844_2975212_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AVD57273.1|2975930_2977142_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.3	2.0e-29
AVD57274.1|2977304_2978651_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AVD57890.1|2978746_2980210_-	restriction endonuclease	NA	NA	NA	NA	NA
AVD57275.1|2980227_2981658_-	SAM-dependent methyltransferase	NA	A0A220A2U4	Liberibacter_phage	23.4	1.0e-27
AVD57276.1|2981795_2981975_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57277.1|2982152_2985359_-	type I restriction-modification system endonuclease	NA	Q5YA94	Bacillus_phage	26.7	3.2e-05
AVD57278.1|2985408_2985645_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57279.1|2985940_2987422_+	gamma-aminobutyrate permease	NA	NA	NA	NA	NA
AVD57280.1|2988601_2989255_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVD57281.1|2989268_2990492_-	ABC transporter	NA	NA	NA	NA	NA
AVD57891.1|2990488_2990593_-	histidine kinase	NA	NA	NA	NA	NA
AVD57282.1|2990791_2991517_-	glycosyl transferase family 2	NA	A0A2H4PQG7	Staphylococcus_phage	36.0	2.3e-28
AVD57283.1|2991744_2992161_+	hypothetical protein	NA	NA	NA	NA	NA
AVD57284.1|2992173_2992476_+	hypothetical protein	NA	NA	NA	NA	NA
AVD57285.1|2992493_2992763_+	hypothetical protein	NA	NA	NA	NA	NA
AVD57286.1|2998851_2999745_+	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.0	2.4e-11
AVD57287.1|3000539_3001847_-|transposase	IS1182-like element ISBco4 family transposase	transposase	NA	NA	NA	NA
AVD57288.1|3001966_3003382_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AVD57289.1|3003891_3005385_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	42.3	6.9e-104
AVD57290.1|3005493_3006285_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	42.2	3.1e-39
AVD57892.1|3006304_3007084_-	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	33.1	8.1e-32
AVD57291.1|3007182_3008457_-	imidazolonepropionase	NA	NA	NA	NA	NA
AVD57893.1|3008475_3010440_-	urocanate hydratase	NA	NA	NA	NA	NA
AVD57292.1|3010524_3011538_-	aliphatic sulfonate ABC transporter substrate-binding protein	NA	G3M9Z0	Bacillus_virus	27.1	5.4e-20
AVD57293.1|3011570_3012539_-	C-terminal binding protein	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	26.5	1.5e-14
AVD57294.1|3012570_3012978_-	DUF126 domain-containing protein	NA	NA	NA	NA	NA
AVD57295.1|3012977_3014180_-	DUF521 domain-containing protein	NA	NA	NA	NA	NA
AVD57296.1|3014195_3015548_-	S-adenosylhomocysteine deaminase	NA	NA	NA	NA	NA
AVD57297.1|3016846_3017758_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AVD57298.1|3019194_3020139_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
AVD57299.1|3020680_3021991_+|transposase	transposase	transposase	NA	NA	NA	NA
AVD57300.1|3022337_3024023_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AVD57301.1|3025309_3026380_-	5-methylcytosine-specific restriction endonuclease system specificity protein McrC	NA	NA	NA	NA	NA
AVD57302.1|3026366_3028781_-	restriction endonuclease	NA	K4I1H4	Acidithiobacillus_phage	27.6	2.4e-18
AVD57303.1|3028828_3031912_-	deoxyribonuclease HsdR	NA	A0A220A398	Liberibacter_phage	23.3	1.0e-24
AVD57304.1|3031927_3033187_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AVD57305.1|3033186_3035751_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	45.4	2.9e-110
AVD57306.1|3036075_3036378_-	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
AVD57307.1|3036693_3036891_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57308.1|3037043_3037688_-	lysine transporter LysE	NA	NA	NA	NA	NA
AVD57309.1|3038072_3038546_+	glutathione peroxidase	NA	NA	NA	NA	NA
AVD57310.1|3038713_3039202_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
AVD57894.1|3039754_3040546_-	maltose-6'-phosphate glucosidase	NA	NA	NA	NA	NA
AVD57311.1|3040722_3042138_+|transposase	ISLre2-like element ISBco6 family transposase	transposase	NA	NA	NA	NA
AVD57312.1|3042525_3043830_+|transposase	IS1380-like element ISBco2 family transposase	transposase	NA	NA	NA	NA
3043523:3043541	attL	TGGAAAACTATATCAAAGA	NA	NA	NA	NA
AVD57313.1|3044052_3045042_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
AVD57314.1|3045624_3047088_-|transposase	transposase	transposase	NA	NA	NA	NA
AVD57315.1|3047987_3049244_-	glutamate:protein symporter	NA	NA	NA	NA	NA
AVD57316.1|3050399_3050963_-	YqcI/YcgG family protein	NA	NA	NA	NA	NA
AVD57317.1|3051288_3051864_-|integrase	site-specific integrase	integrase	A0A1B0T6D2	Bacillus_phage	39.3	2.9e-26
AVD57318.1|3052052_3054188_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	84.7	0.0e+00
AVD57319.1|3054180_3054549_-	transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	77.0	2.6e-49
AVD57320.1|3056045_3057509_-|transposase	transposase	transposase	NA	NA	NA	NA
AVD57895.1|3058072_3058969_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVD57321.1|3059608_3060085_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0A8WJI9	Clostridium_phage	50.3	1.3e-37
AVD57322.1|3060081_3061953_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A2R2ZH54	Clostridioides_phage	45.7	1.4e-157
AVD57323.1|3062675_3063755_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57324.1|3063892_3064942_-	butanediol dehydrogenase	NA	NA	NA	NA	NA
AVD57325.1|3065390_3066416_+	hypothetical protein	NA	NA	NA	NA	NA
AVD57326.1|3066655_3067801_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.2	9.4e-45
AVD57327.1|3067813_3069109_-	gluconate:proton symporter	NA	NA	NA	NA	NA
AVD57328.1|3069966_3070887_-	ribose ABC transporter substrate-binding protein RbsB	NA	NA	NA	NA	NA
AVD57329.1|3070902_3071847_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
AVD57330.1|3071830_3073330_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	1.1e-11
AVD57331.1|3073376_3073772_-	D-ribose pyranase	NA	NA	NA	NA	NA
AVD57332.1|3073768_3074650_-	ribokinase	NA	NA	NA	NA	NA
AVD57333.1|3074652_3075630_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AVD57334.1|3076638_3077532_-|transposase	transposase	transposase	NA	NA	NA	NA
AVD57335.1|3077748_3078237_-	general stress protein	NA	NA	NA	NA	NA
AVD57336.1|3078435_3078699_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57337.1|3078700_3079654_-|transposase	transposase	transposase	NA	NA	NA	NA
AVD57338.1|3080033_3080648_-	DUF1775 domain-containing protein	NA	NA	NA	NA	NA
AVD57339.1|3080816_3082463_-	copper resistance protein CopC	NA	NA	NA	NA	NA
AVD57340.1|3082874_3083798_-	ribokinase	NA	NA	NA	NA	NA
AVD57341.1|3083851_3084571_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AVD57342.1|3084775_3085771_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	33.3	3.3e-30
AVD57896.1|3086270_3087722_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
AVD57343.1|3087970_3088300_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AVD57344.1|3088754_3090185_-	sensor histidine kinase	NA	NA	NA	NA	NA
AVD57345.1|3090208_3091408_-	beta-ketoacyl synthase	NA	NA	NA	NA	NA
AVD57346.1|3091743_3091944_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.7	9.0e-20
AVD57347.1|3092126_3093542_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVD57348.1|3093781_3094615_+	EamA family transporter	NA	NA	NA	NA	NA
AVD57349.1|3094733_3095993_+	MFS transporter	NA	NA	NA	NA	NA
AVD57350.1|3096194_3096497_+	hypothetical protein	NA	NA	NA	NA	NA
AVD57351.1|3096479_3097418_-	EamA-like transporter family protein	NA	NA	NA	NA	NA
AVD57352.1|3098037_3099798_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
AVD57353.1|3099813_3101469_+	serine hydrolase	NA	NA	NA	NA	NA
AVD57354.1|3101483_3102746_+	DUF1343 domain-containing protein	NA	NA	NA	NA	NA
AVD57355.1|3102973_3103336_+	hypothetical protein	NA	NA	NA	NA	NA
AVD57356.1|3103325_3103739_+	hypothetical protein	NA	NA	NA	NA	NA
AVD57357.1|3103791_3105654_-	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.1	3.2e-66
AVD57358.1|3105628_3107383_-	ABC transporter	NA	W8CYL7	Bacillus_phage	31.1	7.9e-51
AVD57359.1|3107424_3107883_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVD57360.1|3108271_3108850_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AVD57361.1|3109141_3110455_+|transposase	IS1380-like element ISBco1 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	48.8	7.1e-113
3110142:3110160	attR	TGGAAAACTATATCAAAGA	NA	NA	NA	NA
>prophage 10
CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	3166784	3208992	3602752	transposase	Catovirus(25.0%)	31	NA	NA
AVD57408.1|3166784_3168470_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AVD57409.1|3168618_3169239_+	bifunctional 2-keto-4-hydroxyglutarate aldolase/2-keto-3-deoxy-6-phosphogluconate aldolase	NA	NA	NA	NA	NA
AVD57410.1|3169509_3170073_-	ECF transporter S component	NA	NA	NA	NA	NA
AVD57411.1|3170084_3170840_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
AVD57412.1|3170846_3172355_-	terpene cyclase	NA	NA	NA	NA	NA
AVD57413.1|3172805_3174116_+|transposase	transposase	transposase	NA	NA	NA	NA
AVD57414.1|3174436_3176314_+	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	34.9	8.6e-96
AVD57415.1|3176879_3177290_-	TIGR01741 family protein	NA	NA	NA	NA	NA
AVD57416.1|3177781_3178831_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	27.8	1.5e-25
AVD57417.1|3179159_3179765_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVD57418.1|3179806_3180928_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AVD57419.1|3181846_3182869_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	23.9	4.8e-24
AVD57420.1|3184760_3184970_+	hypothetical protein	NA	NA	NA	NA	NA
AVD57421.1|3188425_3189199_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AVD57422.1|3189720_3190551_+	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
AVD57423.1|3190821_3191526_-	DUF2961 domain-containing protein	NA	NA	NA	NA	NA
AVD57424.1|3191608_3193294_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AVD57899.1|3193405_3193804_-	DUF2961 domain-containing protein	NA	NA	NA	NA	NA
AVD57425.1|3193941_3195546_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57426.1|3195526_3196201_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57427.1|3196223_3197045_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AVD57428.1|3197041_3197842_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AVD57429.1|3197854_3198346_-	PTS mannose/fructose/sorbose transporter subunit IIB	NA	NA	NA	NA	NA
AVD57430.1|3198357_3198798_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
AVD57431.1|3201742_3203104_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AVD57432.1|3203264_3203489_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57433.1|3203744_3203948_+	hypothetical protein	NA	NA	NA	NA	NA
AVD57434.1|3203962_3204499_+	cysteine hydrolase	NA	NA	NA	NA	NA
AVD57435.1|3204683_3205190_+	RNA-binding protein	NA	NA	NA	NA	NA
AVD57436.1|3205411_3206434_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57437.1|3207768_3208992_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	46.5	3.7e-79
>prophage 11
CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	3236915	3245230	3602752		Synechococcus_phage(33.33%)	8	NA	NA
AVD57457.1|3236915_3237509_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.3	6.4e-29
AVD57458.1|3237501_3238545_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.6	2.9e-61
AVD57459.1|3238564_3239989_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.7	6.0e-49
AVD57460.1|3239973_3242223_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	44.2	2.7e-168
AVD57461.1|3242206_3242890_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AVD57462.1|3242886_3243141_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AVD57463.1|3243133_3243844_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SS43	Cyanophage	42.8	7.4e-48
AVD57464.1|3243934_3245230_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.5	6.5e-18
>prophage 12
CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	3428015	3490215	3602752	tRNA,transposase,protease,bacteriocin	Bacillus_phage(20.0%)	49	NA	NA
AVD57629.1|3428015_3429326_-|transposase	transposase	transposase	NA	NA	NA	NA
AVD57630.1|3429553_3430834_-	transcription termination factor Rho	NA	NA	NA	NA	NA
AVD57631.1|3431270_3432236_-	fructose-bisphosphatase class II	NA	NA	NA	NA	NA
AVD57632.1|3432345_3433632_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AVD57633.1|3433811_3434459_-	fructose-6-phosphate aldolase	NA	A0A1D7SX77	Cyanophage	52.6	4.1e-53
AVD57634.1|3434759_3435617_-	fructose-1,6-bisphosphate aldolase, class II	NA	NA	NA	NA	NA
AVD57635.1|3435828_3436194_-	response regulator	NA	W8CYM9	Bacillus_phage	37.1	3.9e-13
AVD57636.1|3436388_3437534_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57637.1|3437546_3438380_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57638.1|3438376_3439066_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	24.2	4.2e-08
AVD57639.1|3439058_3439463_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVD57640.1|3439733_3441335_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.4	1.0e-150
AVD57641.1|3441565_3442150_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
AVD57642.1|3442265_3442472_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57643.1|3442903_3444319_-|transposase	ISLre2-like element ISBco6 family transposase	transposase	NA	NA	NA	NA
AVD57644.1|3444993_3445674_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	8.1e-28
AVD57645.1|3449621_3451307_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AVD57646.1|3452304_3455559_-	methylmalonyl-CoA mutase	NA	NA	NA	NA	NA
AVD57647.1|3455644_3456280_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVD57648.1|3456299_3457442_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVD57649.1|3457475_3458612_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVD57650.1|3458653_3459832_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
AVD57651.1|3460559_3462704_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
AVD57652.1|3462915_3464115_+	cardiolipin synthase	NA	NA	NA	NA	NA
AVD57653.1|3464393_3466064_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
AVD57654.1|3466060_3466501_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
AVD57655.1|3466656_3467529_-	agmatinase	NA	NA	NA	NA	NA
AVD57907.1|3467709_3469761_+	penicillin-binding protein	NA	NA	NA	NA	NA
AVD57656.1|3469863_3470376_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57657.1|3470406_3471069_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AVD57908.1|3471184_3471400_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AVD57658.1|3471414_3471933_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57659.1|3471950_3473267_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.7	6.6e-26
AVD57660.1|3473695_3474406_+	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	50.0	4.1e-06
AVD57661.1|3477719_3478691_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AVD57662.1|3478860_3479616_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
AVD57663.1|3480264_3480636_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
AVD57664.1|3480807_3481065_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57665.1|3481515_3482202_-	uracil-DNA glycosylase	NA	S4VZ65	Pandoravirus	45.5	5.8e-50
AVD57666.1|3482349_3482697_+	general stress protein	NA	NA	NA	NA	NA
AVD57667.1|3482821_3483094_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVD57668.1|3483573_3483801_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
AVD57669.1|3483875_3485501_+	hypothetical protein	NA	NA	NA	NA	NA
AVD57670.1|3485546_3486065_+	stage II sporulation protein M	NA	NA	NA	NA	NA
AVD57671.1|3486061_3486748_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.8	3.3e-13
AVD57672.1|3486984_3487224_-	hypothetical protein	NA	NA	NA	NA	NA
AVD57673.1|3487303_3487948_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
AVD57909.1|3487953_3488715_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	3.6e-16
AVD57674.1|3488694_3490215_+|transposase	IS5-like element ISBco3 family transposase	transposase	NA	NA	NA	NA
>prophage 13
CP026649	Bacillus coagulans strain R11 chromosome, complete genome	3602752	3583408	3591471	3602752	protease	Staphylococcus_phage(66.67%)	10	NA	NA
AVD57751.1|3583408_3583903_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	67.7	2.8e-54
AVD57752.1|3583964_3584252_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
AVD57753.1|3584505_3584976_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	55.9	2.2e-40
AVD57754.1|3584988_3586182_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.1	7.1e-112
AVD57755.1|3586199_3586847_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.8	8.8e-40
AVD57913.1|3586827_3588048_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.0	2.4e-54
AVD57756.1|3588270_3589371_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
AVD57757.1|3589531_3589732_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
AVD57758.1|3589721_3590633_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AVD57759.1|3590847_3591471_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	38.5	3.6e-22
