The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	0	16733	4784656	tRNA	Mycobacterium_phage(20.0%)	15	NA	NA
AVD76186.1|609_2250_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
AVD76187.1|2274_2817_-	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
AVD80472.1|3011_3785_+	alpha/beta hydrolase	NA	A0A1J0GNR5	Mycobacterium_phage	33.0	6.4e-05
AVD76188.1|3913_4201_+	LexA regulated protein	NA	NA	NA	NA	NA
AVD76189.1|4311_4887_+	flavodoxin FldA	NA	NA	NA	NA	NA
AVD76190.1|5097_5184_+	ryhB-regulated fur leader peptide	NA	NA	NA	NA	NA
AVD76191.1|5176_5623_+	transcriptional repressor	NA	NA	NA	NA	NA
AVD76192.1|5750_6677_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVD76193.1|6774_8178_+	tricarballylate dehydrogenase	NA	A0A2P0ZL82	Lactobacillus_phage	26.1	1.3e-08
AVD76194.1|8164_9304_+	tricarballylate utilization protein TcuB	NA	NA	NA	NA	NA
AVD76195.1|9357_10653_+	citrate-proton symporter	NA	Q6JIH2	Burkholderia_virus	34.9	6.9e-60
AVD76196.1|10703_11036_-	hypothetical protein	NA	NA	NA	NA	NA
AVD76197.1|11085_12492_-	chitoporin	NA	NA	NA	NA	NA
AVD76198.1|12928_14596_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	94.6	0.0e+00
AVD76199.1|14783_16733_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	1.4e-08
>prophage 2
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	21485	23150	4784656		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVD76205.1|21485_23150_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	4.7e-85
>prophage 3
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	27120	28206	4784656		Pseudomonas_phage(100.0%)	1	NA	NA
AVD76208.1|27120_28206_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	3.3e-47
>prophage 4
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	34136	39321	4784656	tRNA	Planktothrix_phage(50.0%)	4	NA	NA
AVD76215.1|34136_34862_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	1.1e-30
AVD76216.1|34978_35914_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
AVD76217.1|36020_36503_-	hypothetical protein	NA	NA	NA	NA	NA
AVD76218.1|36738_39321_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.6	9.5e-186
>prophage 5
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	47486	49951	4784656		Synechococcus_phage(50.0%)	2	NA	NA
AVD76226.1|47486_48596_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	8.1e-09
AVD76227.1|48739_49951_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.9	9.8e-101
>prophage 6
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	53558	54233	4784656		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVD76233.1|53558_53942_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.6	3.4e-23
AVD76234.1|53993_54233_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	71.4	1.8e-22
>prophage 7
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	68038	76168	4784656		Escherichia_phage(50.0%)	8	NA	NA
AVD76247.1|68038_68869_-	alpha/beta hydrolase	NA	W8EHU1	Mycobacterium_phage	31.2	6.0e-17
AVD76248.1|69144_69555_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
AVD76249.1|69738_70167_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	1.1e-17
AVD76250.1|70236_71004_-	hydrogenase	NA	NA	NA	NA	NA
AVD76251.1|71003_71561_-	DMSO reductase	NA	A0A077SL61	Escherichia_phage	37.7	6.2e-26
AVD76252.1|71557_73828_-	DMSO reductase	NA	A0A077SK27	Escherichia_phage	25.0	2.6e-46
AVD76253.1|73824_74379_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	29.0	7.6e-08
AVD76254.1|74602_76168_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	1.1e-43
>prophage 8
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	79278	81104	4784656		Streptococcus_phage(50.0%)	2	NA	NA
AVD76258.1|79278_80502_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.1	1.7e-60
AVD76259.1|80486_81104_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	50.8	3.9e-53
>prophage 9
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	86462	90800	4784656		Escherichia_phage(100.0%)	1	NA	NA
AVD76264.1|86462_90800_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	27.1	2.7e-31
>prophage 10
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	98249	106330	4784656		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
AVD76271.1|98249_99257_+	iron-enterobactin transporter	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.7	6.4e-13
AVD80477.1|99256_100246_+	iron-enterobactin transporter permease	NA	NA	NA	NA	NA
AVD76272.1|100242_101040_+	iron-enterobactin transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.5	2.4e-07
AVD76273.1|101086_102220_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
AVD76274.1|102439_106330_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	30.1	5.3e-63
>prophage 11
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	117674	119219	4784656		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AVD76286.1|117674_119219_+	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.3	5.2e-14
>prophage 12
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	129019	130000	4784656		Enterobacteria_phage(100.0%)	1	NA	NA
AVD76298.1|129019_130000_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.2	2.4e-25
>prophage 13
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	139186	148531	4784656		Escherichia_phage(100.0%)	1	NA	NA
AVD76306.1|139186_148531_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	24.4	2.7e-12
>prophage 14
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	152387	158001	4784656		Erysipelothrix_phage(50.0%)	3	NA	NA
AVD76312.1|152387_153713_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.3	2.9e-106
AVD76313.1|153950_154805_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVD76314.1|154857_158001_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.1	1.2e-57
>prophage 15
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	161339	163464	4784656		Bacillus_phage(50.0%)	2	NA	NA
AVD76318.1|161339_162023_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	1.0e-30
AVD76319.1|162012_163464_+	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.8	1.9e-10
>prophage 16
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	169834	179314	4784656		Morganella_phage(25.0%)	7	NA	NA
AVD76325.1|169834_170263_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	50.0	4.3e-27
AVD76326.1|170318_170933_-	molecular chaperone TorD	NA	NA	NA	NA	NA
AVD76327.1|170929_173470_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.2	2.8e-73
AVD76328.1|173459_174638_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
AVD76329.1|174769_175462_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	29.3	5.7e-21
AVD76330.1|175434_176466_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
AVD76331.1|176548_179314_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.6	3.1e-33
>prophage 17
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	189297	192491	4784656	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
AVD76342.1|189297_190164_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	9.4e-29
AVD76343.1|190165_190378_+	ribosome-associated protein	NA	NA	NA	NA	NA
AVD76344.1|190503_191028_+	hypothetical protein	NA	NA	NA	NA	NA
AVD76345.1|191105_192491_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	1.6e-46
>prophage 18
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	197530	198547	4784656		Planktothrix_phage(100.0%)	1	NA	NA
AVD76353.1|197530_198547_-	virulence-associated ABC transporter ATP-binding protein SfbB	NA	G9BWD6	Planktothrix_phage	38.6	3.9e-34
>prophage 19
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	203433	204120	4784656		Planktothrix_phage(100.0%)	1	NA	NA
AVD76357.1|203433_204120_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	1.0e-30
>prophage 20
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	207423	208101	4784656		Bacillus_virus(100.0%)	1	NA	NA
AVD76361.1|207423_208101_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	35.7	6.2e-28
>prophage 21
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	219652	223072	4784656		Pithovirus(50.0%)	2	NA	NA
AVD76372.1|219652_220423_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.9	6.8e-15
AVD76373.1|220570_223072_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.3	3.8e-115
>prophage 22
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	231337	239963	4784656		Acanthamoeba_polyphaga_mimivirus(25.0%)	9	NA	NA
AVD76381.1|231337_232297_+	acetyl esterase	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	28.3	5.9e-16
AVD76382.1|232293_233256_-	ferrochelatase	NA	NA	NA	NA	NA
AVD76383.1|233419_234064_-	adenylate kinase	NA	NA	NA	NA	NA
AVD76384.1|234295_236170_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.5	7.0e-114
AVD76385.1|236280_236886_-	recombination protein RecR	NA	NA	NA	NA	NA
AVD76386.1|236885_237215_-	nucleoid-associated protein, YbaB/EbfC family	NA	NA	NA	NA	NA
AVD76387.1|237272_239201_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	41.9	1.3e-43
AVD76388.1|239231_239387_-	L-asparaginase	NA	NA	NA	NA	NA
AVD76389.1|239411_239963_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.6	7.0e-30
>prophage 23
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	247847	250997	4784656		Leptospira_phage(100.0%)	1	NA	NA
AVD76396.1|247847_250997_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.5	1.8e-53
>prophage 24
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	263187	266731	4784656		Bacillus_phage(100.0%)	2	NA	NA
AVD76415.1|263187_264966_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	6.4e-40
AVD76416.1|264958_266731_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	4.9e-48
>prophage 25
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	271185	271881	4784656		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVD76420.1|271185_271881_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	4.2e-88
>prophage 26
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	275155	280200	4784656	protease	Bacillus_phage(25.0%)	4	NA	NA
AVD76425.1|275155_275428_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.5e-20
AVD76426.1|275636_277991_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.5	1.2e-224
AVD76427.1|278175_279450_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	1.9e-131
AVD76428.1|279576_280200_-	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 27
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	302997	312607	4784656	tRNA	uncultured_Mediterranean_phage(50.0%)	11	NA	NA
AVD76451.1|302997_303468_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	7.8e-30
AVD76452.1|303558_304662_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase	NA	A0A1V0SE20	Indivirus	35.5	5.9e-52
AVD76453.1|304665_305115_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AVD76454.1|305268_305808_+	hypothetical protein	NA	NA	NA	NA	NA
AVD76455.1|306106_306970_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
AVD76456.1|307015_307708_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	30.1	5.9e-18
AVD76457.1|307731_308097_-	VOC family protein	NA	NA	NA	NA	NA
AVD76458.1|308267_309239_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.8	1.4e-44
AVD76459.1|309249_311097_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AVD76460.1|311124_311457_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
AVD76461.1|311479_312607_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.3	1.6e-89
>prophage 28
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	324799	331368	4784656		Bacillus_phage(75.0%)	4	NA	NA
AVD76473.1|324799_326095_-	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.3	1.1e-28
AVD76474.1|326145_326835_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.9	1.1e-37
AVD76475.1|327025_328228_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	39.8	4.3e-08
AVD76476.1|328224_331368_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.4	1.7e-11
>prophage 29
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	339148	340060	4784656		Salmonella_phage(100.0%)	1	NA	NA
AVD76483.1|339148_340060_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	64.3	2.7e-103
>prophage 30
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	343896	345012	4784656		Bacillus_phage(100.0%)	1	NA	NA
AVD76490.1|343896_345012_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.6	5.3e-16
>prophage 31
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	361683	362451	4784656		Planktothrix_phage(100.0%)	1	NA	NA
AVD76505.1|361683_362451_-	taurine transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	5.6e-25
>prophage 32
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	370501	371548	4784656		Bacillus_virus(100.0%)	1	NA	NA
AVD76512.1|370501_371548_+	Fe(3+) ions import ATP-binding protein FbpC	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
>prophage 33
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	375533	377494	4784656		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
AVD76514.1|375533_376547_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	5.4e-44
AVD76515.1|376543_377494_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.7	8.1e-34
>prophage 34
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	387951	395525	4784656		Enterobacteria_phage(33.33%)	4	NA	NA
AVD76526.1|387951_389034_+	lac repressor	NA	C6ZCU4	Enterobacteria_phage	81.7	2.7e-158
AVD76527.1|389155_392239_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	82.0	0.0e+00
AVD76528.1|392290_393544_+	MFS transporter	NA	NA	NA	NA	NA
AVD76529.1|393638_395525_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.6	1.4e-53
>prophage 35
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	409272	410178	4784656		Burkholderia_virus(100.0%)	1	NA	NA
AVD76541.1|409272_410178_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.1	4.0e-14
>prophage 36
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	418278	419391	4784656		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVD76550.1|418278_419391_+	agmatine deiminase	NA	M1HH76	Paramecium_bursaria_Chlorella_virus	35.7	4.4e-55
>prophage 37
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	441697	442702	4784656		Enterobacteria_phage(100.0%)	1	NA	NA
AVD76568.1|441697_442702_+	transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.1e-23
>prophage 38
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	450270	451452	4784656	integrase	Enterobacteria_phage(100.0%)	1	443137:443151	451610:451624
443137:443151	attL	CGGCACCATCCCTTA	NA	NA	NA	NA
AVD76576.1|450270_451452_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	55.4	4.0e-123
AVD76576.1|450270_451452_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	55.4	4.0e-123
451610:451624	attR	TAAGGGATGGTGCCG	NA	NA	NA	NA
>prophage 39
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	462332	466043	4784656		Streptococcus_phage(66.67%)	3	NA	NA
AVD76585.1|462332_463583_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	1.6e-98
AVD76586.1|463594_464698_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.6	1.2e-60
AVD76587.1|464987_466043_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.5	5.5e-116
>prophage 40
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	473334	473916	4784656		Caulobacter_phage(100.0%)	1	NA	NA
AVD76595.1|473334_473916_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	5.7e-14
>prophage 41
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	490228	494427	4784656		Bradyrhizobium_phage(33.33%)	5	NA	NA
AVD80489.1|490228_490957_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.8	6.9e-41
AVD76611.1|491021_491489_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	60.1	6.5e-53
AVD76612.1|491485_492208_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVD76613.1|492241_492997_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AVD76614.1|493068_494427_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	35.1	9.9e-09
>prophage 42
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	498471	499275	4784656		Indivirus(100.0%)	1	NA	NA
AVD76618.1|498471_499275_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	34.6	1.0e-37
>prophage 43
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	505740	506772	4784656		Planktothrix_phage(100.0%)	1	NA	NA
AVD76620.1|505740_506772_+	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
>prophage 44
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	518774	522878	4784656		Saccharomonospora_phage(50.0%)	2	NA	NA
AVD76634.1|518774_522257_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	5.9e-207
AVD76635.1|522281_522878_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.8	1.3e-26
>prophage 45
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	531685	532444	4784656		Flavobacterium_phage(100.0%)	1	NA	NA
AVD76644.1|531685_532444_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	41.5	5.5e-25
>prophage 46
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	544075	545509	4784656	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVD76656.1|544075_545509_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	2.1e-25
>prophage 47
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	549511	549856	4784656		Lake_Baikal_phage(100.0%)	1	NA	NA
AVD76661.1|549511_549856_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	52.3	1.2e-27
>prophage 48
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	555865	556663	4784656		Planktothrix_phage(100.0%)	1	NA	NA
AVD76666.1|555865_556663_-	iron-hydroxamate transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	27.8	1.2e-14
>prophage 49
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	567153	573976	4784656	tRNA	Niemeyer_virus(50.0%)	6	NA	NA
AVD76673.1|567153_569628_-	ATP-dependent helicase HrpB	NA	A0A0U2UIE6	Niemeyer_virus	28.9	4.1e-37
AVD76674.1|569656_570187_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AVD76675.1|570202_570907_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AVD76676.1|571084_571540_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AVD76677.1|571610_572507_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AVD76678.1|572557_573976_+	polynucleotide adenylyltransferase	NA	G3MAR3	Bacillus_virus	35.9	5.5e-26
>prophage 50
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	587020	589325	4784656		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
AVD76692.1|587020_587947_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.7	4.1e-22
AVD76693.1|588055_588718_+	carbonate dehydratase	NA	NA	NA	NA	NA
AVD76694.1|588788_589325_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	3.9e-17
>prophage 51
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	592597	595513	4784656		Mamastrovirus(50.0%)	3	NA	NA
AVD76696.1|592597_594214_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.3	3.3e-19
AVD80494.1|594367_594715_+	hypothetical protein	NA	NA	NA	NA	NA
AVD76697.1|594745_595513_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.3	5.7e-30
>prophage 52
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	604992	606417	4784656		Erysipelothrix_phage(100.0%)	1	NA	NA
AVD76705.1|604992_606417_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	4.6e-41
>prophage 53
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	617496	618060	4784656		Thiobacimonas_phage(100.0%)	1	NA	NA
AVD76713.1|617496_618060_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0T6G1	Thiobacimonas_phage	33.1	2.7e-13
>prophage 54
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	622366	623410	4784656		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVD76717.1|622366_623410_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.0	3.4e-102
>prophage 55
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	649598	651323	4784656		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVD76743.1|649598_651323_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.7	1.7e-34
>prophage 56
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	667617	668316	4784656		Bacillus_virus(100.0%)	1	NA	NA
AVD76757.1|667617_668316_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	37.4	1.8e-22
>prophage 57
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	675507	680943	4784656		Lymphocystis_disease_virus(50.0%)	2	NA	NA
AVD76763.1|675507_677859_+	DNA polymerase II	NA	A0A1B2RW58	Lymphocystis_disease_virus	25.4	6.5e-16
AVD76764.1|678036_680943_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	2.2e-21
>prophage 58
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	688801	690220	4784656		Salmonella_phage(50.0%)	2	NA	NA
AVD76772.1|688801_689650_+	diadenosine tetraphosphatase	NA	S4TT53	Salmonella_phage	28.8	8.3e-06
AVD76773.1|689740_690220_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	47.1	3.0e-29
>prophage 59
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	698550	704201	4784656		Vibrio_phage(50.0%)	4	NA	NA
AVD76784.1|698550_700068_+	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	22.4	2.5e-08
AVD76785.1|700102_701245_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVD76786.1|701368_702586_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
AVD76787.1|702647_704201_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	24.6	5.2e-30
>prophage 60
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	709684	710833	4784656		Halovirus(100.0%)	1	NA	NA
AVD76792.1|709684_710833_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.4	2.2e-49
>prophage 61
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	717008	719825	4784656	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVD76800.1|717008_719825_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	25.6	1.0e-76
>prophage 62
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	726292	730807	4784656		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
AVD76806.1|726292_727459_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.2	5.7e-90
AVD76807.1|727665_728799_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	5.5e-29
AVD76808.1|728884_730807_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.1	5.5e-146
>prophage 63
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	734691	735645	4784656		Synechococcus_phage(100.0%)	1	NA	NA
AVD76813.1|734691_735645_-	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	35.2	9.7e-11
>prophage 64
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	746841	748266	4784656		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AVD76823.1|746841_748266_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.0	1.0e-08
>prophage 65
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	752224	757490	4784656		Bacillus_phage(33.33%)	3	NA	NA
AVD76830.1|752224_754162_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.2	1.6e-12
AVD76831.1|754493_756161_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	1.4e-41
AVD76832.1|756260_757490_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.0	4.5e-85
>prophage 66
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	764173	765496	4784656		Geobacillus_virus(100.0%)	1	NA	NA
AVD76840.1|764173_765496_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.3	2.0e-78
>prophage 67
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	771322	774127	4784656		Salmonella_phage(50.0%)	3	NA	NA
AVD80499.1|771322_771502_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	1.8e-11
AVD76846.1|771611_772229_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AVD76847.1|772537_774127_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.1	9.1e-30
>prophage 68
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	777950	779027	4784656		Bacillus_phage(100.0%)	1	NA	NA
AVD76852.1|777950_779027_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.2	1.5e-20
>prophage 69
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	785368	786648	4784656		Salmonella_phage(50.0%)	2	NA	NA
AVD76860.1|785368_785908_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
AVD76861.1|785910_786648_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	2.9e-63
>prophage 70
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	789837	792319	4784656		Micromonas_pusilla_virus(50.0%)	2	NA	NA
AVD76864.1|789837_791283_-	altronate oxidoreductase	NA	G8DCZ3	Micromonas_pusilla_virus	26.0	9.5e-18
AVD76865.1|791296_792319_-	galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.0	3.9e-10
>prophage 71
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	795891	797553	4784656		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVD76869.1|795891_797553_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	72.3	6.0e-08
>prophage 72
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	819929	824399	4784656		Enterobacteria_phage(50.0%)	4	NA	NA
AVD76891.1|819929_820937_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	50.3	1.8e-84
AVD76892.1|821130_821340_-	hypothetical protein	NA	NA	NA	NA	NA
AVD76893.1|821974_822748_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVD76894.1|822923_824399_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.1	1.2e-47
>prophage 73
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	850045	850993	4784656		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVD76915.1|850045_850993_+	site-specific DNA-methyltransferase	NA	A0A1B1IW70	uncultured_Mediterranean_phage	31.0	9.3e-14
>prophage 74
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	854488	854683	4784656		Enterobacteria_phage(100.0%)	1	NA	NA
AVD76919.1|854488_854683_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	44.8	5.0e-07
>prophage 75
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	857933	862838	4784656		Yersinia_virus(50.0%)	5	NA	NA
AVD76920.1|857933_860114_+	hypothetical protein	NA	Q858T2	Yersinia_virus	24.1	6.2e-13
AVD76921.1|860113_860977_+	hypothetical protein	NA	NA	NA	NA	NA
AVD76922.1|861921_862152_-	transcriptional regulator	NA	NA	NA	NA	NA
AVD76923.1|862191_862455_-	transcriptional regulator	NA	NA	NA	NA	NA
AVD76924.1|862562_862838_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	65.3	2.1e-19
>prophage 76
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	872500	886690	4784656	integrase,tRNA	Pseudomonas_phage(16.67%)	11	865479:865492	880039:880052
865479:865492	attL	CTGCTGACGATGGC	NA	NA	NA	NA
AVD76933.1|872500_873535_-	Appr-1-p processing protein	NA	B3FJ30	Pseudomonas_phage	33.8	2.9e-16
AVD76934.1|873547_874192_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
AVD76935.1|874331_876011_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	38.2	1.7e-79
AVD76936.1|876538_877558_+	alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.7	3.5e-43
AVD80506.1|877705_879208_+	hypothetical protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	3.0e-83
AVD76937.1|879311_880394_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
880039:880052	attR	GCCATCGTCAGCAG	NA	NA	NA	NA
AVD76938.1|880393_881494_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AVD76939.1|881456_881651_+	hypothetical protein	NA	NA	NA	NA	NA
AVD76940.1|881760_883272_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	7.1e-48
AVD76941.1|883391_883835_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AVD76942.1|883834_886690_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	4.2e-142
>prophage 77
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	891762	892698	4784656		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVD76951.1|891762_892698_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.2	1.4e-51
>prophage 78
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	898555	902601	4784656		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
AVD76959.1|898555_901264_-	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	25.7	1.3e-44
AVD76960.1|901408_901642_-	hypothetical protein	NA	NA	NA	NA	NA
AVD76961.1|901653_902601_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.5	7.9e-13
>prophage 79
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	906288	909052	4784656		Vibrio_phage(100.0%)	2	NA	NA
AVD76964.1|906288_908427_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.4	2.6e-266
AVD76965.1|908587_909052_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	A0A2D0YLR2	Vibrio_phage	57.1	9.4e-52
>prophage 80
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	921001	922000	4784656		Klosneuvirus(100.0%)	1	NA	NA
AVD76980.1|921001_922000_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.1	1.1e-68
>prophage 81
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	925316	928716	4784656		Organic_Lake_phycodnavirus(50.0%)	3	NA	NA
AVD76983.1|925316_926819_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.4	4.7e-12
AVD76984.1|926922_927879_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVD76985.1|928188_928716_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	9.3e-56
>prophage 82
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	932735	934745	4784656		Acinetobacter_phage(100.0%)	1	NA	NA
AVD76991.1|932735_934745_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	28.7	8.6e-09
>prophage 83
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	950524	952096	4784656		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVD77003.1|950524_952096_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.6	1.0e-09
>prophage 84
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	971576	976018	4784656		Lactococcus_phage(50.0%)	4	NA	NA
AVD77027.1|971576_974039_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.3	3.6e-65
AVD77028.1|974077_974503_-	HTH-type transcriptional repressor NsrR	NA	NA	NA	NA	NA
AVD77029.1|974483_974825_+	hypothetical protein	NA	NA	NA	NA	NA
AVD77030.1|974719_976018_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	2.9e-66
>prophage 85
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	981541	984754	4784656		Wolbachia_phage(50.0%)	2	NA	NA
AVD77037.1|981541_983416_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	42.1	2.6e-60
AVD77038.1|983425_984754_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	1.1e-17
>prophage 86
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	988656	989202	4784656		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVD77042.1|988656_989202_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.0	1.7e-28
>prophage 87
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	996651	997629	4784656		Tupanvirus(100.0%)	1	NA	NA
AVD77047.1|996651_997629_-	elongation factor P lysine(34) lysyltransferase	NA	A0A2K9KZX5	Tupanvirus	28.8	1.1e-28
>prophage 88
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1003531	1004065	4784656		Morganella_phage(100.0%)	1	NA	NA
AVD77054.1|1003531_1004065_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
>prophage 89
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1009095	1011076	4784656		Vibrio_phage(50.0%)	2	NA	NA
AVD77063.1|1009095_1010739_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.1	1.7e-188
AVD77064.1|1010782_1011076_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
>prophage 90
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1019788	1021450	4784656		Hepacivirus(100.0%)	1	NA	NA
AVD77073.1|1019788_1021450_+	long-chain fatty acid--CoA ligase	NA	Q75ZG1	Hepacivirus	24.4	3.0e-31
>prophage 91
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1048282	1051100	4784656		Bacillus_phage(50.0%)	3	NA	NA
AVD77089.1|1048282_1049365_+	two-component system sensor histidine kinase BasS	NA	W8CYF6	Bacillus_phage	27.2	4.5e-12
AVD77090.1|1049358_1049448_-	LpxT activity modulator PmrR	NA	NA	NA	NA	NA
AVD77091.1|1049597_1051100_-	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.5	4.1e-56
>prophage 92
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1057674	1058463	4784656		Pithovirus(100.0%)	1	NA	NA
AVD77097.1|1057674_1058463_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.1	7.2e-12
>prophage 93
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1064109	1068948	4784656		Bacillus_virus(33.33%)	7	NA	NA
AVD77104.1|1064109_1064868_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	1.8e-15
AVD77105.1|1064989_1065676_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-08
AVD77106.1|1065672_1066809_+	phosphonate metabolism protein PhnM	NA	NA	NA	NA	NA
AVD77107.1|1066811_1067366_+	ribose 1,5-bisphosphokinase	NA	NA	NA	NA	NA
AVD77108.1|1067352_1067787_+	aminoalkylphosphonate N-acetyltransferase	NA	NA	NA	NA	NA
AVD77109.1|1067795_1068554_+	phosphonate metabolism protein PhnP	NA	NA	NA	NA	NA
AVD77110.1|1068606_1068948_-	addiction module antidote protein, HigA family	NA	A0A222YWD7	Escherichia_phage	81.8	1.8e-44
>prophage 94
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1072206	1073730	4784656		Pithovirus(100.0%)	1	NA	NA
AVD77113.1|1072206_1073730_+	sugar ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	22.9	3.6e-07
>prophage 95
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1091174	1093133	4784656		Staphylococcus_phage(100.0%)	1	NA	NA
AVD77129.1|1091174_1093133_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.5	4.6e-92
>prophage 96
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1099573	1100923	4784656		Moraxella_phage(100.0%)	1	NA	NA
AVD77136.1|1099573_1100923_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	70.9	2.6e-158
>prophage 97
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1104888	1109814	4784656	transposase	Enterobacteria_phage(33.33%)	5	NA	NA
AVD77141.1|1104888_1105413_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	94.5	1.1e-53
AVD77142.1|1105664_1108487_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.5	5.2e-312
AVD77143.1|1108470_1108656_-	hypothetical protein	NA	NA	NA	NA	NA
AVD77144.1|1108675_1108897_+	hypothetical protein	NA	NA	NA	NA	NA
AVD77145.1|1108833_1109814_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.8	1.0e-23
>prophage 98
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1112850	1115362	4784656		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
AVD77149.1|1112850_1113930_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	1.1e-29
AVD77150.1|1113946_1115362_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	77.9	1.8e-199
>prophage 99
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1121040	1121649	4784656		Lactococcus_phage(100.0%)	1	NA	NA
AVD77155.1|1121040_1121649_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 100
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1128824	1129934	4784656		Mycoplasma_phage(100.0%)	1	NA	NA
AVD77162.1|1128824_1129934_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 101
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1160007	1167018	4784656		Brucella_phage(66.67%)	5	NA	NA
AVD77192.1|1160007_1160325_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	57.3	5.1e-25
AVD77193.1|1160317_1160596_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	48.8	1.3e-11
AVD77194.1|1160706_1161396_+	dipeptidase PepE	NA	NA	NA	NA	NA
AVD77195.1|1161482_1163114_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
AVD77196.1|1163334_1167018_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 102
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1180793	1182383	4784656		Prochlorococcus_phage(100.0%)	1	NA	NA
AVD77203.1|1180793_1182383_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	3.2e-67
>prophage 103
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1187874	1189638	4784656		Bacillus_phage(50.0%)	3	NA	NA
AVD77208.1|1187874_1188147_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
AVD77209.1|1188333_1188924_-	DUF416 domain-containing protein	NA	NA	NA	NA	NA
AVD77210.1|1188957_1189638_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	29.6	7.4e-21
>prophage 104
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1194903	1215429	4784656		Indivirus(14.29%)	17	NA	NA
AVD77216.1|1194903_1195662_+	molybdopterin biosynthesis protein MoeB	NA	A0A1V0SCZ9	Indivirus	32.7	1.6e-11
AVD77217.1|1195642_1195843_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AVD77218.1|1195844_1196615_+	thiazole synthase	NA	NA	NA	NA	NA
AVD77219.1|1196611_1197745_+	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
AVD77220.1|1197864_1198077_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	78.6	2.2e-24
AVD77221.1|1199169_1199475_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AVD77222.1|1199479_1199797_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AVD77223.1|1199899_1204123_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.4	1.3e-67
AVD77224.1|1204199_1208228_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.4	1.6e-22
AVD77225.1|1208548_1208914_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
AVD77226.1|1208980_1209478_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
AVD77227.1|1209892_1210600_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
AVD77228.1|1210603_1211032_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
AVD77229.1|1211186_1211732_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	29.6	1.1e-14
AVD77230.1|1211733_1212117_-	protein translocase subunit SecE	NA	NA	NA	NA	NA
AVD77231.1|1212347_1213532_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	7.5e-13
AVD80518.1|1214478_1215429_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 105
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1224086	1225943	4784656		Acinetobacter_phage(100.0%)	1	NA	NA
AVD77235.1|1224086_1225943_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	27.5	1.5e-07
>prophage 106
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1242969	1250339	4784656		Serratia_phage(33.33%)	5	NA	NA
AVD77248.1|1242969_1245267_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	46.2	1.3e-05
AVD77249.1|1245436_1245757_-	PTS fructose-like transporter subunit EIIB	NA	NA	NA	NA	NA
AVD77250.1|1245771_1246851_-	PTS fructose-like transporter subunit EIIC	NA	NA	NA	NA	NA
AVD80521.1|1247159_1249661_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	27.8	4.6e-12
AVD77251.1|1249676_1250339_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	33.2	1.9e-29
>prophage 107
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1271559	1276207	4784656	protease	Erwinia_phage(50.0%)	5	NA	NA
AVD77271.1|1271559_1272891_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	29.2	2.6e-46
AVD77272.1|1272958_1273888_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AVD77273.1|1273980_1274466_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AVD77274.1|1274687_1274933_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
AVD77275.1|1275361_1276207_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.5	4.0e-16
>prophage 108
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1289814	1291883	4784656		Feldmannia_irregularis_virus(50.0%)	2	NA	NA
AVD77289.1|1289814_1290513_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	1.5e-05
AVD77290.1|1290509_1291883_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	1.1e-15
>prophage 109
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1298177	1298798	4784656		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AVD77296.1|1298177_1298798_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	3.5e-62
>prophage 110
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1318070	1319000	4784656		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
AVD77319.1|1318070_1319000_+	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	32.0	2.3e-25
>prophage 111
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1326686	1331429	4784656		Acanthamoeba_polyphaga_moumouvirus(33.33%)	5	NA	NA
AVD77329.1|1326686_1327697_-	Zn-dependent alcohol dehydrogenase	NA	L7RC95	Acanthamoeba_polyphaga_moumouvirus	25.1	2.2e-05
AVD77330.1|1327728_1328616_-	aldolase	NA	NA	NA	NA	NA
AVD77331.1|1328641_1329532_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	76.7	8.4e-49
AVD77332.1|1329704_1330601_+	sugar kinase	NA	NA	NA	NA	NA
AVD77333.1|1330640_1331429_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.5	2.0e-22
>prophage 112
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1335391	1337861	4784656		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
AVD77336.1|1335391_1336441_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	3.4e-09
AVD80526.1|1336451_1337861_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	9.0e-05
>prophage 113
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1341773	1344560	4784656		Enterococcus_phage(100.0%)	1	NA	NA
AVD77341.1|1341773_1344560_-	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	30.3	6.5e-47
>prophage 114
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1356787	1357402	4784656		Streptococcus_phage(100.0%)	1	NA	NA
AVD77351.1|1356787_1357402_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	45.7	2.8e-19
>prophage 115
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1368387	1371707	4784656		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AVD77361.1|1368387_1369179_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.0	3.0e-26
AVD77362.1|1369181_1369730_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AVD77363.1|1369733_1369988_-	Sec-independent protein translocase protein TatA	NA	NA	NA	NA	NA
AVD77364.1|1370066_1371707_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.5	1.3e-42
>prophage 116
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1383716	1387153	4784656	transposase	Sodalis_phage(50.0%)	3	NA	NA
AVD77376.1|1383716_1384601_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	52.4	5.7e-66
AVD77377.1|1384639_1385260_-	threonine export protein RhtC	NA	NA	NA	NA	NA
AVD77378.1|1385323_1387153_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.5	1.9e-84
>prophage 117
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1391171	1395041	4784656		Bacillus_phage(100.0%)	3	NA	NA
AVD77383.1|1391171_1393334_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.7	3.5e-117
AVD77384.1|1393422_1394139_-	flavin mononucleotide phosphatase	NA	NA	NA	NA	NA
AVD77385.1|1394138_1395041_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.9	1.1e-24
>prophage 118
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1411451	1417613	4784656		uncultured_marine_virus(20.0%)	6	NA	NA
AVD77400.1|1411451_1412582_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	5.1e-19
AVD77401.1|1412586_1413264_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AVD77402.1|1413241_1414123_-	glucose-1-phosphate thymidylyltransferase	NA	A0A291LA53	Escherichia_phage	66.7	1.8e-107
AVD77403.1|1414156_1415224_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.8	5.6e-100
AVD77404.1|1415223_1416486_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HFY9	Paramecium_bursaria_Chlorella_virus	27.5	4.5e-24
AVD77405.1|1416482_1417613_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.8	1.1e-26
>prophage 119
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1421666	1427095	4784656		Indivirus(33.33%)	5	NA	NA
AVD77409.1|1421666_1421996_-	thiol reductase thioredoxin	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
AVD77410.1|1422139_1423408_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	8.3e-42
AVD77411.1|1423416_1423539_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AVD77412.1|1423544_1425026_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
AVD77413.1|1425073_1427095_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	2.2e-113
>prophage 120
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1436299	1437946	4784656		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVD77421.1|1436299_1437946_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	1.0e-63
>prophage 121
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1453309	1457303	4784656		Tupanvirus(50.0%)	3	NA	NA
AVD77432.1|1453309_1454815_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	21.9	2.9e-17
AVD77433.1|1454822_1455242_-	D-ribose pyranase	NA	NA	NA	NA	NA
AVD77434.1|1455434_1457303_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.5	3.2e-66
>prophage 122
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1460577	1461570	4784656		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AVD77437.1|1460577_1461570_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	3.8e-50
>prophage 123
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1473880	1484653	4784656		Chrysochromulina_ericina_virus(20.0%)	9	NA	NA
AVD77451.1|1473880_1475251_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.0	2.5e-36
AVD77452.1|1475603_1477433_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	41.2	4.0e-122
AVD77453.1|1477767_1478808_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	35.8	2.7e-46
AVD77454.1|1478951_1479911_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AVD77455.1|1479910_1480801_+	phosphate ABC transporter, permease protein PstA	NA	NA	NA	NA	NA
AVD80529.1|1480847_1481621_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	30.6	3.4e-14
AVD77456.1|1481635_1482361_+	phosphate transport system regulator PhoU	NA	NA	NA	NA	NA
AVD77457.1|1482482_1483148_-	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
AVD77458.1|1483315_1484653_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	38.0	1.6e-64
>prophage 124
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1491630	1499138	4784656		Staphylococcus_phage(33.33%)	7	NA	NA
AVD77465.1|1491630_1491888_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
AVD77466.1|1491851_1492211_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AVD77467.1|1492228_1492369_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AVD77468.1|1492975_1494379_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AVD77469.1|1494383_1495484_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	1.1e-53
AVD77470.1|1495621_1496695_+	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
AVD77471.1|1496723_1499138_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.1	4.1e-114
>prophage 125
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1506692	1507106	4784656		Synechococcus_phage(100.0%)	1	NA	NA
AVD77476.1|1506692_1507106_+	heat shock protein IbpA	NA	A0A1D8KSJ6	Synechococcus_phage	35.2	4.6e-18
>prophage 126
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1515756	1520596	4784656		Salmonella_phage(50.0%)	5	NA	NA
AVD77485.1|1515756_1516941_-	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	24.5	3.3e-16
AVD77486.1|1517132_1517966_-	EamA family transporter	NA	NA	NA	NA	NA
AVD77487.1|1518089_1518179_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AVD77488.1|1518701_1518800_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AVD77489.1|1518907_1520596_+	acetolactate synthase, large subunit, biosynthetic type	NA	E5EQ70	Micromonas_sp._RCC1109_virus	30.4	2.2e-58
>prophage 127
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1535840	1537223	4784656		Pandoravirus(100.0%)	1	NA	NA
AVD77505.1|1535840_1537223_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	28.0	1.7e-40
>prophage 128
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1541245	1545938	4784656	transposase	Sodalis_phage(33.33%)	5	NA	NA
AVD77511.1|1541245_1542172_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	52.0	2.2e-68
AVD77512.1|1542295_1543114_+	lipoprotein NlpA	NA	NA	NA	NA	NA
AVD77513.1|1543142_1544045_-	EamA family transporter	NA	NA	NA	NA	NA
AVD80533.1|1544070_1545015_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.4	2.2e-15
AVD77514.1|1545161_1545938_+	sugar dehydrogenase	NA	A0A0M4JSW6	Mollivirus	27.2	6.4e-13
>prophage 129
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1552679	1555484	4784656		Escherichia_phage(100.0%)	1	NA	NA
AVD77521.1|1552679_1555484_+	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	47.8	1.3e-100
>prophage 130
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1572001	1573393	4784656		environmental_Halophage(100.0%)	1	NA	NA
AVD77538.1|1572001_1573393_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	95.9	2.5e-68
>prophage 131
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1577647	1582675	4784656		Bordetella_phage(33.33%)	4	NA	NA
AVD77542.1|1577647_1579762_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
AVD77543.1|1579780_1580056_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AVD77544.1|1580110_1580734_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	2.2e-19
AVD77545.1|1580995_1582675_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.0	2.9e-26
>prophage 132
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1586739	1591360	4784656		Xanthomonas_phage(25.0%)	7	NA	NA
AVD77552.1|1586739_1587195_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	1.2e-48
AVD80536.1|1587175_1588396_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.7	1.2e-42
AVD77553.1|1588567_1589233_+	JAB domain-containing protein	NA	NA	NA	NA	NA
AVD77554.1|1589509_1589746_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AVD77555.1|1589766_1589934_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AVD77556.1|1590032_1590842_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.2	2.6e-25
AVD77557.1|1590880_1591360_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.2	6.3e-27
>prophage 133
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1601830	1612230	4784656		Prochlorococcus_phage(16.67%)	10	NA	NA
AVD77567.1|1601830_1602763_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.1	1.0e-36
AVD77568.1|1602977_1604174_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.1	9.2e-35
AVD77569.1|1604183_1605209_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.4	3.9e-18
AVD77570.1|1605261_1605948_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AVD77571.1|1606433_1607468_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	29.4	1.7e-08
AVD77572.1|1607468_1608404_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AVD77573.1|1608407_1609691_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.8e-07
AVD80537.1|1609700_1611245_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVD77574.1|1611494_1611926_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AVD77575.1|1611978_1612230_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	2.2e-15
>prophage 134
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1633615	1635460	4784656	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVD77595.1|1633615_1635460_+|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	25.1	6.9e-13
>prophage 135
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1656732	1657728	4784656		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AVD80539.1|1656732_1657728_-	O-acetyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.5	1.0e-10
>prophage 136
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1662135	1662348	4784656		Morganella_phage(100.0%)	1	NA	NA
AVD77617.1|1662135_1662348_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 137
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1670143	1672477	4784656		Escherichia_phage(100.0%)	1	NA	NA
AVD77626.1|1670143_1672477_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.3	2.2e-72
>prophage 138
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1682365	1684350	4784656		Planktothrix_phage(50.0%)	2	NA	NA
AVD77638.1|1682365_1683349_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	2.5e-14
AVD77639.1|1683345_1684350_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	1.9e-17
>prophage 139
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1712834	1714877	4784656		Indivirus(100.0%)	1	NA	NA
AVD77663.1|1712834_1714877_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.3	2.0e-45
>prophage 140
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1724681	1728489	4784656		Ostreococcus_tauri_virus(50.0%)	3	NA	NA
AVD77672.1|1724681_1726154_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.6	5.4e-45
AVD77673.1|1726261_1727443_-	mannonate dehydratase	NA	NA	NA	NA	NA
AVD77674.1|1727463_1728489_-	alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	23.6	2.3e-10
>prophage 141
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1740077	1742825	4784656		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AVD77684.1|1740077_1742825_+	multidrug ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.6	8.7e-20
>prophage 142
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1765145	1769223	4784656		Dickeya_phage(50.0%)	4	NA	NA
AVD77711.1|1765145_1765811_-	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	54.9	2.5e-58
AVD77712.1|1765979_1766225_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	4.7e-10
AVD77713.1|1766323_1768522_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	37.7	1.2e-117
AVD77714.1|1768596_1769223_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	60.2	2.3e-29
>prophage 143
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1772475	1775320	4784656		Staphylococcus_phage(50.0%)	3	NA	NA
AVD77719.1|1772475_1773144_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.5e-13
AVD77720.1|1773136_1774195_+	cell division protein FtsX	NA	NA	NA	NA	NA
AVD77721.1|1774465_1775320_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	7.0e-45
>prophage 144
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1781114	1782613	4784656		Anomala_cuprea_entomopoxvirus(100.0%)	2	NA	NA
AVD77727.1|1781114_1781882_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	3.7e-13
AVD77728.1|1781899_1782613_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.2	1.9e-11
>prophage 145
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1786402	1788213	4784656		Planktothrix_phage(50.0%)	2	NA	NA
AVD77733.1|1786402_1787473_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.0	2.6e-20
AVD77734.1|1787469_1788213_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	4.9e-10
>prophage 146
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1809315	1811763	4784656		Dickeya_phage(100.0%)	1	NA	NA
AVD77754.1|1809315_1811763_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	82.1	3.6e-33
>prophage 147
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1818965	1821359	4784656		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AVD77760.1|1818965_1821359_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	2.1e-14
>prophage 148
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1834537	1838303	4784656		Bacillus_phage(66.67%)	3	NA	NA
AVD77771.1|1834537_1835257_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
AVD77772.1|1835253_1836606_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.6	1.9e-12
AVD77773.1|1836680_1838303_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.9	1.6e-143
>prophage 149
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1855254	1856091	4784656		Vibrio_phage(100.0%)	1	NA	NA
AVD77789.1|1855254_1856091_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	8.4e-67
>prophage 150
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1873816	1877861	4784656		Acinetobacter_phage(33.33%)	3	NA	NA
AVD77804.1|1873816_1874380_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.5	2.7e-61
AVD77805.1|1874465_1875683_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.7	8.0e-34
AVD77806.1|1875773_1877861_-	hypothetical protein	NA	H9YQA8	environmental_Halophage	87.7	2.1e-66
>prophage 151
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1881596	1886827	4784656		Bacillus_virus(25.0%)	4	NA	NA
AVD77812.1|1881596_1882316_-	NUDIX domain-containing protein	NA	G3MA14	Bacillus_virus	28.4	8.6e-20
AVD77813.1|1882507_1883368_+	ribose-phosphate pyrophosphokinase	NA	G0X553	Salmonella_phage	41.3	1.5e-50
AVD77814.1|1883382_1884873_+	nicotinate phosphoribosyltransferase	NA	A0A218KC49	Bacillus_phage	52.2	1.3e-142
AVD77815.1|1884925_1886827_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.9	1.5e-74
>prophage 152
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1892504	1898076	4784656		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
AVD77823.1|1892504_1892891_+	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	40.6	3.9e-19
AVD77824.1|1892890_1893250_+	sulfurtransferase TusC	NA	NA	NA	NA	NA
AVD77825.1|1893257_1893545_+	sulfurtransferase TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	39.2	3.1e-05
AVD77826.1|1893670_1894045_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
AVD77827.1|1894140_1894611_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
AVD77828.1|1894707_1896822_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.1	6.2e-58
AVD77829.1|1896891_1898076_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	7.5e-13
>prophage 153
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1917975	1919447	4784656	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
AVD77865.1|1917975_1918923_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	36.9	2.2e-07
AVD77866.1|1918937_1919447_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
>prophage 154
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1929900	1934056	4784656		Bacillus_virus(50.0%)	4	NA	NA
AVD77875.1|1929900_1930659_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	3.1e-20
AVD77876.1|1930666_1931770_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVD77877.1|1931779_1932961_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVD77878.1|1933030_1934056_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	6.9e-71
>prophage 155
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1940658	1941543	4784656		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVD77884.1|1940658_1941543_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.2	2.1e-28
>prophage 156
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1954200	1955244	4784656		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVD77897.1|1954200_1955244_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 157
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1972948	1974316	4784656	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVD77913.1|1972948_1974316_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	2.5e-20
>prophage 158
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1978218	1978722	4784656	protease	Pseudomonas_phage(100.0%)	1	NA	NA
AVD77920.1|1978218_1978722_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	7.3e-26
>prophage 159
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1982558	1984049	4784656		Burkholderia_virus(100.0%)	1	NA	NA
AVD77924.1|1982558_1984049_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.9	4.1e-08
>prophage 160
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	1994888	2008963	4784656		Staphylococcus_phage(25.0%)	16	NA	NA
AVD77931.1|1994888_1995818_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	4.0e-17
AVD77932.1|1996013_1998350_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.1	9.9e-41
AVD77933.1|1998579_1999233_+	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AVD77934.1|1999229_1999949_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AVD77935.1|2000015_2000288_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AVD77936.1|2000284_2001139_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
AVD77937.1|2001184_2001676_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AVD77938.1|2001759_2002047_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	4.2e-10
AVD77939.1|2002069_2003503_-	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AVD77940.1|2003549_2004275_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
AVD77941.1|2004281_2004830_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AVD77942.1|2004798_2005374_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AVD77943.1|2005370_2005937_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	74.8	1.8e-52
AVD77944.1|2005957_2006944_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
AVD77945.1|2006957_2007935_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
AVD77946.1|2008150_2008963_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.6	9.7e-20
>prophage 161
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2013055	2014532	4784656		Vibrio_phage(50.0%)	2	NA	NA
AVD77952.1|2013055_2013340_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	65.7	6.0e-17
AVD77953.1|2013560_2014532_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.2	1.6e-08
>prophage 162
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2021220	2024102	4784656	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
AVD77963.1|2021220_2023155_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	4.1e-117
AVD77964.1|2023253_2024102_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	28.9	1.7e-19
>prophage 163
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2029922	2036567	4784656		Dickeya_phage(50.0%)	4	NA	NA
AVD77970.1|2029922_2031266_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	93.7	4.8e-64
AVD77971.1|2031871_2032336_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AVD77972.1|2032364_2033852_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AVD77973.1|2033876_2036567_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.4	8.8e-25
>prophage 164
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2042109	2044089	4784656		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVD77979.1|2042109_2044089_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	4.7e-52
>prophage 165
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2049877	2055947	4784656		Invertebrate_iridovirus(33.33%)	8	NA	NA
AVD77986.1|2049877_2050168_-	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	53.2	4.1e-13
AVD77987.1|2050220_2050649_+	hypothetical protein	NA	NA	NA	NA	NA
AVD77988.1|2050685_2051321_+	hypothetical protein	NA	NA	NA	NA	NA
AVD77989.1|2051405_2051981_-	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AVD77990.1|2051990_2052581_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	3.2e-12
AVD77991.1|2052615_2053011_-	YraN family protein	NA	NA	NA	NA	NA
AVD77992.1|2052968_2055020_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
AVD77993.1|2055083_2055947_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	5.6e-50
>prophage 166
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2068661	2069807	4784656		Streptococcus_phage(100.0%)	1	NA	NA
AVD78007.1|2068661_2069807_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	40.2	4.1e-48
>prophage 167
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2075831	2078126	4784656		Tetraselmis_virus(100.0%)	1	NA	NA
AVD78012.1|2075831_2078126_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	40.4	5.3e-156
>prophage 168
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2098127	2099096	4784656		Enterobacteria_phage(100.0%)	1	NA	NA
AVD80550.1|2098127_2099096_-	hypothetical protein	NA	I7HPH5	Enterobacteria_phage	31.8	4.5e-32
>prophage 169
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2109916	2121967	4784656	tRNA	Herpes_simplex_virus(25.0%)	9	NA	NA
AVD78042.1|2109916_2113009_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.9	1.9e-156
AVD78043.1|2113216_2114200_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
AVD78044.1|2114409_2114742_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
AVD80551.1|2114819_2116295_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.7	3.7e-33
AVD78045.1|2116629_2118150_+	hypothetical protein	NA	A0A1B0V854	Salmonella_phage	49.3	1.1e-32
AVD78046.1|2118203_2118884_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AVD78047.1|2119122_2119896_+	NADPH-dependent ferric siderophore reductase	NA	NA	NA	NA	NA
AVD80552.1|2119896_2120745_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVD78048.1|2120812_2121967_+	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.8	2.1e-84
>prophage 170
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2136345	2141806	4784656	tRNA	Vibrio_phage(33.33%)	5	NA	NA
AVD78062.1|2136345_2138193_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
AVD78063.1|2138357_2140103_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	8.4e-77
AVD78064.1|2140147_2140243_+	hypothetical protein	NA	NA	NA	NA	NA
AVD78065.1|2140340_2140556_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVD78066.1|2140792_2141806_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.8	7.4e-110
>prophage 171
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2153263	2154499	4784656		Sinorhizobium_phage(100.0%)	1	NA	NA
AVD78081.1|2153263_2154499_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	48.3	3.4e-93
>prophage 172
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2159750	2163131	4784656		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AVD78085.1|2159750_2161184_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.0	7.4e-39
AVD78086.1|2161552_2161759_+	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
AVD78087.1|2161792_2162149_-	hypothetical protein	NA	NA	NA	NA	NA
AVD78088.1|2162477_2163131_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
>prophage 173
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2168832	2176907	4784656		Ralstonia_phage(25.0%)	9	NA	NA
AVD78095.1|2168832_2169993_-	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	42.9	8.5e-86
AVD78096.1|2169998_2170676_-	hypothetical protein	NA	A0A173GEW8	Erwinia_phage	45.0	2.6e-34
AVD78097.1|2170563_2170824_-	hypothetical protein	NA	NA	NA	NA	NA
AVD78098.1|2170823_2172302_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
AVD78099.1|2172501_2173134_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	34.2	7.6e-20
AVD78100.1|2173130_2173553_+	hypothetical protein	NA	NA	NA	NA	NA
AVD78101.1|2173577_2174405_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
AVD78102.1|2174404_2174986_+	esterase YqiA	NA	NA	NA	NA	NA
AVD78103.1|2175014_2176907_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.0e-92
>prophage 174
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2180205	2180604	4784656		Stx_converting_phage(100.0%)	1	NA	NA
AVD78108.1|2180205_2180604_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	43.9	9.9e-18
>prophage 175
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2184281	2186540	4784656		Bacillus_virus(100.0%)	1	NA	NA
AVD78112.1|2184281_2186540_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.3	9.8e-86
>prophage 176
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2190648	2195893	4784656		Pseudomonas_phage(33.33%)	4	NA	NA
AVD78116.1|2190648_2192820_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.3e-103
AVD78117.1|2192923_2193379_-	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.1	5.4e-20
AVD78118.1|2193423_2194878_-	anion permease	NA	NA	NA	NA	NA
AVD78119.1|2195065_2195893_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.6	1.9e-63
>prophage 177
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2205707	2207348	4784656		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVD78130.1|2205707_2207348_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.4	8.3e-10
>prophage 178
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2226159	2227926	4784656		Ralstonia_phage(100.0%)	1	NA	NA
AVD78146.1|2226159_2227926_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.5	2.6e-25
>prophage 179
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2241179	2242290	4784656	transposase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
AVD78157.1|2241179_2242290_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	24.5	1.1e-05
>prophage 180
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2247814	2248897	4784656		Geobacillus_virus(100.0%)	1	NA	NA
AVD78161.1|2247814_2248897_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	4.5e-12
>prophage 181
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2262266	2265214	4784656		Aichi_virus(50.0%)	2	NA	NA
AVD78179.1|2262266_2263661_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	25.5	8.3e-27
AVD78180.1|2264059_2265214_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	6.2e-129
>prophage 182
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2287631	2288864	4784656		Catovirus(100.0%)	1	NA	NA
AVD78197.1|2287631_2288864_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.6	3.1e-102
>prophage 183
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2296834	2302056	4784656		Prochlorococcus_phage(50.0%)	3	NA	NA
AVD78205.1|2296834_2299708_+	glycine dehydrogenase (aminomethyl-transferring)	NA	M4QFZ1	Prochlorococcus_phage	50.8	1.0e-260
AVD78206.1|2299785_2300529_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVD78207.1|2300622_2302056_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	8.2e-30
>prophage 184
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2306858	2314505	4784656	tRNA	Brevibacillus_phage(20.0%)	7	NA	NA
AVD78214.1|2306858_2307755_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	27.9	2.5e-29
AVD78215.1|2307778_2308492_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AVD78216.1|2308497_2310231_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.3	4.1e-60
AVD78217.1|2310322_2311420_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
AVD78218.1|2311430_2312948_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	1.3e-86
AVD78219.1|2313025_2313580_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AVD80565.1|2313746_2314505_+	hypothetical protein	NA	A0A7K9	Microcystis_virus	37.3	2.5e-09
>prophage 185
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2324332	2324938	4784656		Canarypox_virus(100.0%)	1	NA	NA
AVD78227.1|2324332_2324938_+	hypothetical protein	NA	Q6VZ28	Canarypox_virus	27.4	3.2e-07
>prophage 186
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2340606	2343101	4784656		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AVD78242.1|2340606_2341368_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	2.6e-19
AVD80567.1|2341682_2343101_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.7	5.1e-24
>prophage 187
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2346743	2347754	4784656		Enterobacteria_phage(100.0%)	1	NA	NA
AVD78247.1|2346743_2347754_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.3	3.3e-33
>prophage 188
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2354349	2361175	4784656		Moraxella_phage(33.33%)	7	NA	NA
AVD78254.1|2354349_2355063_-	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	5.3e-46
AVD78255.1|2355138_2355834_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
AVD78256.1|2356267_2356447_+	hypothetical protein	NA	NA	NA	NA	NA
AVD78257.1|2356518_2357049_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AVD78258.1|2357061_2359308_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	24.6	5.1e-10
AVD78259.1|2359498_2360374_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AVD78260.1|2360380_2361175_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.0	1.9e-116
>prophage 189
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2366655	2382262	4784656	tRNA	Klosneuvirus(16.67%)	9	NA	NA
AVD78266.1|2366655_2369544_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	24.9	2.6e-67
AVD78267.1|2369536_2373082_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.4	5.2e-09
AVD78268.1|2373078_2374908_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	40.8	3.8e-03
AVD78269.1|2375005_2376337_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
AVD78270.1|2376572_2377826_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.4	2.7e-13
AVD78271.1|2378520_2379618_+	murein transglycosylase A	NA	NA	NA	NA	NA
AVD78272.1|2379726_2380533_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	5.0e-16
AVD78273.1|2380610_2381057_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AVD78274.1|2381056_2382262_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.3	1.6e-71
>prophage 190
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2393808	2394564	4784656		Bacillus_phage(100.0%)	1	NA	NA
AVD78287.1|2393808_2394564_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	28.7	2.0e-06
>prophage 191
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2399482	2400331	4784656		Vibrio_phage(100.0%)	1	NA	NA
AVD78291.1|2399482_2400331_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.6	3.6e-41
>prophage 192
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2404856	2413193	4784656		Oenococcus_phage(25.0%)	5	NA	NA
AVD78297.1|2404856_2406197_+	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	24.3	2.0e-06
AVD78298.1|2406217_2407558_+	glucarate dehydratase	NA	NA	NA	NA	NA
AVD78299.1|2407640_2408783_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.0	1.7e-49
AVD78300.1|2409080_2411837_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.7	7.8e-53
AVD78301.1|2411894_2413193_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	2.6e-35
>prophage 193
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2416800	2419824	4784656		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
AVD78305.1|2416800_2418438_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.6	6.7e-153
AVD78306.1|2418525_2419824_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	57.9	1.4e-129
>prophage 194
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2425007	2425679	4784656		Vibrio_phage(100.0%)	1	NA	NA
AVD78312.1|2425007_2425679_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.9e-14
>prophage 195
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2433154	2435187	4784656		Hokovirus(50.0%)	2	NA	NA
AVD78319.1|2433154_2434582_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	25.6	5.1e-32
AVD78320.1|2434581_2435187_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.9	4.7e-27
>prophage 196
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2438359	2441008	4784656		uncultured_Mediterranean_phage(66.67%)	3	NA	NA
AVD78326.1|2438359_2439121_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	46.7	2.5e-57
AVD78327.1|2439114_2439741_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.6	4.4e-36
AVD78328.1|2439880_2441008_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.6	5.0e-06
>prophage 197
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2445129	2447697	4784656		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
AVD78333.1|2445129_2447697_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	1.9e-32
>prophage 198
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2451664	2453869	4784656		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVD78338.1|2451664_2453869_-	type I secretion system permease/ATPase	NA	F2Y1V6	Organic_Lake_phycodnavirus	32.8	1.3e-21
>prophage 199
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2471572	2491480	4784656		Bacillus_phage(33.33%)	15	NA	NA
AVD78346.1|2471572_2473765_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.5	9.1e-12
AVD78347.1|2474375_2476586_+	diguanylate cyclase	NA	NA	NA	NA	NA
AVD78348.1|2476631_2478722_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.0	3.0e-12
AVD78349.1|2478718_2479786_+	protein-glutamate methylesterase	NA	NA	NA	NA	NA
AVD78350.1|2479782_2481195_+	chemotaxis protein CheR	NA	NA	NA	NA	NA
AVD78351.1|2481206_2483339_+	hybrid sensor histidine kinase/response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	37.1	5.7e-11
AVD78352.1|2483361_2483721_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVD78353.1|2483738_2485415_+	response regulator	NA	A0A127AWB9	Bacillus_phage	34.0	2.5e-17
AVD78354.1|2485426_2485951_+	chemotaxis protein	NA	NA	NA	NA	NA
AVD78355.1|2485934_2486294_+	hypothetical protein	NA	NA	NA	NA	NA
AVD78356.1|2486353_2487976_-	serine hydrolase	NA	G1BNF7	Mycobacterium_phage	24.8	1.4e-06
AVD78357.1|2488070_2488793_-	isochorismatase	NA	NA	NA	NA	NA
AVD78358.1|2488956_2489808_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AVD78359.1|2489804_2490662_-	hypothetical protein	NA	NA	NA	NA	NA
AVD78360.1|2490664_2491480_-	manganese/iron transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.1	1.2e-12
>prophage 200
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2519807	2520773	4784656		Tetraselmis_virus(100.0%)	1	NA	NA
AVD78387.1|2519807_2520773_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.6	8.8e-36
>prophage 201
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2526264	2531686	4784656	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
AVD78395.1|2526264_2526762_+	hypothetical protein	NA	B5TK85	Pseudomonas_phage	51.0	2.6e-31
AVD78396.1|2526854_2527919_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	4.0e-114
AVD78397.1|2528005_2528506_+	recombination regulator RecX	NA	NA	NA	NA	NA
AVD78398.1|2528634_2531262_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.8	1.1e-80
AVD78399.1|2531500_2531686_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 202
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2546359	2551656	4784656		Bacillus_virus(20.0%)	5	NA	NA
AVD78412.1|2546359_2547562_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.1	1.9e-27
AVD78413.1|2547916_2548876_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.5	2.9e-132
AVD78414.1|2548886_2551031_-	ribonucleotide-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.4	2.2e-196
AVD78415.1|2551003_2551414_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.0	1.1e-16
AVD78416.1|2551410_2551656_-	NrdH-redoxin	NA	A0A0M7REK7	Lactobacillus_phage	42.5	3.8e-12
>prophage 203
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2557292	2561318	4784656		Clostridioides_phage(50.0%)	5	NA	NA
AVD78426.1|2557292_2557742_+	peptidoglycan-binding protein LysM	NA	A0A1V0DZX0	Clostridioides_phage	38.2	3.7e-05
AVD78427.1|2557754_2558441_-	transcriptional regulator	NA	NA	NA	NA	NA
AVD78428.1|2558486_2559887_-	GABA permease	NA	NA	NA	NA	NA
AVD78429.1|2559861_2560062_-	hypothetical protein	NA	NA	NA	NA	NA
AVD78430.1|2560034_2561318_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	1.6e-29
>prophage 204
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2581615	2586837	4784656		Tetraselmis_virus(50.0%)	5	NA	NA
AVD78448.1|2581615_2582827_+	glycosyltransferase family 1 protein	NA	A0A2P0VNG4	Tetraselmis_virus	32.3	8.5e-12
AVD78449.1|2582828_2583941_+	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVD78450.1|2583943_2584351_+	hypothetical protein	NA	NA	NA	NA	NA
AVD78451.1|2584382_2585774_+	DUF4832 domain-containing protein	NA	NA	NA	NA	NA
AVD78452.1|2585820_2586837_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	46.1	1.0e-79
>prophage 205
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2605535	2608778	4784656		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AVD78467.1|2605535_2608778_+	histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	30.4	5.6e-34
>prophage 206
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2618972	2624797	4784656		Micromonas_sp._RCC1109_virus(50.0%)	5	NA	NA
AVD78476.1|2618972_2620898_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.0	4.3e-26
AVD78477.1|2620907_2621159_+	hypothetical protein	NA	NA	NA	NA	NA
AVD78478.1|2621241_2622228_+	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
AVD78479.1|2622266_2623196_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVD78480.1|2623249_2624797_+	D-xylose ABC transporter ATP-binding protein	NA	M1HXU1	Acanthocystis_turfacea_Chlorella_virus	22.1	7.3e-08
>prophage 207
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2636408	2638595	4784656		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVD78487.1|2636408_2638595_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	29.8	5.5e-17
>prophage 208
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2651895	2652378	4784656		Staphylococcus_phage(100.0%)	1	NA	NA
AVD80574.1|2651895_2652378_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.2e-28
>prophage 209
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2663708	2667265	4784656		Pseudomonas_phage(50.0%)	4	NA	NA
AVD78505.1|2663708_2664935_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	37.0	3.8e-07
AVD78506.1|2664927_2665446_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AVD78507.1|2665604_2665979_-	hypothetical protein	NA	NA	NA	NA	NA
AVD78508.1|2666194_2667265_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	4.5e-89
>prophage 210
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2673218	2675792	4784656		Enterobacteria_phage(100.0%)	1	NA	NA
AVD78515.1|2673218_2675792_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	1.5e-127
>prophage 211
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2682034	2683333	4784656		Burkholderia_virus(100.0%)	1	NA	NA
AVD78516.1|2682034_2683333_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.8	6.9e-44
>prophage 212
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2688632	2694775	4784656	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
AVD78520.1|2688632_2689052_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	36.5	6.3e-15
AVD78521.1|2689259_2690339_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AVD78522.1|2690372_2691062_-	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	49.3	6.0e-55
AVD78523.1|2691379_2691763_+	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	70.9	3.6e-33
AVD78524.1|2691842_2692430_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
AVD80576.1|2692532_2693429_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVD78525.1|2693446_2694775_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.1	2.5e-41
>prophage 213
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2700620	2707601	4784656		Streptococcus_phage(33.33%)	9	NA	NA
AVD78532.1|2700620_2702420_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	3.8e-24
AVD78533.1|2702435_2703410_+	signal peptidase I	NA	NA	NA	NA	NA
AVD78534.1|2703679_2704360_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	1.6e-20
AVD78535.1|2704356_2705262_+	GTPase Era	NA	NA	NA	NA	NA
AVD78536.1|2705274_2705397_+	hypothetical protein	NA	NA	NA	NA	NA
AVD80577.1|2705396_2706107_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AVD78537.1|2706122_2706854_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AVD78538.1|2706853_2707234_+	holo-ACP synthase	NA	NA	NA	NA	NA
AVD78539.1|2707340_2707601_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	1.7e-18
>prophage 214
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2713942	2725281	4784656		Bacillus_phage(50.0%)	7	NA	NA
AVD78546.1|2713942_2717830_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	2.5e-129
AVD80578.1|2718464_2719910_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	25.6	1.2e-12
AVD78547.1|2719932_2720676_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AVD78548.1|2720672_2722010_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	34.1	1.4e-10
AVD78549.1|2722070_2722409_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
AVD78550.1|2722510_2723701_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AVD78551.1|2724027_2725281_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	3.0e-100
>prophage 215
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2743321	2744830	4784656		Bacillus_virus(100.0%)	1	NA	NA
AVD78568.1|2743321_2744830_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.5	3.5e-15
>prophage 216
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2750547	2756902	4784656		Faustovirus(20.0%)	9	NA	NA
AVD78575.1|2750547_2751762_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.6e-34
AVD78576.1|2751787_2752174_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
AVD78577.1|2752194_2752518_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.2e-21
AVD78578.1|2752489_2752687_+	hypothetical protein	NA	NA	NA	NA	NA
AVD78579.1|2752626_2753142_+	co-chaperone HscB	NA	NA	NA	NA	NA
AVD78580.1|2753157_2755008_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.9	1.4e-103
AVD78581.1|2755009_2755345_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AVD78582.1|2755356_2755557_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AVD78583.1|2755618_2756902_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	35.7	1.3e-34
>prophage 217
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2766240	2766672	4784656		Powai_lake_megavirus(100.0%)	1	NA	NA
AVD78588.1|2766240_2766672_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.1	5.3e-17
>prophage 218
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2775616	2781569	4784656		Acinetobacter_phage(33.33%)	5	NA	NA
AVD78597.1|2775616_2777158_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.6	1.1e-160
AVD78598.1|2777221_2778304_+	oxidoreductase	NA	NA	NA	NA	NA
AVD78599.1|2778356_2778572_+	hypothetical protein	NA	NA	NA	NA	NA
AVD78600.1|2778568_2779942_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.0	4.4e-41
AVD78601.1|2780102_2781569_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	5.7e-87
>prophage 219
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2784575	2784779	4784656		Escherichia_phage(100.0%)	1	NA	NA
AVD78603.1|2784575_2784779_-	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	82.9	5.4e-12
>prophage 220
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2791207	2796805	4784656		Prochlorococcus_phage(33.33%)	5	NA	NA
AVD78607.1|2791207_2791849_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.5e-28
AVD78608.1|2791845_2792883_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	42.1	3.1e-71
AVD78609.1|2793178_2794609_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AVD78610.1|2794792_2795419_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AVD78611.1|2795515_2796805_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.4	2.3e-63
>prophage 221
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2806622	2807336	4784656		Cyanophage(100.0%)	1	NA	NA
AVD78623.1|2806622_2807336_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	2.0e-37
>prophage 222
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2843170	2852707	4784656		Paenibacillus_phage(20.0%)	11	NA	NA
AVD78654.1|2843170_2844040_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	33.3	1.5e-18
AVD78655.1|2844252_2844678_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AVD78656.1|2844664_2845114_+	hypothetical protein	NA	NA	NA	NA	NA
AVD78657.1|2845173_2845749_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AVD78658.1|2845842_2846742_+	peroxidase	NA	S4VVJ7	Pandoravirus	32.4	1.5e-24
AVD78659.1|2846914_2847706_+	oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.8	1.2e-17
AVD78660.1|2847863_2848880_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVD78661.1|2848880_2849714_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
AVD78662.1|2849713_2850589_+	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
AVD78663.1|2850578_2851676_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.9	8.2e-30
AVD78664.1|2851795_2852707_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	42.1	3.5e-58
>prophage 223
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2856765	2866638	4784656		Hokovirus(25.0%)	9	NA	NA
AVD78670.1|2856765_2858493_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
AVD78671.1|2858538_2858796_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AVD78672.1|2859179_2860151_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	3.3e-75
AVD78673.1|2860314_2861076_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
AVD78674.1|2861306_2862320_+	cell division protein ZipA	NA	NA	NA	NA	NA
AVD78675.1|2862391_2864407_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.1	2.1e-148
AVD78676.1|2864408_2864627_+	hypothetical protein	NA	NA	NA	NA	NA
AVD78677.1|2864623_2865622_-	hypothetical protein	NA	NA	NA	NA	NA
AVD78678.1|2865711_2866638_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.2	2.2e-07
>prophage 224
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2885965	2886700	4784656		Clostridioides_phage(100.0%)	1	NA	NA
AVD78697.1|2885965_2886700_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.8	1.2e-13
>prophage 225
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2891177	2892098	4784656		Morganella_phage(100.0%)	1	NA	NA
AVD78700.1|2891177_2892098_-	lipid A biosynthesis palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	1.2e-74
>prophage 226
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2900157	2902056	4784656		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVD78707.1|2900157_2902056_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.5	1.9e-13
>prophage 227
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2905207	2914829	4784656		Enterobacteria_phage(50.0%)	7	NA	NA
AVD78711.1|2905207_2905408_-	excisionase	NA	K7P7V0	Enterobacteria_phage	84.8	5.3e-28
AVD78712.1|2905542_2905815_-	hypothetical protein	NA	NA	NA	NA	NA
AVD78713.1|2905855_2906197_-	hypothetical protein	NA	I3PV00	Vibrio_phage	53.3	5.1e-23
AVD78714.1|2906406_2906754_-	protein ninX	NA	Q76H72	Enterobacteria_phage	61.9	2.7e-35
AVD78715.1|2908063_2908312_+	hypothetical protein	NA	F1C5A7	Cronobacter_phage	58.0	9.5e-19
AVD78716.1|2910292_2912236_-	hypothetical protein	NA	A0A1R3Y5Q6	Salmonella_virus	32.7	2.9e-62
AVD78717.1|2913887_2914829_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	89.6	1.3e-148
>prophage 228
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2923968	2925054	4784656		Pandoravirus(100.0%)	1	NA	NA
AVD78727.1|2923968_2925054_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.3	9.1e-90
>prophage 229
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2933557	2934694	4784656		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVD78735.1|2933557_2934694_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	26.6	4.0e-19
>prophage 230
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2941184	2942702	4784656		Mollivirus(100.0%)	1	NA	NA
AVD78744.1|2941184_2942702_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	1.4e-88
>prophage 231
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2947058	2947832	4784656		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AVD80585.1|2947058_2947832_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	27.7	3.6e-08
>prophage 232
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2961628	2962228	4784656		Salmonella_phage(100.0%)	1	NA	NA
AVD78763.1|2961628_2962228_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	3.1e-07
>prophage 233
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2981213	2982218	4784656		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AVD78778.1|2981213_2982218_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.0	1.1e-28
>prophage 234
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	2994902	3002845	4784656	transposase	Tupanvirus(50.0%)	7	NA	NA
AVD78792.1|2994902_2996885_-	bifunctional UDP-glucuronic acid oxidase/UDP-4-amino-4-deoxy-L-arabinose formyltransferase	NA	A0A2K9KZK0	Tupanvirus	25.4	3.7e-20
AVD78793.1|2996881_2997865_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.2	2.9e-34
AVD78794.1|2997867_2999007_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	28.5	1.0e-30
AVD78795.1|2999291_2999717_-	nucleoside triphosphatase NudI	NA	NA	NA	NA	NA
AVD78796.1|3000034_3000577_+	hypothetical protein	NA	NA	NA	NA	NA
AVD78797.1|3000656_3001853_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
AVD78798.1|3001891_3002845_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	55.6	5.6e-67
>prophage 235
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3008725	3022782	4784656		Pseudomonas_phage(33.33%)	9	NA	NA
AVD78803.1|3008725_3009793_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	1.7e-08
AVD78804.1|3009854_3010733_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVD78805.1|3010893_3012084_+	MFS transporter	NA	NA	NA	NA	NA
AVD78806.1|3012087_3012342_-	2Fe-2S ferredoxin	NA	G9IAA2	Pseudomonas_phage	76.1	2.4e-25
AVD78807.1|3012341_3013472_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	2.8e-174
AVD78808.1|3013582_3015868_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.9	7.1e-286
AVD78809.1|3016287_3017016_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
AVD78810.1|3017174_3019814_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.1	1.6e-92
AVD78811.1|3019935_3022782_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.5	1.9e-41
>prophage 236
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3026973	3035506	4784656		Enterobacteria_phage(20.0%)	8	NA	NA
AVD78814.1|3026973_3028074_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.7	3.4e-116
AVD80589.1|3028075_3028279_-	hypothetical protein	NA	NA	NA	NA	NA
AVD78815.1|3028188_3029241_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AVD78816.1|3029320_3030385_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A2P1EL10	Moumouvirus	52.9	2.4e-18
AVD78817.1|3030384_3031035_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	34.7	3.7e-06
AVD78818.1|3031110_3032754_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.2	6.3e-10
AVD78819.1|3032859_3034296_+	magnesium transporter	NA	NA	NA	NA	NA
AVD80590.1|3034258_3035506_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	49.3	3.1e-81
>prophage 237
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3044310	3044931	4784656		Bacillus_virus(100.0%)	1	NA	NA
AVD78828.1|3044310_3044931_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.0	2.8e-11
>prophage 238
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3053895	3062164	4784656		Vibrio_phage(50.0%)	8	NA	NA
AVD78839.1|3053895_3054903_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.6	1.0e-82
AVD78840.1|3054930_3055551_+	hypothetical protein	NA	NA	NA	NA	NA
AVD78841.1|3055658_3055943_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AVD80592.1|3056067_3057828_-	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	41.4	6.0e-99
AVD78842.1|3057979_3058687_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
AVD78843.1|3058702_3059893_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	22.4	1.4e-19
AVD78844.1|3060226_3060571_+	hypothetical protein	NA	NA	NA	NA	NA
AVD78845.1|3060574_3062164_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.4	2.1e-18
>prophage 239
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3067927	3072230	4784656		Bacillus_phage(50.0%)	4	NA	NA
AVD78850.1|3067927_3068497_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	S5MM68	Bacillus_phage	37.6	2.3e-12
AVD78851.1|3068910_3069624_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AVD78852.1|3069657_3070644_-	hypothetical protein	NA	NA	NA	NA	NA
AVD78853.1|3070763_3072230_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	9.0e-40
>prophage 240
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3090088	3090946	4784656		Catovirus(100.0%)	1	NA	NA
AVD78869.1|3090088_3090946_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	32.8	1.3e-22
>prophage 241
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3094994	3099087	4784656		Acinetobacter_phage(50.0%)	4	NA	NA
AVD78875.1|3094994_3096980_-	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	32.6	4.5e-10
AVD78876.1|3097259_3098096_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AVD80593.1|3098023_3098161_-	hypothetical protein	NA	NA	NA	NA	NA
AVD78877.1|3098418_3099087_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	4.1e-56
>prophage 242
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3102792	3104313	4784656		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVD78881.1|3102792_3104313_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.8	3.4e-10
>prophage 243
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3116060	3116795	4784656		Streptococcus_phage(100.0%)	1	NA	NA
AVD78895.1|3116060_3116795_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	43.6	1.1e-51
>prophage 244
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3127633	3136197	4784656	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AVD78903.1|3127633_3128581_+	ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	25.3	1.7e-07
AVD78904.1|3128564_3129296_+	ABC transporter permease	NA	NA	NA	NA	NA
AVD78905.1|3129276_3129384_-	hypothetical protein	NA	NA	NA	NA	NA
AVD78906.1|3129435_3129630_-	hypothetical protein	NA	NA	NA	NA	NA
AVD78907.1|3129583_3130315_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.0e-105
AVD78908.1|3130540_3132226_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	7.4e-280
AVD78909.1|3132222_3132942_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
AVD80595.1|3132988_3133459_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	77.4	1.8e-63
AVD78910.1|3133499_3133958_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	69.3	7.1e-52
AVD78911.1|3134163_3136197_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	8.9e-54
>prophage 245
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3147198	3151702	4784656		Serratia_phage(50.0%)	4	NA	NA
AVD78923.1|3147198_3148203_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	28.1	1.4e-12
AVD78924.1|3148199_3149477_-	MFS transporter	NA	NA	NA	NA	NA
AVD78925.1|3149729_3150782_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AVD78926.1|3150802_3151702_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	27.8	1.2e-10
>prophage 246
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3154965	3157168	4784656		Planktothrix_phage(50.0%)	3	NA	NA
AVD78931.1|3154965_3155694_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.0	1.1e-27
AVD78932.1|3155919_3156435_-	lipoprotein	NA	NA	NA	NA	NA
AVD78933.1|3156955_3157168_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	74.3	2.7e-22
>prophage 247
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3162519	3164238	4784656		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
AVD78938.1|3162519_3164238_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.8	1.5e-30
>prophage 248
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3175592	3180789	4784656	protease	Planktothrix_phage(25.0%)	4	NA	NA
AVD78948.1|3175592_3177539_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.8	1.4e-40
AVD78949.1|3177613_3177838_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
AVD78950.1|3178161_3178482_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
AVD78951.1|3178512_3180789_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
>prophage 249
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3184822	3193416	4784656		Bacillus_phage(50.0%)	6	NA	NA
AVD78953.1|3184822_3186184_-	U32 family peptidase	NA	Q6DW11	Phage_TP	92.6	5.3e-204
AVD78954.1|3186343_3186676_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AVD78955.1|3186804_3187527_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
AVD78956.1|3187523_3188927_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	29.2	2.3e-32
AVD78957.1|3188926_3190339_-	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
AVD78958.1|3190335_3193416_-	multidrug transporter subunit MdtC	NA	S5VTK5	Leptospira_phage	22.6	1.7e-64
>prophage 250
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3204195	3214833	4784656		Catovirus(20.0%)	9	NA	NA
AVD78964.1|3204195_3204837_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.3	2.2e-35
AVD78965.1|3204928_3205510_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	4.2e-33
AVD78966.1|3205536_3207390_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AVD78967.1|3207434_3209018_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.9	1.2e-37
AVD78968.1|3209673_3210813_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
AVD78969.1|3210818_3211268_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
AVD78970.1|3211264_3213427_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.8	3.7e-18
AVD78971.1|3213499_3214342_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	NA	NA	NA	NA
AVD78972.1|3214344_3214833_+	colanic acid biosynthesis acetyltransferase WcaB	NA	A0A191KBJ5	Streptococcus_virus	41.0	9.3e-10
>prophage 251
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3218579	3225315	4784656		Synechococcus_phage(25.0%)	6	NA	NA
AVD78977.1|3218579_3219701_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	2.0e-132
AVD78978.1|3219703_3220669_+	GDP-fucose synthetase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	50.3	1.7e-87
AVD78979.1|3220671_3221151_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AVD78980.1|3221147_3222374_+	colanic acid biosynthesis glycosyltransferase WcaI	NA	NA	NA	NA	NA
AVD80599.1|3222373_3223810_+	mannose-1-phosphate guanylyltransferase ManC	NA	A0A1V0SH58	Hokovirus	31.9	4.1e-53
AVD78981.1|3223944_3225315_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.6	9.3e-31
>prophage 252
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3230776	3238970	4784656		Enterobacteria_phage(42.86%)	8	NA	NA
AVD78986.1|3230776_3232171_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	35.0	5.5e-23
AVD78987.1|3232336_3233230_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	39.7	1.6e-44
AVD78988.1|3233599_3234685_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	4.4e-100
AVD78989.1|3234684_3235584_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	35.3	1.0e-30
AVD78990.1|3235635_3236514_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	63.4	1.6e-105
AVD78991.1|3236518_3237067_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	55.6	1.2e-50
AVD78992.1|3237109_3238255_+	hypothetical protein	NA	NA	NA	NA	NA
AVD78993.1|3238187_3238970_+	hypothetical protein	NA	A0A0F7L2F7	uncultured_marine_virus	32.4	8.2e-08
>prophage 253
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3242364	3245174	4784656		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
AVD78997.1|3242364_3243771_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	1.8e-37
AVD78998.1|3244007_3245174_+	UDP-glucose 6-dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	54.0	2.8e-113
>prophage 254
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3252988	3253888	4784656		Cellulophaga_phage(100.0%)	1	NA	NA
AVD79008.1|3252988_3253888_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	97.4	4.8e-12
>prophage 255
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3261851	3264506	4784656		Escherichia_phage(50.0%)	3	NA	NA
AVD79014.1|3261851_3262430_+	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	38.0	1.6e-21
AVD79015.1|3262426_3263194_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
AVD79016.1|3263333_3264506_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	86.7	1.1e-197
>prophage 256
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3284163	3284973	4784656		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVD79041.1|3284163_3284973_+	propanediol diffusion facilitator PduF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.8	1.7e-11
>prophage 257
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3298467	3299283	4784656		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AVD79058.1|3298467_3299283_+	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.2	2.5e-07
>prophage 258
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3304252	3304936	4784656		Bacillus_virus(100.0%)	1	NA	NA
AVD79064.1|3304252_3304936_-	ABC transporter	NA	G3M9Y6	Bacillus_virus	32.7	3.1e-27
>prophage 259
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3309139	3321456	4784656	integrase	Salmonella_phage(27.27%)	16	3308768:3308781	3331477:3331490
3308768:3308781	attL	GGCGATAAGCCTGG	NA	NA	NA	NA
AVD79068.1|3309139_3310183_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	55.5	1.8e-98
AVD79069.1|3310157_3310400_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AVD79070.1|3311724_3312315_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	77.5	3.5e-67
AVD79071.1|3312438_3312792_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	4.8e-24
AVD79072.1|3312839_3313202_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AVD79073.1|3313219_3314971_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AVD79074.1|3315018_3316308_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.7	2.7e-173
AVD79075.1|3316320_3316746_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	3.3e-51
AVD79076.1|3316812_3317109_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AVD79077.1|3317209_3318301_+	hypothetical protein	NA	NA	NA	NA	NA
AVD79078.1|3318583_3318817_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	83.1	2.7e-31
AVD79079.1|3318862_3319108_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	62.2	1.3e-20
AVD79080.1|3319237_3319438_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	61.5	1.9e-17
AVD79081.1|3319440_3319800_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	64.4	4.0e-42
AVD79082.1|3319796_3320837_+	hypothetical protein	NA	S5MW46	Escherichia_phage	50.4	2.1e-96
AVD79083.1|3320850_3321456_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	72.1	5.6e-81
3331477:3331490	attR	CCAGGCTTATCGCC	NA	NA	NA	NA
>prophage 260
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3324535	3332060	4784656		Burkholderia_phage(40.0%)	6	NA	NA
AVD79086.1|3324535_3325069_+	hypothetical protein	NA	A0A291LC16	Salmonella_phage	62.8	4.4e-53
AVD79087.1|3325610_3327170_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AVD79088.1|3327771_3328971_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.7	3.6e-111
AVD79089.1|3329412_3330105_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.5	2.1e-07
AVD79090.1|3330181_3331612_+	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	55.2	2.5e-103
AVD79091.1|3331592_3332060_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.3e-32
>prophage 261
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3360103	3360856	4784656		Bacillus_virus(100.0%)	1	NA	NA
AVD79126.1|3360103_3360856_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	6.4e-26
>prophage 262
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3366226	3404155	4784656	protease,portal,capsid,tail,head,holin,terminase,integrase	Salmonella_phage(27.45%)	56	3366045:3366104	3404342:3404465
3366045:3366104	attL	GATTTAAAATCCCTCGGCGTTCGCGCTGTGTGGGTTCAAGTCCCACTCCGGGTACCATGG	NA	NA	NA	NA
AVD79132.1|3366226_3367237_-|integrase	integrase	integrase	K7PLZ2	Enterobacterial_phage	87.5	9.5e-174
AVD79133.1|3367236_3367464_-	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	88.0	4.6e-36
AVD79134.1|3367497_3367776_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	60.7	6.7e-21
AVD79135.1|3367849_3368065_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	1.7e-08
AVD79136.1|3368061_3368466_-	hypothetical protein	NA	G5DA83	Enterobacteria_phage	37.0	7.2e-08
AVD80601.1|3368967_3369276_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	73.9	3.8e-33
AVD79137.1|3369280_3369694_-	hypothetical protein	NA	I6RSM9	Salmonella_phage	76.6	3.8e-20
AVD79138.1|3369677_3370718_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	87.8	7.7e-163
AVD79139.1|3370717_3371131_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	72.1	6.8e-46
AVD79140.1|3371178_3371616_-	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	42.8	6.2e-29
AVD79141.1|3372503_3372710_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	1.6e-16
AVD79142.1|3372748_3373099_-	hypothetical protein	NA	NA	NA	NA	NA
AVD79143.1|3373098_3373533_-	hypothetical protein	NA	NA	NA	NA	NA
AVD79144.1|3373549_3374302_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	55.8	1.5e-75
AVD79145.1|3374336_3374588_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	52.2	2.7e-13
AVD79146.1|3374616_3375171_+	hypothetical protein	NA	U5P4K1	Shigella_phage	51.9	2.9e-47
AVD79147.1|3375334_3375541_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.9	1.2e-14
AVD79148.1|3375503_3376424_+	transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	84.1	4.7e-63
AVD79149.1|3376426_3376870_+	hypothetical protein	NA	U5P0U0	Shigella_phage	30.4	1.4e-12
AVD79150.1|3377211_3377601_+	hypothetical protein	NA	A5LH74	Enterobacteria_phage	66.7	2.7e-44
AVD79151.1|3377617_3378343_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	53.5	1.5e-56
AVD79152.1|3378339_3379329_+	hypothetical protein	NA	K7PJS6	Enterobacterial_phage	70.8	1.9e-142
AVD79153.1|3379343_3379922_+	hypothetical protein	NA	A0A0U2S606	Escherichia_phage	54.4	3.3e-46
AVD79154.1|3380180_3380477_+	hypothetical protein	NA	NA	NA	NA	NA
AVD79155.1|3380488_3380992_+	hypothetical protein	NA	NA	NA	NA	NA
AVD79156.1|3381091_3381478_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	92.2	1.0e-56
AVD79157.1|3381464_3381746_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	47.1	7.0e-18
AVD79158.1|3381745_3382360_+	endolysin	NA	Q8HA86	Salmonella_phage	81.9	8.5e-93
AVD79159.1|3382367_3382637_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	69.0	1.7e-21
AVD79160.1|3382587_3382770_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	67.2	9.4e-16
AVD79161.1|3382876_3383233_-	hypothetical protein	NA	NA	NA	NA	NA
AVD79162.1|3383423_3383774_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	77.2	3.3e-49
AVD79163.1|3383930_3384404_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	88.5	3.9e-77
AVD79164.1|3384403_3386161_+|terminase	terminase	terminase	A0A1B5FP96	Escherichia_phage	90.3	0.0e+00
AVD79165.1|3386308_3387535_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	86.5	9.0e-211
AVD79166.1|3387527_3388127_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	83.0	7.8e-91
AVD79167.1|3388136_3389354_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	75.8	1.2e-170
AVD79168.1|3389431_3389752_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	53.9	2.8e-23
AVD79169.1|3389761_3390100_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	69.6	1.7e-39
AVD79170.1|3390096_3390546_+	hypothetical protein	NA	S4TR46	Salmonella_phage	85.9	1.4e-65
AVD79171.1|3390542_3390890_+	DUF3168 domain-containing protein	NA	A0A220NRP0	Escherichia_phage	74.8	7.0e-44
AVD79172.1|3390947_3391652_+|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	74.4	5.7e-93
AVD79173.1|3391679_3392051_+|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	86.8	1.9e-55
AVD79174.1|3392062_3392353_+|tail	phage tail protein	tail	S4TND7	Salmonella_phage	90.6	1.8e-40
AVD79175.1|3392411_3392591_+	hypothetical protein	NA	K7PH36	Enterobacterial_phage	84.7	6.2e-20
AVD79176.1|3392636_3395921_+|tail	phage tail tape measure protein	tail	K7PKG1	Enterobacteria_phage	70.5	0.0e+00
AVD79177.1|3396073_3396289_-	hypothetical protein	NA	H6WRW0	Salmonella_phage	57.6	2.2e-11
AVD79178.1|3396459_3397053_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	97.0	6.3e-109
AVD79179.1|3397052_3397637_+	hypothetical protein	NA	S4TND4	Salmonella_phage	95.4	2.3e-103
AVD79180.1|3397643_3398042_+	hypothetical protein	NA	S4TR39	Salmonella_phage	93.9	2.5e-69
AVD79181.1|3398041_3400756_+|tail	phage tail protein	tail	S4TTF5	Salmonella_phage	90.7	0.0e+00
AVD79182.1|3400755_3401700_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	67.1	1.6e-119
AVD79183.1|3401709_3403068_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	50.5	4.3e-113
AVD79184.1|3403202_3403445_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	79.2	1.2e-29
AVD79185.1|3403520_3403763_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	54.4	3.8e-20
AVD79186.1|3403765_3404155_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.1	7.8e-52
3404342:3404465	attR	GATTTAAAATCCCTCGGCGTTCGCGCTGTGTGGGTTCAAGTCCCACTCCGGGTACCATGGGAAAGAACAGAATAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTACGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 263
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3417827	3419342	4784656		Cedratvirus(100.0%)	1	NA	NA
AVD79204.1|3417827_3419342_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.2	1.3e-12
>prophage 264
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3431125	3436771	4784656		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
AVD79216.1|3431125_3432781_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.8	1.6e-08
AVD79217.1|3432824_3434426_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.1	1.1e-11
AVD79218.1|3434445_3435318_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AVD79219.1|3435314_3436364_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	1.8e-05
AVD79220.1|3436381_3436771_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	1.3e-06
>prophage 265
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3444783	3451443	4784656	tRNA	Tupanvirus(33.33%)	7	NA	NA
AVD79227.1|3444783_3446517_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	2.2e-85
AVD79228.1|3446755_3447322_+	VOC family protein	NA	NA	NA	NA	NA
AVD79229.1|3447324_3448071_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AVD79230.1|3448305_3449274_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AVD79231.1|3449270_3450014_-|tRNA	tRNA (cmo5U34)-methyltransferase	tRNA	F5B419	Synechococcus_phage	31.3	2.4e-25
AVD79232.1|3450054_3450450_-	hypothetical protein	NA	NA	NA	NA	NA
AVD79233.1|3450624_3451443_-	hypothetical protein	NA	Q859D1	Escherichia_coli_phage	80.3	4.5e-57
>prophage 266
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3455317	3461524	4784656		Bacillus_virus(50.0%)	7	NA	NA
AVD79238.1|3455317_3455839_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
AVD79239.1|3455919_3456531_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AVD79240.1|3456539_3457550_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.4	1.6e-08
AVD79241.1|3457628_3458414_-	zinc ABC transporter permease	NA	NA	NA	NA	NA
AVD79242.1|3458410_3459166_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	6.5e-18
AVD79243.1|3459229_3460189_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVD79244.1|3460204_3461524_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.5e-14
>prophage 267
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3465457	3466933	4784656		Cyanophage(100.0%)	1	NA	NA
AVD79249.1|3465457_3466933_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	1.9e-77
>prophage 268
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3472614	3479170	4784656		Organic_Lake_phycodnavirus(25.0%)	8	NA	NA
AVD79256.1|3472614_3474693_+	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	36.3	6.3e-31
AVD79257.1|3474683_3475346_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	31.1	9.1e-08
AVD79258.1|3475369_3476026_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AVD79259.1|3476132_3476363_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
AVD79260.1|3476506_3476881_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AVD79261.1|3476884_3477757_+	hypothetical protein	NA	NA	NA	NA	NA
AVD79262.1|3477777_3478116_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AVD79263.1|3478528_3479170_+	protein-serine/threonine phosphatase	NA	Q71TJ1	Escherichia_phage	50.2	7.8e-57
>prophage 269
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3486616	3488665	4784656		Moraxella_phage(100.0%)	1	NA	NA
AVD79271.1|3486616_3488665_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	6.1e-87
>prophage 270
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3493939	3494149	4784656		Morganella_phage(100.0%)	1	NA	NA
AVD79279.1|3493939_3494149_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 271
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3501647	3503207	4784656		Moraxella_phage(100.0%)	1	NA	NA
AVD79288.1|3501647_3503207_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	5.1e-41
>prophage 272
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3507075	3514426	4784656	tRNA	Pandoravirus(25.0%)	7	NA	NA
AVD79292.1|3507075_3508440_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	32.5	4.0e-42
AVD79293.1|3508520_3508700_+	YoaH family protein	NA	NA	NA	NA	NA
AVD79294.1|3508706_3509051_-	RidA family protein	NA	NA	NA	NA	NA
AVD79295.1|3509192_3511103_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.1	9.1e-93
AVD79296.1|3511161_3511857_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	A0A0R6PI74	Moraxella_phage	35.4	5.8e-05
AVD79297.1|3511951_3512536_+	hypothetical protein	NA	NA	NA	NA	NA
AVD79298.1|3512674_3514426_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	2.7e-35
>prophage 273
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3542623	3543385	4784656		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVD79324.1|3542623_3543385_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.1	4.4e-14
>prophage 274
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3557457	3558189	4784656		Enterobacteria_phage(100.0%)	1	NA	NA
AVD79336.1|3557457_3558189_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.3	3.2e-54
>prophage 275
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3571109	3576826	4784656		Klosneuvirus(33.33%)	4	NA	NA
AVD79350.1|3571109_3572495_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.2	1.3e-27
AVD79351.1|3572510_3573974_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AVD79352.1|3574071_3575754_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	22.7	8.2e-21
AVD80605.1|3575878_3576826_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
>prophage 276
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3580076	3584083	4784656		Pseudomonas_phage(50.0%)	5	NA	NA
AVD79356.1|3580076_3581159_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	38.8	4.3e-07
AVD79357.1|3581158_3581992_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVD79358.1|3581988_3582381_+	hypothetical protein	NA	NA	NA	NA	NA
AVD79359.1|3582383_3583193_+	hypothetical protein	NA	NA	NA	NA	NA
AVD79360.1|3583228_3584083_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.8	2.4e-45
>prophage 277
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3587503	3587734	4784656		Mythimna_unipuncta_granulovirus(100.0%)	1	NA	NA
AVD79364.1|3587503_3587734_+	cation transport regulator	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	46.1	9.1e-08
>prophage 278
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3593165	3593954	4784656		Bacillus_virus(100.0%)	1	NA	NA
AVD79371.1|3593165_3593954_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.6	2.6e-30
>prophage 279
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3610442	3620522	4784656		Escherichia_phage(25.0%)	10	NA	NA
AVD79378.1|3610442_3611981_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.5	1.8e-19
AVD79379.1|3611977_3612688_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
AVD79380.1|3612687_3613365_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
AVD79381.1|3614149_3614992_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	48.8	9.8e-15
AVD79382.1|3615047_3615503_-	hypothetical protein	NA	NA	NA	NA	NA
AVD79383.1|3615614_3616526_+	patatin family protein	NA	NA	NA	NA	NA
AVD79384.1|3616616_3617630_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
AVD79385.1|3617834_3618743_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	47.5	3.7e-60
AVD79386.1|3618880_3619294_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
AVD79387.1|3619904_3620522_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	54.3	1.1e-52
>prophage 280
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3629062	3684002	4784656	tail,head,holin,terminase,coat,integrase	Enterobacteria_phage(34.62%)	72	3619240:3619254	3664537:3664551
3619240:3619254	attL	TTGCCTGCGCACGAA	NA	NA	NA	NA
AVD79394.1|3629062_3630076_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	4.5e-14
AVD79395.1|3630072_3631077_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.2	6.8e-15
AVD79396.1|3631122_3631959_+	transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	1.4e-08
AVD79397.1|3631996_3632326_-	dsDNA-mimic protein	NA	NA	NA	NA	NA
AVD79398.1|3632360_3633821_-	cardiolipin synthase	NA	NA	NA	NA	NA
AVD79399.1|3633963_3634137_+	hypothetical protein	NA	NA	NA	NA	NA
AVD79400.1|3634391_3635585_+|integrase	integrase	integrase	K7PGY1	Enterobacteria_phage	84.1	2.6e-202
AVD79401.1|3635577_3635778_-	excisionase	NA	K7PM28	Enterobacteria_phage	82.5	1.9e-25
AVD79402.1|3635823_3636066_-	DUF4060 domain-containing protein	NA	K7PHF4	Enterobacteria_phage	82.3	2.6e-29
AVD79403.1|3636105_3637146_-	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	75.9	2.0e-155
AVD79404.1|3637160_3640010_-	exodeoxyribonuclease VIII	NA	K7P6V4	Enterobacteria_phage	60.9	4.4e-293
AVD80609.1|3640149_3640311_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	92.5	3.5e-22
AVD79405.1|3640318_3640516_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVD79406.1|3640515_3640716_-	hypothetical protein	NA	NA	NA	NA	NA
AVD79407.1|3640991_3641285_+	hypothetical protein	NA	NA	NA	NA	NA
AVD79408.1|3641754_3641979_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	63.2	5.7e-15
AVD79409.1|3642010_3642391_-	hypothetical protein	NA	NA	NA	NA	NA
AVD79410.1|3642480_3643395_-	hypothetical protein	NA	NA	NA	NA	NA
AVD79411.1|3643584_3644283_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	79.3	1.0e-102
AVD79412.1|3644393_3644615_+	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	67.6	8.2e-22
AVD79413.1|3644640_3645180_+	regulator	NA	K7PJT7	Enterobacteria_phage	86.0	8.5e-81
AVD79414.1|3645347_3646295_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	33.0	1.8e-25
AVD79415.1|3646297_3647047_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	87.1	5.3e-121
AVD79416.1|3647065_3647377_+	hypothetical protein	NA	NA	NA	NA	NA
AVD79417.1|3647373_3647859_+	SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.1	8.8e-69
AVD79418.1|3648391_3649159_+	hypothetical protein	NA	NA	NA	NA	NA
AVD79419.1|3649155_3649554_+	hypothetical protein	NA	NA	NA	NA	NA
AVD79420.1|3650258_3650516_+	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	77.3	4.6e-24
AVD79421.1|3650515_3650770_+	hypothetical protein	NA	NA	NA	NA	NA
AVD79422.1|3650871_3651471_+	DUF1367 domain-containing protein	NA	K7PKS6	Enterobacteria_phage	97.0	2.9e-106
AVD79423.1|3651470_3651677_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	72.1	1.8e-23
AVD79424.1|3651679_3652288_+	protein NinG	NA	A0A0M4RU10	Salmonella_phage	61.8	7.0e-47
AVD79425.1|3652284_3652422_+	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	88.4	1.2e-15
AVD79426.1|3652418_3653108_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.2	3.3e-61
AVD79427.1|3653362_3653902_+	hypothetical protein	NA	NA	NA	NA	NA
AVD79428.1|3654100_3654289_+	hypothetical protein	NA	NA	NA	NA	NA
AVD79429.1|3654635_3654914_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	97.8	3.3e-44
AVD79430.1|3654885_3655434_+	lysozyme	NA	K7PM52	Enterobacteria_phage	94.5	3.2e-99
AVD79431.1|3655430_3655964_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	50.0	3.0e-09
AVD79432.1|3655967_3656183_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
AVD79433.1|3656422_3656809_-	hypothetical protein	NA	NA	NA	NA	NA
AVD80610.1|3656882_3657527_+	hypothetical protein	NA	I6S676	Salmonella_phage	89.5	2.1e-110
AVD79434.1|3657558_3658047_+	hypothetical protein	NA	I6S1P9	Salmonella_phage	75.6	2.5e-47
AVD79435.1|3658043_3659591_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	86.9	2.5e-282
AVD79436.1|3659602_3661054_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	67.0	2.6e-177
AVD79437.1|3661091_3661988_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	66.1	5.2e-107
AVD79438.1|3662005_3663394_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	69.4	2.6e-166
AVD79439.1|3663397_3663838_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	65.1	2.0e-43
AVD79440.1|3663848_3664925_+|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	75.1	3.4e-153
3664537:3664551	attR	TTCGTGCGCAGGCAA	NA	NA	NA	NA
AVD79441.1|3664934_3665300_+	hypothetical protein	NA	NA	NA	NA	NA
AVD79442.1|3665302_3665683_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	7.5e-31
AVD79443.1|3665682_3665853_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AVD79444.1|3665856_3666219_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	61.7	5.1e-37
AVD79445.1|3666208_3666577_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	75.4	1.8e-45
AVD79446.1|3666573_3666957_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	62.2	7.5e-39
AVD79447.1|3667019_3667763_+	DNA breaking-rejoining protein	NA	F1C5E5	Cronobacter_phage	82.9	1.2e-72
AVD79448.1|3667821_3668514_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	60.8	1.9e-72
AVD79449.1|3668655_3668931_+	cor protein	NA	Q5G8V7	Enterobacteria_phage	67.5	1.2e-22
AVD79450.1|3669064_3669736_+	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	48.5	1.3e-46
AVD79451.1|3669801_3673134_+	hypothetical protein	NA	Q5G8W8	Enterobacteria_phage	85.4	0.0e+00
AVD79452.1|3673136_3673487_+|tail	phage tail protein	tail	I6RSL7	Salmonella_phage	87.1	2.6e-54
AVD79453.1|3673483_3673771_+	hypothetical protein	NA	NA	NA	NA	NA
AVD79454.1|3673813_3674518_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	97.4	6.0e-135
AVD79455.1|3674517_3675237_+|tail	phage tail protein	tail	Q5G8W2	Enterobacteria_phage	83.7	5.8e-125
AVD79456.1|3675179_3675707_+|tail	phage tail protein	tail	I6RSM0	Salmonella_phage	78.1	2.4e-56
AVD79457.1|3675716_3678899_+	hypothetical protein	NA	A0A1V0E5M1	Salmonella_phage	91.7	0.0e+00
AVD79458.1|3678898_3679843_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	68.0	6.7e-121
AVD79459.1|3679852_3681217_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	50.5	6.7e-114
AVD79460.1|3681351_3681594_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	4.4e-29
AVD79461.1|3681672_3682062_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.1	1.0e-51
AVD79462.1|3682755_3683076_-	hypothetical protein	NA	NA	NA	NA	NA
AVD79463.1|3683330_3684002_-	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	1.5e-79
>prophage 281
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3690618	3697091	4784656		Acinetobacter_phage(66.67%)	5	NA	NA
AVD79471.1|3690618_3692091_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.4	1.1e-16
AVD79472.1|3692123_3692930_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AVD79473.1|3692929_3694123_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AVD80612.1|3694133_3695492_-	bifunctional indole-3-glycerol phosphate synthase/phosphoribosylanthranilate isomerase	NA	A0A0P0IR83	Acinetobacter_phage	40.7	1.0e-37
AVD79474.1|3695495_3697091_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.6	3.2e-51
>prophage 282
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3702069	3707455	4784656	protease	Chrysochromulina_ericina_virus(50.0%)	4	NA	NA
AVD79480.1|3702069_3702831_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	5.2e-07
AVD79481.1|3703052_3704099_+|protease	protease SohB	protease	NA	NA	NA	NA
AVD79482.1|3704207_3704459_-	hypothetical protein	NA	NA	NA	NA	NA
AVD79483.1|3704857_3707455_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	35.0	1.3e-86
>prophage 283
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3712296	3712887	4784656		Staphylococcus_phage(100.0%)	1	NA	NA
AVD79487.1|3712296_3712887_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	7.7e-43
>prophage 284
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3720792	3722727	4784656		Bodo_saltans_virus(100.0%)	1	NA	NA
AVD79498.1|3720792_3722727_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.5	4.5e-07
>prophage 285
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3726138	3727939	4784656		Bacillus_virus(50.0%)	2	NA	NA
AVD79502.1|3726138_3726945_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	1.3e-13
AVD79503.1|3726946_3727939_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	24.7	4.7e-08
>prophage 286
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3746368	3749980	4784656		Escherichia_phage(50.0%)	5	NA	NA
AVD79523.1|3746368_3747139_-	decarboxylase	NA	A0A077SK06	Escherichia_phage	29.1	2.3e-18
AVD79524.1|3747259_3747643_+	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
AVD79525.1|3747814_3748444_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AVD79526.1|3748476_3748884_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AVD79527.1|3748927_3749980_+	hydroxyacid dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	46.7	2.0e-86
>prophage 287
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3753653	3766996	4784656	tRNA	Streptococcus_phage(11.11%)	13	NA	NA
AVD79532.1|3753653_3754169_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	7.0e-24
AVD79533.1|3754394_3754958_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
AVD79534.1|3754970_3756203_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.0	6.9e-17
AVD79535.1|3756270_3758385_-	hypothetical protein	NA	G3MA91	Bacillus_virus	31.5	1.2e-16
AVD79536.1|3758796_3759906_+	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.9	1.6e-09
AVD79537.1|3760060_3761044_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AVD79538.1|3761319_3761487_+	hypothetical protein	NA	NA	NA	NA	NA
AVD79539.1|3761515_3762889_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.3e-52
AVD79540.1|3762967_3763903_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.5	9.8e-141
AVD79541.1|3764537_3764780_-	DNA-damage-inducible protein I	NA	Q6UAW0	Klebsiella_phage	77.9	3.4e-29
AVD79542.1|3764965_3765400_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	1.2e-29
AVD79543.1|3765481_3765694_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
AVD79544.1|3765841_3766996_-	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	57.0	7.4e-114
>prophage 288
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3771975	3772965	4784656		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVD79548.1|3771975_3772965_-	2-hydroxyacid dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	42.5	2.8e-69
>prophage 289
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3777909	3781812	4784656		Klosneuvirus(100.0%)	1	NA	NA
AVD79555.1|3777909_3781812_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	7.6e-54
>prophage 290
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3786613	3795425	4784656		Escherichia_phage(57.14%)	12	NA	NA
AVD79560.1|3786613_3787144_+	cytochrome B	NA	A0A0U2QLA7	Escherichia_phage	43.0	4.5e-18
AVD79561.1|3787182_3788109_-	EamA family transporter	NA	NA	NA	NA	NA
AVD79562.1|3788369_3788789_+	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	58.3	1.4e-33
AVD79563.1|3788791_3790060_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	78.6	4.5e-197
AVD79564.1|3790209_3791256_+	porin OmpA	NA	NA	NA	NA	NA
AVD79565.1|3791441_3792230_+	hypothetical protein	NA	NA	NA	NA	NA
AVD79566.1|3792269_3792554_-	hypothetical protein	NA	A0A0U2JGI6	Escherichia_phage	57.4	3.0e-24
AVD79567.1|3792696_3793062_+	hypothetical protein	NA	NA	NA	NA	NA
AVD79568.1|3793580_3793781_+	hypothetical protein	NA	NA	NA	NA	NA
AVD80616.1|3793855_3794434_+	hypothetical protein	NA	A0A0U2RT94	Escherichia_phage	48.2	9.3e-49
AVD79569.1|3794430_3794727_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.6	1.9e-37
AVD79570.1|3794726_3795425_+	antitermination protein	NA	Q7Y3X2	Yersinia_phage	32.1	2.3e-17
>prophage 291
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3798602	3804428	4784656		Escherichia_phage(25.0%)	8	NA	NA
AVD79575.1|3798602_3799082_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	66.7	2.2e-56
AVD79576.1|3799088_3799280_+	hypothetical protein	NA	NA	NA	NA	NA
AVD79577.1|3799390_3799825_+	hypothetical protein	NA	NA	NA	NA	NA
AVD79578.1|3800045_3800498_-	hypothetical protein	NA	NA	NA	NA	NA
AVD79579.1|3800738_3800930_+	hypothetical protein	NA	M4SQC2	Psychrobacter_phage	55.4	2.5e-11
AVD79580.1|3801143_3801419_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
AVD79581.1|3801451_3802570_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.6	3.6e-33
AVD79582.1|3802739_3804428_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	2.1e-16
>prophage 292
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3819671	3821633	4784656	protease	Phage_TP(100.0%)	1	NA	NA
AVD79597.1|3819671_3821633_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.4	2.4e-24
>prophage 293
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3828854	3829871	4784656		Mycoplasma_phage(100.0%)	1	NA	NA
AVD79604.1|3828854_3829871_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	58.9	2.5e-25
>prophage 294
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3847221	3849342	4784656		Salmonella_phage(100.0%)	1	NA	NA
AVD79620.1|3847221_3849342_-	TonB-dependent siderophore receptor	NA	A0A1B0VCF0	Salmonella_phage	68.2	2.5e-139
>prophage 295
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3852784	3854326	4784656		Salmonella_phage(100.0%)	1	NA	NA
AVD79624.1|3852784_3854326_-	hypothetical protein	NA	A0A1B0V854	Salmonella_phage	55.4	8.3e-36
>prophage 296
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3860684	3861458	4784656		Bacillus_virus(100.0%)	1	NA	NA
AVD79631.1|3860684_3861458_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	6.0e-19
>prophage 297
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3868509	3870486	4784656		Tetraselmis_virus(100.0%)	1	NA	NA
AVD79639.1|3868509_3870486_-	hypothetical protein	NA	A0A2P0VMX1	Tetraselmis_virus	45.8	2.1e-161
>prophage 298
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3874698	3876243	4784656		Escherichia_phage(100.0%)	1	NA	NA
AVD79645.1|3874698_3876243_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.1e-19
>prophage 299
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3884382	3885471	4784656		Enterobacteria_phage(100.0%)	1	NA	NA
AVD79650.1|3884382_3885471_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	72.9	1.5e-148
>prophage 300
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3891825	3894966	4784656		Escherichia_phage(50.0%)	4	NA	NA
AVD79656.1|3891825_3892428_+	pyrophosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.9	1.5e-22
AVD79657.1|3892467_3892752_-	addiction module antidote protein, HigA family	NA	A0A2L1IV52	Escherichia_phage	48.9	4.4e-20
AVD80620.1|3892751_3893030_-	Killer protein	NA	A0A2L1IV28	Escherichia_phage	59.8	3.1e-26
AVD79658.1|3893250_3894966_-	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	26.3	3.7e-37
>prophage 301
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3904804	3906719	4784656		Planktothrix_phage(100.0%)	2	NA	NA
AVD79669.1|3904804_3905740_-	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	7.0e-14
AVD79670.1|3905732_3906719_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.5	7.2e-17
>prophage 302
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3912608	3914552	4784656		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVD79677.1|3912608_3914552_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.9	5.0e-06
>prophage 303
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3920009	3921749	4784656		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVD79683.1|3920009_3921749_-	type I secretion system permease/ATPase	NA	F2Y1V6	Organic_Lake_phycodnavirus	29.8	7.7e-14
>prophage 304
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3930527	3932510	4784656		Tetraselmis_virus(100.0%)	1	NA	NA
AVD79687.1|3930527_3932510_+	hypothetical protein	NA	A0A2P0VMX1	Tetraselmis_virus	45.2	7.6e-159
>prophage 305
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3963878	3964268	4784656		Streptococcus_phage(100.0%)	1	NA	NA
AVD79716.1|3963878_3964268_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.8e-09
>prophage 306
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3967686	3969192	4784656		Staphylococcus_phage(50.0%)	2	NA	NA
AVD79720.1|3967686_3968385_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	4.4e-13
AVD79721.1|3968394_3969192_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A285PWH2	Cedratvirus	27.5	2.1e-11
>prophage 307
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3974020	3974947	4784656		Bacillus_phage(100.0%)	1	NA	NA
AVD79726.1|3974020_3974947_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.3	3.6e-18
>prophage 308
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3979475	3984425	4784656		Salmonella_phage(25.0%)	5	NA	NA
AVD79731.1|3979475_3979679_+	selenoprotein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.9e-13
AVD79732.1|3979753_3981220_-	D-mannonate oxidoreductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.9	1.9e-45
AVD79733.1|3981381_3982716_-	MFS transporter	NA	NA	NA	NA	NA
AVD79734.1|3982776_3983991_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.2	7.4e-48
AVD79735.1|3984098_3984425_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.9	9.9e-24
>prophage 309
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3989240	3991371	4784656		Escherichia_phage(100.0%)	3	NA	NA
AVD79740.1|3989240_3989858_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	60.6	8.6e-77
AVD79741.1|3989859_3990714_+	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AVD79742.1|3990756_3991371_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.5	1.4e-26
>prophage 310
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	3998029	4000239	4784656		Bacillus_phage(100.0%)	2	NA	NA
AVD79749.1|3998029_3999520_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.7	6.3e-25
AVD80621.1|3999516_4000239_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.6	1.1e-35
>prophage 311
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4007418	4008615	4784656		Salmonella_phage(100.0%)	1	NA	NA
AVD79760.1|4007418_4008615_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	27.1	8.1e-23
>prophage 312
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4022141	4023443	4784656		Bacillus_phage(100.0%)	1	NA	NA
AVD79773.1|4022141_4023443_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.6	1.4e-15
>prophage 313
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4034906	4036256	4784656		Bacillus_virus(100.0%)	1	NA	NA
AVD79781.1|4034906_4036256_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	28.7	3.3e-12
>prophage 314
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4050900	4052175	4784656	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AVD79797.1|4050900_4052175_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.8	2.9e-87
>prophage 315
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4059092	4059617	4784656		Salmonella_phage(100.0%)	1	NA	NA
AVD79806.1|4059092_4059617_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	57.1	1.2e-47
>prophage 316
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4064720	4075761	4784656		Orpheovirus(33.33%)	11	NA	NA
AVD79814.1|4064720_4065551_+	peptidoglycan endopeptidase	NA	A0A2H5BM69	Streptomyces_phage	41.6	2.4e-18
AVD79815.1|4065678_4066260_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	3.4e-43
AVD79816.1|4066299_4067469_-	MFS transporter	NA	NA	NA	NA	NA
AVD79817.1|4067645_4067735_-	YnhF family membrane protein	NA	NA	NA	NA	NA
AVD79818.1|4068032_4069058_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	4.8e-32
AVD79819.1|4069054_4069987_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVD79820.1|4070099_4071305_+	Bcr/CflA family multidrug efflux transporter	NA	NA	NA	NA	NA
AVD79821.1|4071595_4072744_+	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2I2L5L3	Orpheovirus	44.8	3.3e-82
AVD79822.1|4072785_4073433_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	37.3	1.2e-23
AVD79823.1|4073650_4075024_+	multidrug transporter MdtK	NA	NA	NA	NA	NA
AVD79824.1|4075062_4075761_-	RNA pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.4	1.1e-08
>prophage 317
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4085471	4087256	4784656		Bacillus_phage(100.0%)	1	NA	NA
AVD79835.1|4085471_4087256_+	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	34.4	1.1e-18
>prophage 318
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4097471	4097954	4784656		Turkeypox_virus(100.0%)	1	NA	NA
AVD79845.1|4097471_4097954_+	glutathione peroxidase	NA	A0A0M5HSM9	Turkeypox_virus	41.0	7.0e-18
>prophage 319
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4107074	4112892	4784656		Tupanvirus(33.33%)	5	NA	NA
AVD79850.1|4107074_4107827_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.5	5.1e-07
AVD79851.1|4107823_4108828_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AVD79852.1|4108814_4109870_-	hypothetical protein	NA	NA	NA	NA	NA
AVD79853.1|4110047_4111310_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.2	3.0e-20
AVD79854.1|4111416_4112892_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	27.8	3.4e-15
>prophage 320
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4123868	4128415	4784656		Indivirus(33.33%)	6	NA	NA
AVD79865.1|4123868_4124687_+	amino acid ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.7	9.5e-15
AVD79866.1|4124686_4125472_+	hypothetical protein	NA	NA	NA	NA	NA
AVD79867.1|4125461_4126139_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVD79868.1|4126148_4126961_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	33.3	6.8e-05
AVD79869.1|4126964_4127750_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
AVD79870.1|4127746_4128415_-	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	41.0	1.7e-25
>prophage 321
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4135302	4142748	4784656		Escherichia_phage(66.67%)	6	NA	NA
AVD80627.1|4135302_4136055_+	tetrathionate reductase subunit TtrB	NA	A0A077SL61	Escherichia_phage	40.0	8.7e-23
AVD79876.1|4136055_4137078_+	tetrathionate reductase subunit TtrC	NA	NA	NA	NA	NA
AVD79877.1|4137070_4140136_+	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	26.0	3.6e-06
AVD79878.1|4140230_4141043_-	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVD79879.1|4141064_4141733_-	ABC transporter permease	NA	NA	NA	NA	NA
AVD79880.1|4141725_4142748_-	methionine ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.4	5.0e-13
>prophage 322
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4146909	4152000	4784656		environmental_halophage(33.33%)	5	NA	NA
AVD79886.1|4146909_4148130_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	43.4	1.1e-96
AVD79887.1|4148126_4149398_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
AVD79888.1|4149372_4150119_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	25.0	7.8e-08
AVD79889.1|4150135_4151623_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AVD79890.1|4151631_4152000_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	38.5	9.5e-15
>prophage 323
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4172497	4178916	4784656		Staphylococcus_phage(33.33%)	4	NA	NA
AVD79908.1|4172497_4174135_+	cyclohexanecarboxylate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	28.8	1.1e-30
AVD79909.1|4174202_4176581_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.3	8.8e-170
AVD79910.1|4176909_4177743_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
AVD79911.1|4177869_4178916_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	47.1	8.8e-82
>prophage 324
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4184213	4197771	4784656	tRNA	Brazilian_cedratvirus(22.22%)	14	NA	NA
AVD79917.1|4184213_4184993_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	1.3e-10
AVD79918.1|4184989_4186432_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	1.3e-51
AVD79919.1|4186493_4187207_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AVD79920.1|4187525_4187990_-	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
AVD79921.1|4188067_4188817_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
AVD79922.1|4188816_4189368_-	glutathione peroxidase	NA	NA	NA	NA	NA
AVD79923.1|4189428_4190409_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.2	8.7e-15
AVD79924.1|4190530_4190830_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AVD79925.1|4190834_4193222_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AVD79926.1|4193237_4194221_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
AVD79927.1|4194590_4194947_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVD79928.1|4195002_4195200_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVD79929.1|4195296_4195839_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	8.2e-15
AVD79930.1|4195842_4197771_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	4.4e-127
>prophage 325
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4203036	4204481	4784656		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AVD79937.1|4203036_4203798_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	1.8e-20
AVD79938.1|4203881_4204481_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	34.3	3.5e-06
>prophage 326
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4212626	4213457	4784656		Bacillus_virus(100.0%)	1	NA	NA
AVD79948.1|4212626_4213457_+	NAD(+) synthase	NA	G3MA24	Bacillus_virus	54.9	1.2e-73
>prophage 327
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4221002	4222223	4784656		Klosneuvirus(100.0%)	1	NA	NA
AVD79956.1|4221002_4222223_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.0	3.2e-27
>prophage 328
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4227770	4228403	4784656		Bacillus_phage(100.0%)	1	NA	NA
AVD79964.1|4227770_4228403_+	sulfate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.7	2.4e-13
>prophage 329
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4233482	4235429	4784656		Streptococcus_phage(100.0%)	1	NA	NA
AVD79970.1|4233482_4235429_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.7	5.3e-40
>prophage 330
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4241548	4243699	4784656		Tupanvirus(100.0%)	2	NA	NA
AVD79975.1|4241548_4242187_+	nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.6	1.3e-16
AVD79976.1|4242445_4243699_+	chitinase	NA	A0A2K9L3D4	Tupanvirus	30.4	5.3e-25
>prophage 331
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4253042	4256846	4784656		Bacillus_phage(100.0%)	3	NA	NA
AVD79986.1|4253042_4254326_+	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	27.0	8.5e-10
AVD79987.1|4254420_4255191_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVD79988.1|4255355_4256846_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.4	6.2e-12
>prophage 332
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4261774	4262800	4784656		Bacillus_virus(100.0%)	1	NA	NA
AVD79996.1|4261774_4262800_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	26.3	4.7e-11
>prophage 333
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4280821	4282072	4784656		Phage_21(100.0%)	1	NA	NA
AVD80014.1|4280821_4282072_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-22
>prophage 334
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4286182	4287553	4784656		Bodo_saltans_virus(100.0%)	1	NA	NA
AVD80019.1|4286182_4287553_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	3.6e-107
>prophage 335
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4292676	4300953	4784656		Mycoplasma_phage(50.0%)	9	NA	NA
AVD80024.1|4292676_4293813_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	40.3	7.2e-29
AVD80025.1|4293796_4294654_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.8	4.3e-10
AVD80026.1|4294650_4295430_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
AVD80638.1|4295457_4296504_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
AVD80027.1|4296641_4297148_+	hypothetical protein	NA	NA	NA	NA	NA
AVD80028.1|4297169_4297991_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	1.9e-23
AVD80029.1|4298006_4298918_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AVD80030.1|4299007_4300252_-	lipoprotein-releasing system transmembrane subunit LolE	NA	NA	NA	NA	NA
AVD80031.1|4300251_4300953_-	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.4e-35
>prophage 336
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4308237	4308495	4784656		Erwinia_phage(100.0%)	1	NA	NA
AVD80639.1|4308237_4308495_-	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	35.7	2.8e-05
>prophage 337
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4328106	4329177	4784656		Synechococcus_phage(100.0%)	1	NA	NA
AVD80054.1|4328106_4329177_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	A0A0E3FCK0	Synechococcus_phage	47.8	2.1e-09
>prophage 338
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4346441	4348166	4784656		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVD80071.1|4346441_4347398_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.8	3.7e-18
AVD80072.1|4347398_4348166_+	ferric citrate ABC transporter ATP-binding protein FecE	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.2	3.2e-12
>prophage 339
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4352850	4353969	4784656		Streptococcus_phage(100.0%)	1	NA	NA
AVD80079.1|4352850_4353969_+	hypothetical protein	NA	A1IMD5	Streptococcus_phage	22.6	8.1e-09
>prophage 340
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4362475	4368610	4784656		Acinetobacter_phage(33.33%)	5	NA	NA
AVD80088.1|4362475_4364254_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	34.7	2.0e-81
AVD80089.1|4364309_4365743_-	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
AVD80090.1|4366159_4366957_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AVD80091.1|4366967_4367972_-	DNA polymerase III subunit delta'	NA	A0A1V0DYC6	Dinoroseobacter_phage	33.3	2.0e-06
AVD80092.1|4367968_4368610_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	38.2	1.3e-27
>prophage 341
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4371896	4373022	4784656		Ralstonia_phage(50.0%)	2	NA	NA
AVD80096.1|4371896_4372133_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
AVD80097.1|4372287_4373022_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	7.7e-16
>prophage 342
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4387655	4388606	4784656		Brevibacillus_phage(100.0%)	1	NA	NA
AVD80110.1|4387655_4388606_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	30.9	1.6e-10
>prophage 343
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4403865	4404111	4784656		Enterobacteria_phage(100.0%)	1	NA	NA
AVD80129.1|4403865_4404111_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	50.0	1.1e-14
>prophage 344
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4408828	4412521	4784656		Morganella_phage(50.0%)	3	NA	NA
AVD80136.1|4408828_4409749_+	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	41.6	1.0e-57
AVD80137.1|4409904_4411125_+	multidrug transporter MdtG	NA	NA	NA	NA	NA
AVD80641.1|4411189_4412521_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.1	1.0e-18
>prophage 345
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4420826	4421369	4784656		Scale_drop_disease_virus(100.0%)	1	NA	NA
AVD80142.1|4420826_4421369_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	47.9	2.5e-27
>prophage 346
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4425557	4431043	4784656		Pelagibacter_phage(33.33%)	6	NA	NA
AVD80150.1|4425557_4426391_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	39.7	3.0e-40
AVD80151.1|4426437_4426968_-	hypothetical protein	NA	NA	NA	NA	NA
AVD80152.1|4427021_4427576_-	molecular chaperone	NA	NA	NA	NA	NA
AVD80153.1|4427599_4428337_-	phosphatase	NA	NA	NA	NA	NA
AVD80154.1|4428547_4429486_-	glyoxylate/hydroxypyruvate reductase GhrA	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	30.0	9.9e-08
AVD80155.1|4430134_4431043_-	phosphate starvation protein PhoH	NA	A0A1B2ICF6	Erwinia_phage	70.8	3.1e-91
>prophage 347
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4443085	4443259	4784656		Enterobacteria_phage(100.0%)	1	NA	NA
AVD80165.1|4443085_4443259_-	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 348
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4452631	4453552	4784656		Klosneuvirus(100.0%)	1	NA	NA
AVD80177.1|4452631_4453552_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	39.0	3.6e-10
>prophage 349
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4461399	4462215	4784656		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AVD80184.1|4461399_4462215_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.7	3.4e-12
>prophage 350
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4465543	4471989	4784656	integrase	Erysipelothrix_phage(66.67%)	3	4458384:4458397	4471344:4471357
4458384:4458397	attL	CAGCAACATCAATA	NA	NA	NA	NA
AVD80189.1|4465543_4466782_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.4	1.1e-78
AVD80190.1|4466961_4469019_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	39.4	8.8e-118
AVD80191.1|4469028_4471989_+	restriction endonuclease subunit R	NA	A0A2K5B2C2	Erysipelothrix_phage	38.2	1.2e-163
4471344:4471357	attR	TATTGATGTTGCTG	NA	NA	NA	NA
>prophage 351
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4477607	4478699	4784656		Clostridium_botulinum_C_phage(100.0%)	1	NA	NA
AVD80197.1|4477607_4478699_+	hypothetical protein	NA	Q332C0	Clostridium_botulinum_C_phage	35.6	1.3e-06
>prophage 352
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4482704	4483454	4784656		Cellulophaga_phage(100.0%)	1	NA	NA
AVD80203.1|4482704_4483454_+	DNA-binding protein	NA	M1Q742	Cellulophaga_phage	46.5	7.6e-27
>prophage 353
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4489417	4489630	4784656		Enterobacteria_phage(100.0%)	1	NA	NA
AVD80215.1|4489417_4489630_-	DNA-binding protein	NA	Q7M299	Enterobacteria_phage	40.6	5.8e-09
>prophage 354
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4493108	4493768	4784656		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVD80218.1|4493108_4493768_+	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	2.6e-47
>prophage 355
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4498024	4500079	4784656		Bacillus_phage(100.0%)	1	NA	NA
AVD80226.1|4498024_4500079_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.7e-20
>prophage 356
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4512624	4514532	4784656		Tupanvirus(100.0%)	1	NA	NA
AVD80237.1|4512624_4514532_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	6.0e-52
>prophage 357
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4523299	4534141	4784656	tRNA	Bacillus_virus(20.0%)	8	NA	NA
AVD80246.1|4523299_4524067_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	2.0e-30
AVD80247.1|4524163_4526776_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	1.8e-19
AVD80248.1|4527042_4528245_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AVD80249.1|4528411_4529812_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.9	5.0e-80
AVD80250.1|4530412_4531489_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	55.3	2.1e-102
AVD80251.1|4531672_4532863_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AVD80252.1|4532916_4533564_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AVD80253.1|4533592_4534141_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	32.6	3.5e-05
>prophage 358
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4549598	4554139	4784656		Bacillus_phage(100.0%)	3	NA	NA
AVD80265.1|4549598_4551347_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	31.1	4.9e-61
AVD80266.1|4551383_4553648_-	ComEC family protein	NA	NA	NA	NA	NA
AVD80267.1|4553854_4554139_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	39.1	9.2e-10
>prophage 359
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4558293	4559382	4784656		Streptococcus_phage(100.0%)	1	NA	NA
AVD80271.1|4558293_4559382_-	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	46.0	7.8e-81
>prophage 360
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4563505	4566839	4784656		Tetraselmis_virus(100.0%)	2	NA	NA
AVD80274.1|4563505_4565788_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	3.8e-162
AVD80275.1|4566098_4566839_+	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.0e-20
>prophage 361
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4572545	4589128	4784656	tRNA	Escherichia_phage(25.0%)	10	NA	NA
AVD80280.1|4572545_4573163_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	59.6	1.2e-75
AVD80281.1|4573173_4575618_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.7	4.6e-222
AVD80282.1|4575854_4577147_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.0	4.3e-94
AVD80283.1|4577239_4578583_-	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	40.3	1.6e-80
AVD80284.1|4578593_4579205_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AVD80285.1|4579316_4583381_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	2.9e-88
AVD80286.1|4583515_4584010_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AVD80287.1|4584556_4585525_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	1.9e-62
AVD80288.1|4585639_4587406_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	23.3	3.5e-22
AVD80289.1|4587406_4589128_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-12
>prophage 362
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4593679	4602981	4784656		Streptococcus_phage(25.0%)	11	NA	NA
AVD80295.1|4593679_4594807_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	2.5e-29
AVD80296.1|4594848_4595337_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AVD80297.1|4595396_4596242_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AVD80298.1|4596238_4597192_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AVD80299.1|4597201_4598335_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	1.1e-29
AVD80300.1|4598473_4599586_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AVD80301.1|4600019_4600496_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AVD80302.1|4600586_4601489_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	33.6	3.3e-37
AVD80303.1|4601548_4602271_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AVD80304.1|4602254_4602545_-	hypothetical protein	NA	NA	NA	NA	NA
AVD80305.1|4602717_4602981_+	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	67.9	3.8e-26
>prophage 363
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4611884	4613891	4784656		Escherichia_phage(50.0%)	2	NA	NA
AVD80315.1|4611884_4612643_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	28.3	3.3e-14
AVD80649.1|4612688_4613891_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	2.2e-97
>prophage 364
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4617614	4620065	4784656		Dickeya_phage(100.0%)	1	NA	NA
AVD80320.1|4617614_4620065_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	74.6	1.3e-22
>prophage 365
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4625381	4627253	4784656		Planktothrix_phage(100.0%)	1	NA	NA
AVD80326.1|4625381_4627253_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.1	1.4e-13
>prophage 366
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4631430	4639689	4784656		Synechococcus_phage(33.33%)	6	NA	NA
AVD80332.1|4631430_4632093_-	fructose-6-phosphate aldolase	NA	A0A1D8KKK9	Synechococcus_phage	31.8	2.9e-22
AVD80333.1|4632225_4633125_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
AVD80334.1|4633130_4635563_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	50.9	2.3e-08
AVD80335.1|4635787_4636603_+	sugar-phosphatase	NA	NA	NA	NA	NA
AVD80336.1|4636755_4638018_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
AVD80337.1|4638096_4639689_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	1.1e-59
>prophage 367
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4644827	4650077	4784656		Enterobacteria_phage(33.33%)	6	NA	NA
AVD80342.1|4644827_4645343_-	outer membrane protein OmpX	NA	A5LH44	Enterobacteria_phage	33.7	1.2e-15
AVD80343.1|4645754_4646642_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AVD80344.1|4646945_4647449_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	28.1	5.5e-05
AVD80345.1|4647814_4648561_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVD80346.1|4648698_4649358_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AVD80347.1|4649354_4650077_+	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.1	2.8e-34
>prophage 368
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4656448	4662523	4784656		Synechococcus_phage(33.33%)	6	NA	NA
AVD80351.1|4656448_4657126_+	Fe2+-dependent dioxygenase	NA	Q5GQB0	Synechococcus_phage	30.6	5.8e-18
AVD80352.1|4657201_4657468_+	hypothetical protein	NA	A0A2C9CZU7	Yersinia_phage	50.0	1.8e-15
AVD80353.1|4657768_4658029_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVD80354.1|4658126_4659212_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
AVD80355.1|4659374_4660343_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AVD80356.1|4660372_4662523_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.3	8.2e-42
>prophage 369
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4666513	4671480	4784656		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	4	NA	NA
AVD80360.1|4666513_4667860_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.0	5.0e-53
AVD80361.1|4668081_4668759_+	transcriptional regulator	NA	NA	NA	NA	NA
AVD80362.1|4668755_4669751_+	secretion protein HlyD	NA	NA	NA	NA	NA
AVD80363.1|4669743_4671480_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	5.1e-18
>prophage 370
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4681303	4685810	4784656		Streptococcus_phage(50.0%)	3	NA	NA
AVD80377.1|4681303_4682212_+	hypothetical protein	NA	A1IMD5	Streptococcus_phage	30.7	7.8e-26
AVD80378.1|4682297_4684319_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AVD80379.1|4685087_4685810_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	2.4e-09
>prophage 371
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4689476	4692916	4784656		Klosneuvirus(50.0%)	3	NA	NA
AVD80384.1|4689476_4690766_+	adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA	NA	A0A1V0SKB7	Klosneuvirus	28.8	1.4e-20
AVD80385.1|4690823_4691300_+	kinase inhibitor	NA	NA	NA	NA	NA
AVD80386.1|4691395_4692916_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.9	2.2e-81
>prophage 372
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4701278	4707828	4784656		Planktothrix_phage(33.33%)	7	NA	NA
AVD80393.1|4701278_4702337_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	33.8	2.6e-20
AVD80394.1|4702339_4703029_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AVD80395.1|4703028_4703802_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVD80396.1|4703986_4704136_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
AVD80397.1|4704265_4705054_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AVD80398.1|4705121_4706594_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	26.9	3.0e-11
AVD80399.1|4706811_4707828_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.1	9.8e-78
>prophage 373
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4712163	4715679	4784656		Pandoravirus(33.33%)	4	NA	NA
AVD80404.1|4712163_4713216_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4VUY9	Pandoravirus	47.3	1.3e-80
AVD80405.1|4713533_4713908_+	hypothetical protein	NA	NA	NA	NA	NA
AVD80406.1|4714021_4714963_+	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	2.9e-23
AVD80407.1|4714959_4715679_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.6	5.8e-24
>prophage 374
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4742817	4747129	4784656		Escherichia_phage(75.0%)	5	NA	NA
AVD80434.1|4742817_4744074_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	48.6	2.1e-93
AVD80435.1|4744070_4744715_+	aldolase	NA	A0A077SK32	Escherichia_phage	55.1	1.3e-56
AVD80436.1|4744724_4745531_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	42.4	2.4e-47
AVD80437.1|4745511_4746288_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
AVD80438.1|4746316_4747129_+	3-keto-5-aminohexanoate cleavage protein	NA	A0A1V0SL81	Klosneuvirus	26.6	9.1e-18
>prophage 375
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4765604	4766396	4784656		Kaumoebavirus(100.0%)	1	NA	NA
AVD80456.1|4765604_4766396_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	30.1	3.7e-08
>prophage 376
CP026677	UNVERIFIED_ORG: Citrobacter freundii strain AR_0023 chromosome, complete genome	4784656	4772189	4781225	4784656	transposase	Acinetobacter_phage(25.0%)	8	NA	NA
AVD80462.1|4772189_4773671_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	27.3	2.3e-43
AVD80463.1|4773717_4774620_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	44.5	3.4e-66
AVD80464.1|4774783_4776202_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	33.0	1.4e-61
AVD80465.1|4776220_4776775_-	hypothetical protein	NA	NA	NA	NA	NA
AVD80466.1|4776872_4777079_-	DUF2517 domain-containing protein	NA	NA	NA	NA	NA
AVD80467.1|4777387_4777477_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AVD80468.1|4777476_4779156_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AVD80469.1|4779176_4781225_+	K(+)-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.7	3.7e-31
