The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026700	Salmonella enterica subsp. enterica serovar Typhimurium strain AR_0031 chromosome, complete genome	4870262	66676	78967	4870262	holin,tail	Salmonella_phage(45.45%)	11	NA	NA
AVE61532.1|66676_67180_-	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
AVE61533.1|67207_67498_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
AVE61534.1|67845_69675_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
AVE61535.1|69728_70172_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
AVE61536.1|70549_71077_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
AVE61537.1|71079_72321_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
AVE61538.1|72913_73243_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
AVE61539.1|73539_74871_+	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
AVE61540.1|74899_75268_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
AVE66005.1|75282_76272_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	2.4e-190
AVE61541.1|76600_78967_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
>prophage 2
CP026700	Salmonella enterica subsp. enterica serovar Typhimurium strain AR_0031 chromosome, complete genome	4870262	419300	520764	4870262	portal,protease,integrase,transposase,tail,holin,head,lysis,tRNA,capsid,terminase	Salmonella_phage(36.07%)	111	445444:445459	515853:515868
AVE61845.1|419300_420032_-|tRNA	tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
AVE61846.1|420150_420954_+	inositol monophosphatase	NA	NA	NA	NA	NA
AVE61847.1|421098_421977_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
AVE61848.1|422158_423202_+	sulfite reductase subunit alpha	NA	NA	NA	NA	NA
AVE61849.1|423205_424024_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
AVE61850.1|424034_425048_+	anaerobic sulfite reductase subunit AsrC	NA	NA	NA	NA	NA
AVE61851.1|425048_426035_-	nickel transporter	NA	NA	NA	NA	NA
AVE66016.1|426025_426664_-	DUF1007 domain-containing protein	NA	NA	NA	NA	NA
AVE61852.1|426789_428067_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
AVE61853.1|428061_429201_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
AVE61854.1|429396_430650_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
AVE61855.1|430974_432165_+	flavohemoprotein	NA	NA	NA	NA	NA
AVE61856.1|432346_433891_+	transcriptional regulator CadC	NA	NA	NA	NA	NA
AVE61857.1|434251_435583_+	lysine:cadaverine antiporter	NA	NA	NA	NA	NA
AVE61858.1|435665_437810_+	lysine decarboxylase inducible	NA	NA	NA	NA	NA
AVE61859.1|437865_439326_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
AVE61860.1|439374_439713_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AVE61861.1|439789_441127_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
AVE61862.1|441123_441888_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AVE61863.1|441889_443275_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	1.9e-15
AVE61864.1|443969_447857_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
445444:445459	attL	AACGCGGAAATCACCA	NA	NA	NA	NA
AVE61865.1|447878_448112_+	hypothetical protein	NA	NA	NA	NA	NA
AVE61866.1|448112_449657_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
AVE61867.1|449707_450259_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
AVE61868.1|450283_450919_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
AVE61869.1|450922_452284_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AVE61870.1|452294_453188_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AVE61871.1|453303_454152_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AVE61872.1|454190_455108_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AVE61873.1|455129_456326_-	MFS transporter	NA	NA	NA	NA	NA
AVE61874.1|456441_457368_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
AVE61875.1|457405_457666_+	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
AVE61876.1|457777_458158_-	holo-ACP synthase	NA	NA	NA	NA	NA
AVE61877.1|458157_458889_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AVE61878.1|458900_459629_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AVE61879.1|459640_460546_-	GTPase Era	NA	NA	NA	NA	NA
AVE66017.1|460542_461223_-	ribonuclease 3	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
AVE61880.1|461496_462471_-	S26 family signal peptidase	NA	NA	NA	NA	NA
AVE61881.1|462487_464287_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
AVE61882.1|464691_466185_+	type III secretion system protein	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
AVE61883.1|466663_466801_+	hypothetical protein	NA	NA	NA	NA	NA
AVE61884.1|467047_467593_+|transposase	transposase	transposase	NA	NA	NA	NA
AVE66018.1|468257_468323_-	hypothetical protein	NA	NA	NA	NA	NA
AVE61885.1|468385_468598_-	hypothetical protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
AVE61886.1|468704_468932_+	phage virulence factor	NA	NA	NA	NA	NA
AVE61887.1|469028_469607_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
AVE61888.1|469596_470421_-|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
AVE61889.1|470417_472790_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
AVE61890.1|472843_473086_-	hypothetical protein	NA	NA	NA	NA	NA
AVE61891.1|473124_476487_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
AVE61892.1|476548_477196_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
AVE61893.1|477093_477831_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
AVE61894.1|477837_478536_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
AVE61895.1|478545_478875_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
AVE61896.1|478877_481973_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
AVE61897.1|481944_482283_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
AVE61898.1|482279_482675_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
AVE61899.1|482725_483472_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
AVE61900.1|483479_483881_-|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
AVE61901.1|483869_485120_+|transposase	transposase	transposase	Q9G0F2	Phage_Gifsy-1	100.0	7.8e-218
AVE61902.1|485168_485747_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
AVE61903.1|485774_486158_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
AVE61904.1|486168_486528_-	DNA packaging protein	NA	NA	NA	NA	NA
AVE61905.1|486585_487614_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
AVE61906.1|487668_488016_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
AVE61907.1|488028_489525_-	scaffolding protein	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
AVE61908.1|489514_491095_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
AVE61909.1|491091_491295_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
AVE61910.1|491278_493210_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
AVE61911.1|493181_493727_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
AVE61912.1|493784_493979_-	hypothetical protein	NA	NA	NA	NA	NA
AVE61913.1|494013_494415_+	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
AVE66019.1|494650_495103_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
AVE61914.1|495120_495573_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
AVE66020.1|495556_495886_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AVE61915.1|496161_496848_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
AVE61916.1|497062_497251_-	hypothetical protein	NA	NA	NA	NA	NA
AVE61917.1|497757_498321_-	hypothetical protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
AVE61918.1|498411_498597_-	hypothetical protein	NA	NA	NA	NA	NA
AVE61919.1|498593_499271_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
AVE61920.1|499267_499408_-	hypothetical protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
AVE61921.1|499404_500016_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
AVE61922.1|500018_500225_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.7e-34
AVE61923.1|500224_500827_-	hypothetical protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
AVE61924.1|500861_501110_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
AVE61925.1|501226_501460_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
AVE61926.1|501702_502335_-	hypothetical protein	NA	NA	NA	NA	NA
AVE61927.1|502442_503141_-	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
AVE61928.1|503154_503850_-	phage replication protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
AVE61929.1|503846_504731_-	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
AVE61930.1|504822_505197_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
AVE61931.1|505156_505399_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
AVE61932.1|505498_505894_+	transcriptional regulator	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
AVE61933.1|505952_506792_+	chromosome partitioning protein ParA	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
AVE61934.1|506784_507171_+	hypothetical protein	NA	NA	NA	NA	NA
AVE61935.1|507170_507833_+	hypothetical protein	NA	NA	NA	NA	NA
AVE61936.1|508289_508448_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
AVE61937.1|508469_508820_+	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
AVE61938.1|508946_511874_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
AVE61939.1|511836_512994_+	enterohemolysin	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
AVE61940.1|513036_513276_+	DUF4060 domain-containing protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AVE61941.1|513316_513601_+	excisionase	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
AVE61942.1|513578_514808_-|integrase	integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
AVE61943.1|515159_515276_-	transcriptional regulator	NA	NA	NA	NA	NA
AVE61944.1|515305_515785_-	SoxR reducing system protein RseC	NA	NA	NA	NA	NA
AVE61945.1|515781_516738_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
515853:515868	attR	TGGTGATTTCCGCGTT	NA	NA	NA	NA
AVE61946.1|516737_517388_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
AVE61947.1|517419_517995_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
AVE61948.1|518155_518335_-	hypothetical protein	NA	NA	NA	NA	NA
AVE61949.1|518419_520042_+	L-aspartate oxidase	NA	NA	NA	NA	NA
AVE61950.1|520026_520764_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
CP026700	Salmonella enterica subsp. enterica serovar Typhimurium strain AR_0031 chromosome, complete genome	4870262	2115615	2136035	4870262	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
AVE63390.1|2115615_2116344_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
AVE63391.1|2116540_2116831_-	hypothetical protein	NA	NA	NA	NA	NA
AVE63392.1|2117079_2117535_-	hypothetical protein	NA	NA	NA	NA	NA
AVE63393.1|2117531_2118137_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
AVE63394.1|2118141_2119887_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
AVE63395.1|2119889_2120522_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
AVE63396.1|2120514_2121630_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
AVE63397.1|2121620_2121980_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AVE63398.1|2122143_2123691_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
AVE63399.1|2123690_2124620_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
AVE63400.1|2124616_2124979_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
AVE63401.1|2125306_2126029_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
AVE63402.1|2126038_2127082_-	phage protein D	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
AVE63403.1|2127069_2127279_-	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AVE63404.1|2127278_2128232_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
AVE63405.1|2128231_2130586_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
AVE63406.1|2130682_2130811_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AVE63407.1|2130770_2131088_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVE63408.1|2131139_2131664_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
AVE63409.1|2131663_2133091_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
AVE63410.1|2133080_2133278_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
AVE63411.1|2133274_2133730_-	hypothetical protein	NA	NA	NA	NA	NA
AVE63412.1|2133889_2134204_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AVE63413.1|2134216_2134822_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	1.2e-59
AVE63414.1|2134824_2135112_-	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
AVE63415.1|2135687_2136035_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 4
CP026700	Salmonella enterica subsp. enterica serovar Typhimurium strain AR_0031 chromosome, complete genome	4870262	3531364	3540096	4870262	transposase,protease	Dickeya_phage(14.29%)	9	NA	NA
AVE64657.1|3531364_3532483_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
AVE64658.1|3532479_3534426_+	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
AVE64659.1|3534406_3534601_+	hypothetical protein	NA	NA	NA	NA	NA
AVE64660.1|3534555_3534777_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AVE64661.1|3535100_3535421_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AVE64662.1|3535451_3537728_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AVE64663.1|3537780_3537963_+	hypothetical protein	NA	NA	NA	NA	NA
AVE64664.1|3537919_3538378_+|transposase	IS200/IS605 family transposase IS200F	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
AVE64665.1|3538840_3540096_-|transposase	IS3-like ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 5
CP026700	Salmonella enterica subsp. enterica serovar Typhimurium strain AR_0031 chromosome, complete genome	4870262	3590189	3688998	4870262	portal,protease,integrase,tail,lysis,tRNA,holin	Salmonella_phage(44.64%)	103	3593098:3593117	3664886:3664905
AVE64704.1|3590189_3590993_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AVE64705.1|3590985_3592308_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
AVE64706.1|3592288_3592993_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
AVE64707.1|3592992_3597459_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
3593098:3593117	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AVE64708.1|3597803_3599645_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AVE64709.1|3599904_3600453_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
AVE64710.1|3600480_3601128_+	MBL fold hydrolase	NA	NA	NA	NA	NA
AVE64711.1|3601189_3602380_-	aspartate aminotransferase	NA	NA	NA	NA	NA
AVE64712.1|3602564_3603656_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
AVE64713.1|3604262_3605663_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
AVE64714.1|3605863_3606325_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AVE64715.1|3606321_3606555_-	hypothetical protein	NA	NA	NA	NA	NA
AVE64716.1|3606641_3607856_+	PLP-dependent lyase/thiolase	NA	NA	NA	NA	NA
AVE64717.1|3608100_3609537_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
AVE64718.1|3609614_3610817_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AVE64719.1|3611011_3612304_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.5	2.9e-252
AVE64720.1|3612348_3612597_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AVE64721.1|3612637_3612877_-	DUF4060 domain-containing protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AVE64722.1|3612919_3614077_-	enterohemolysin	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
AVE64723.1|3614039_3616925_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
AVE64724.1|3617051_3617351_-	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
AVE64725.1|3617372_3617531_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
AVE64726.1|3617523_3617784_-	hypothetical protein	NA	NA	NA	NA	NA
AVE64727.1|3617833_3618244_-	transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
AVE64728.1|3618363_3618603_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
AVE64729.1|3618568_3618943_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AVE64730.1|3619027_3620011_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
AVE64731.1|3620013_3620763_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.2	1.1e-137
AVE64732.1|3620773_3621121_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
AVE64733.1|3621117_3621429_+	hypothetical protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
AVE64734.1|3621506_3621797_+	hypothetical protein	NA	NA	NA	NA	NA
AVE64735.1|3622088_3622322_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
AVE64736.1|3622433_3622655_+	hypothetical protein	NA	NA	NA	NA	NA
AVE64737.1|3622737_3623340_+	hypothetical protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
AVE64738.1|3623339_3623546_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
AVE64739.1|3623548_3624160_+	protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
AVE64740.1|3624156_3624303_+	hypothetical protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
AVE64741.1|3624292_3625090_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
AVE64742.1|3625156_3625474_+	hypothetical protein	NA	NA	NA	NA	NA
AVE64743.1|3625647_3625773_+	hypothetical protein	NA	NA	NA	NA	NA
AVE64744.1|3625908_3626358_-	hypothetical protein	NA	NA	NA	NA	NA
AVE64745.1|3626718_3627405_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
AVE66146.1|3627680_3628010_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AVE64746.1|3627993_3628446_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
AVE66147.1|3628463_3628943_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
AVE64747.1|3629150_3629684_+	DNA breaking-rejoining protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
AVE64748.1|3629640_3631779_+	DNA packaging protein	NA	A5LH27	Enterobacteria_phage	72.6	3.4e-290
AVE64749.1|3631775_3631982_+	primosomal replication protein PriB/PriC domain protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
AVE66148.1|3632008_3633526_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
AVE66149.1|3633449_3635531_+	peptidase S14	NA	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
AVE64750.1|3635621_3635945_+	recombinase RecA	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
AVE64751.1|3635937_3636237_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
AVE64752.1|3636217_3636784_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
AVE64753.1|3636780_3637182_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
AVE64754.1|3637193_3637943_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
AVE64755.1|3637988_3638387_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
AVE64756.1|3638383_3638713_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
AVE66150.1|3638792_3641780_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
AVE64757.1|3641776_3642109_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
AVE64758.1|3642207_3642705_+	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
AVE64759.1|3642821_3643355_-	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AVE64760.1|3643444_3644140_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
AVE64761.1|3644149_3644887_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
AVE64762.1|3644784_3645489_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
AVE64763.1|3648949_3649192_+	hypothetical protein	NA	NA	NA	NA	NA
AVE64764.1|3649245_3651684_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
AVE64765.1|3651683_3652265_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
AVE64766.1|3652740_3653709_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	100.0	7.1e-195
AVE64767.1|3654356_3654983_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
AVE64768.1|3655051_3655351_-	hypothetical protein	NA	NA	NA	NA	NA
AVE64769.1|3655335_3656022_-	virulence protein	NA	NA	NA	NA	NA
AVE64770.1|3656292_3656484_-	DNA-damage-inducible protein I	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
AVE64771.1|3656910_3659523_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
AVE64772.1|3659730_3660741_+	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AVE64773.1|3660906_3661449_+	cell division protein ZapC	NA	NA	NA	NA	NA
AVE64774.1|3661445_3662555_-	hypothetical protein	NA	NA	NA	NA	NA
AVE64775.1|3662653_3664762_+	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AVE64776.1|3664774_3666682_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
3664886:3664905	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AVE64777.1|3666696_3667950_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AVE64778.1|3667954_3669595_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AVE64779.1|3669591_3670155_+	hypothetical protein	NA	NA	NA	NA	NA
AVE64780.1|3670410_3670578_+	ribosome modulation factor	NA	NA	NA	NA	NA
AVE64781.1|3670677_3671196_-	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AVE64782.1|3671264_3673025_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
AVE64783.1|3673210_3673663_+	macrodomain Ter protein	NA	NA	NA	NA	NA
AVE64784.1|3673734_3674787_-	outer membrane protein A	NA	NA	NA	NA	NA
AVE64785.1|3675143_3675653_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
AVE64786.1|3675869_3676475_+	DNA transformation protein	NA	NA	NA	NA	NA
AVE64787.1|3676461_3678615_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AVE64788.1|3678633_3679080_-	YccF domain-containing protein	NA	NA	NA	NA	NA
AVE64789.1|3679203_3681258_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
AVE64790.1|3681293_3681752_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AVE64791.1|3681846_3682509_-	hypothetical protein	NA	NA	NA	NA	NA
AVE64792.1|3682679_3683096_+	CoA-binding protein	NA	NA	NA	NA	NA
AVE64793.1|3683140_3683458_-	heat-shock protein HspQ	NA	NA	NA	NA	NA
AVE64794.1|3683515_3684727_-	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AVE64795.1|3684941_3685490_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AVE64796.1|3685515_3686295_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVE64797.1|3686343_3686625_+	acylphosphatase	NA	NA	NA	NA	NA
AVE64798.1|3686621_3686951_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
AVE64799.1|3687037_3687697_-	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
AVE64800.1|3687762_3687972_+	hypothetical protein	NA	NA	NA	NA	NA
AVE64801.1|3688317_3688998_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 6
CP026700	Salmonella enterica subsp. enterica serovar Typhimurium strain AR_0031 chromosome, complete genome	4870262	3827445	3884559	4870262	integrase,transposase,tail,capsid,head,lysis,tRNA,portal,terminase	Enterobacteria_phage(32.69%)	74	3838173:3838187	3852571:3852585
AVE64944.1|3827445_3827904_+|transposase	IS200/IS605 family transposase IS200F	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
AVE64945.1|3827994_3829284_+	hypothetical protein	NA	NA	NA	NA	NA
AVE64946.1|3829323_3830445_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AVE64947.1|3830525_3831989_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
AVE64948.1|3831988_3832663_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AVE64949.1|3832786_3834157_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	8.5e-109
AVE66158.1|3834160_3834802_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AVE64950.1|3834888_3835995_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AVE64951.1|3836048_3836510_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AVE64952.1|3836521_3836851_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AVE64953.1|3836847_3837513_-	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AVE64954.1|3837684_3838935_+	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	90.7	1.1e-19
3838173:3838187	attL	TGAATGGAAAGCTGA	NA	NA	NA	NA
AVE64955.1|3839047_3840190_-|integrase	integrase	integrase	O21929	Phage_21	80.3	8.2e-174
AVE64956.1|3840179_3840416_-	excisionase	NA	NA	NA	NA	NA
AVE64957.1|3840465_3841017_-	Eaa protein	NA	A0A192Y7X3	Salmonella_phage	34.5	2.8e-10
AVE64958.1|3841013_3841346_-	hypothetical protein	NA	S4TNP2	Salmonella_phage	81.8	8.8e-20
AVE64959.1|3841338_3841659_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	59.2	1.8e-33
AVE64960.1|3841694_3842525_-	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.3e-104
AVE64961.1|3842517_3845229_-	exonuclease VIII	NA	H6WRX1	Salmonella_phage	39.6	1.2e-125
AVE64962.1|3845939_3846146_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	7.4e-17
AVE64963.1|3846253_3847339_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	38.0	1.5e-60
AVE64964.1|3847490_3847958_-	transcriptional regulator	NA	K7PHG0	Enterobacteria_phage	86.9	3.2e-68
AVE64965.1|3847971_3848199_+	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
AVE64966.1|3848164_3848539_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	97.6	2.8e-62
AVE64967.1|3848630_3849536_+	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	96.3	4.4e-170
AVE64968.1|3849532_3850225_+	phage replication protein	NA	G8C7U6	Escherichia_phage	60.2	1.8e-78
AVE64969.1|3850239_3850905_+	hypothetical protein	NA	A0A1V0E5L5	Salmonella_phage	44.9	2.8e-25
AVE64970.1|3850906_3851377_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.1e-68
AVE64971.1|3851379_3852033_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	52.0	6.3e-62
AVE64972.1|3852025_3852307_+	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	95.7	3.2e-47
AVE64973.1|3852418_3852610_+	hypothetical protein	NA	G8C7S2	Escherichia_phage	68.9	1.1e-17
3852571:3852585	attR	TGAATGGAAAGCTGA	NA	NA	NA	NA
AVE64974.1|3852868_3853102_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
AVE64975.1|3853218_3853467_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
AVE64976.1|3853501_3854101_+	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	81.0	1.7e-93
AVE64977.1|3854097_3854292_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	1.4e-12
AVE64978.1|3854273_3854570_+	hypothetical protein	NA	K7P7Q1	Enterobacteria_phage	79.1	3.9e-35
AVE64979.1|3854566_3855121_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	65.3	3.4e-64
AVE64980.1|3855117_3855306_+	hypothetical protein	NA	NA	NA	NA	NA
AVE64981.1|3855387_3855948_+	hypothetical protein	NA	A0A2R2Z302	Escherichia_phage	71.1	1.1e-41
AVE64982.1|3855867_3856056_-	hypothetical protein	NA	NA	NA	NA	NA
AVE64983.1|3856190_3856379_+	hypothetical protein	NA	NA	NA	NA	NA
AVE64984.1|3856532_3856751_+	hypothetical protein	NA	NA	NA	NA	NA
AVE66159.1|3856762_3857230_-	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
AVE66160.1|3857479_3857782_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVE64985.1|3857759_3858299_+	lysozyme	NA	S5MQK2	Escherichia_phage	74.1	5.7e-77
AVE66161.1|3858616_3859072_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	78.8	8.0e-56
AVE64986.1|3859298_3859700_-	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
AVE64987.1|3859734_3859941_+	hypothetical protein	NA	NA	NA	NA	NA
AVE64988.1|3859985_3860531_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
AVE64989.1|3860502_3862434_+|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
AVE64990.1|3862417_3862621_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
AVE64991.1|3862617_3864198_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	5.6e-189
AVE64992.1|3864187_3865684_+	scaffolding protein	NA	A0A0K2FI53	Enterobacteria_phage	52.7	4.3e-98
AVE64993.1|3865696_3866044_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
AVE64994.1|3866098_3867127_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
AVE64995.1|3867184_3867550_+	DNA packaging protein	NA	NA	NA	NA	NA
AVE64996.1|3867560_3867944_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
AVE64997.1|3867971_3868550_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.7	1.7e-82
AVE64998.1|3868598_3869849_-|transposase	transposase	transposase	Q9G0F2	Phage_Gifsy-1	99.2	1.6e-215
AVE64999.1|3869837_3870239_+|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
AVE65000.1|3870246_3870993_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
AVE65001.1|3871043_3871439_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
AVE65002.1|3871435_3871774_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
AVE65003.1|3871745_3874841_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
AVE65004.1|3874843_3875173_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
AVE65005.1|3875182_3875881_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
AVE65006.1|3875887_3876625_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
AVE65007.1|3876522_3877170_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
AVE65008.1|3877231_3880594_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.9	0.0e+00
AVE65009.1|3880632_3880875_+	hypothetical protein	NA	NA	NA	NA	NA
AVE65010.1|3880928_3883370_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	62.0	2.5e-87
AVE65011.1|3883369_3883954_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	84.8	1.7e-87
AVE65012.1|3884051_3884252_-	phage virulence factor	NA	NA	NA	NA	NA
AVE65013.1|3884442_3884559_-|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 7
CP026700	Salmonella enterica subsp. enterica serovar Typhimurium strain AR_0031 chromosome, complete genome	4870262	4480399	4536114	4870262	protease,integrase,transposase,tail,tRNA	Moraxella_phage(11.76%)	69	4524168:4524190	4533883:4533905
AVE65600.1|4480399_4480858_-|transposase	IS200/IS605 family transposase IS200F	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
AVE65601.1|4480814_4480997_-	hypothetical protein	NA	NA	NA	NA	NA
AVE65602.1|4481048_4482734_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.8e-34
AVE65603.1|4482753_4482960_+	hypothetical protein	NA	NA	NA	NA	NA
AVE65604.1|4482938_4483520_-	hypothetical protein	NA	NA	NA	NA	NA
AVE65605.1|4483591_4484287_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AVE65606.1|4484344_4486255_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
AVE65607.1|4486385_4486730_+	RidA family protein	NA	NA	NA	NA	NA
AVE65608.1|4486735_4486915_-	YoaH family protein	NA	NA	NA	NA	NA
AVE65609.1|4486995_4488360_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	35.0	1.9e-44
AVE65610.1|4488363_4488942_+	coenzyme A pyrophosphatase	NA	NA	NA	NA	NA
AVE65611.1|4489205_4490570_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AVE65612.1|4490707_4492309_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AVE65613.1|4492330_4493890_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
AVE65614.1|4493877_4494213_-	hypothetical protein	NA	NA	NA	NA	NA
AVE65615.1|4494362_4495331_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AVE65616.1|4495383_4496184_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AVE65617.1|4496196_4497048_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AVE65618.1|4497105_4497564_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
AVE66185.1|4497919_4498540_+	hypothetical protein	NA	NA	NA	NA	NA
AVE65619.1|4498536_4499346_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AVE65620.1|4499411_4501157_-	cell division protein FtsI	NA	NA	NA	NA	NA
AVE65621.1|4501376_4501586_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AVE65622.1|4501598_4501742_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AVE65623.1|4502390_4502678_-	hypothetical protein	NA	NA	NA	NA	NA
AVE65624.1|4502748_4502892_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
AVE65625.1|4503049_4503289_+	hypothetical protein	NA	NA	NA	NA	NA
AVE65626.1|4503500_4504292_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AVE65627.1|4504467_4505841_+	MFS transporter	NA	NA	NA	NA	NA
AVE65628.1|4505888_4506770_-|protease	protease HtpX	protease	NA	NA	NA	NA
AVE65629.1|4506963_4509012_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
AVE65630.1|4509031_4509718_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AVE65631.1|4509815_4510400_-	Free methionine-R-sulfoxide reductase	NA	NA	NA	NA	NA
AVE65632.1|4510441_4511725_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AVE65633.1|4511687_4514327_+	MCE family protein	NA	NA	NA	NA	NA
AVE66186.1|4514404_4515844_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AVE65634.1|4515958_4516198_+	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
AVE65635.1|4516308_4516500_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVE65636.1|4516518_4517169_-	serine/threonine-protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
AVE65637.1|4517392_4517557_-	hypothetical protein	NA	NA	NA	NA	NA
AVE65638.1|4517841_4518564_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
AVE65639.1|4519247_4519643_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
AVE65640.1|4519972_4520449_+	hypothetical protein	NA	NA	NA	NA	NA
AVE65641.1|4520836_4521256_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVE65642.1|4521384_4521579_-	hypothetical protein	NA	NA	NA	NA	NA
AVE65643.1|4521625_4521895_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
AVE65644.1|4522060_4522201_+	hypothetical protein	NA	NA	NA	NA	NA
AVE65645.1|4523664_4524033_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	5.4e-18
AVE65646.1|4523970_4524228_-	hypothetical protein	NA	NA	NA	NA	NA
4524168:4524190	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
AVE66187.1|4524518_4524719_-	hypothetical protein	NA	NA	NA	NA	NA
AVE65647.1|4525336_4526251_+	protein PagO	NA	NA	NA	NA	NA
AVE65648.1|4526383_4526542_+	hypothetical protein	NA	NA	NA	NA	NA
AVE65649.1|4526551_4527166_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
AVE65650.1|4527918_4528185_-	hypothetical protein	NA	NA	NA	NA	NA
AVE65651.1|4528313_4528439_-	arsenic transporter	NA	NA	NA	NA	NA
AVE65652.1|4528701_4528818_+|tail	phage tail protein	tail	NA	NA	NA	NA
AVE65653.1|4529008_4529209_+	phage virulence factor	NA	NA	NA	NA	NA
AVE65654.1|4529305_4530187_-|tail	phage tail protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
AVE65655.1|4530659_4530848_+	hypothetical protein	NA	NA	NA	NA	NA
AVE65656.1|4530912_4531080_+	lytic enzyme	NA	NA	NA	NA	NA
AVE65657.1|4531336_4531870_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
AVE65658.1|4531923_4532154_-	lytic enzyme	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
AVE66190.1|4532343_4532838_+	RecE	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
AVE66188.1|4532897_4533752_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
AVE66189.1|4533948_4534068_-	hypothetical protein	NA	NA	NA	NA	NA
4533883:4533905	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
AVE65659.1|4534125_4534479_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AVE65660.1|4534495_4535371_-	hypothetical protein	NA	NA	NA	NA	NA
AVE65661.1|4535371_4535746_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AVE65662.1|4535883_4536114_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 8
CP026700	Salmonella enterica subsp. enterica serovar Typhimurium strain AR_0031 chromosome, complete genome	4870262	4611564	4690908	4870262	portal,protease,integrase,plate,transposase,tail,holin,head,lysis,capsid,terminase	Salmonella_phage(85.07%)	107	4618102:4618117	4692531:4692546
AVE65740.1|4611564_4612023_-|transposase	IS200/IS605 family transposase IS200F	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
AVE65741.1|4612203_4613409_-	lysine-N-methylase	NA	NA	NA	NA	NA
AVE65742.1|4613487_4614975_-	flagellin FliC	NA	NA	NA	NA	NA
AVE65743.1|4615231_4616635_+	flagellar hook-associated protein 2	NA	NA	NA	NA	NA
AVE65744.1|4616649_4617057_+	flagellar protein FliS	NA	NA	NA	NA	NA
AVE65745.1|4617056_4617425_+	flagellar protein FliT	NA	NA	NA	NA	NA
AVE65746.1|4617496_4618981_+	alpha-amylase	NA	NA	NA	NA	NA
4618102:4618117	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
AVE65747.1|4619020_4619446_-	hypothetical protein	NA	NA	NA	NA	NA
AVE65748.1|4619571_4620837_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
AVE65749.1|4620833_4621067_+	SirA-like protein	NA	NA	NA	NA	NA
AVE65750.1|4621331_4621718_+	hypothetical protein	NA	NA	NA	NA	NA
AVE65751.1|4621837_4622152_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
AVE65752.1|4622368_4624051_+	flagellar M-ring protein	NA	NA	NA	NA	NA
AVE65753.1|4624043_4625039_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AVE65754.1|4625031_4625739_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AVE65755.1|4625738_4627109_+	flagellum-specific ATP synthase	NA	NA	NA	NA	NA
AVE65756.1|4627130_4627574_+	flagellar protein FliJ	NA	NA	NA	NA	NA
AVE65757.1|4627570_4628788_+	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
AVE65758.1|4628892_4629360_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
AVE65759.1|4629364_4630369_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AVE65760.1|4630365_4630779_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AVE65761.1|4630778_4631156_+	flagellar protein FliO	NA	NA	NA	NA	NA
AVE65762.1|4631155_4631893_+	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
AVE65763.1|4631902_4632172_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
AVE65764.1|4632180_4632975_+	flagellar biosynthesis protein FliR	NA	NA	NA	NA	NA
AVE65765.1|4633256_4633880_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AVE65766.1|4633918_4634167_-	DsrB protein	NA	NA	NA	NA	NA
AVE66192.1|4634241_4634469_+	DUF2525 domain-containing protein	NA	NA	NA	NA	NA
AVE65767.1|4634778_4635594_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
AVE65768.1|4635572_4637285_-	cellulose synthesis regulatory protein	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
AVE65769.1|4637449_4637695_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AVE65770.1|4637711_4638629_-	hypothetical protein	NA	NA	NA	NA	NA
AVE65771.1|4638798_4639719_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AVE65772.1|4639707_4640178_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
AVE65773.1|4640158_4641589_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AVE65774.1|4641662_4642358_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AVE65775.1|4642449_4642749_-	hypothetical protein	NA	NA	NA	NA	NA
AVE65776.1|4643398_4644595_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
AVE66193.1|4644855_4645044_-	cold-shock protein	NA	NA	NA	NA	NA
AVE65777.1|4645054_4645267_-	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AVE65778.1|4645721_4646990_-	protein UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
AVE65779.1|4646992_4647412_-	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AVE65780.1|4647538_4647700_-	hypothetical protein	NA	NA	NA	NA	NA
AVE65781.1|4647677_4647920_-	hypothetical protein	NA	NA	NA	NA	NA
AVE65782.1|4648001_4648217_+	hypothetical protein	NA	NA	NA	NA	NA
AVE65783.1|4648330_4648552_-	DNA-binding protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
AVE65784.1|4648764_4649772_+	non-LEE encoded effector protein NleB	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
AVE65785.1|4650056_4650626_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
AVE65786.1|4650625_4652188_-|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	100.0	2.6e-287
AVE65787.1|4652174_4652762_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
AVE65788.1|4652764_4653286_-|tail	phage tail protein	tail	Q8HAB6	Salmonella_phage	100.0	2.9e-94
AVE65789.1|4653320_4653866_-|head	head assembly protein	head	Q8HAB7	Salmonella_phage	100.0	9.2e-99
AVE65790.1|4653837_4654251_-	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
AVE65791.1|4654255_4654789_-|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
AVE65792.1|4654788_4655847_-|plate	baseplate protein	plate	Q8HAC0	Salmonella_phage	100.0	1.3e-202
AVE65793.1|4655843_4657184_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
AVE65794.1|4657217_4659146_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
AVE65795.1|4659230_4659557_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
AVE65796.1|4659553_4659910_-|tail	phage tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
AVE65797.1|4659909_4661406_-|tail	phage tail protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
AVE65798.1|4661395_4661560_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
AVE65799.1|4661563_4662124_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
AVE65800.1|4662120_4662633_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
AVE65801.1|4662604_4663009_-|head,tail	head-tail adaptor protein	head,tail	Q8HAC9	Salmonella_phage	100.0	1.4e-72
AVE65802.1|4663005_4663329_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
AVE65803.1|4663331_4663532_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
AVE65804.1|4663582_4664788_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
AVE65805.1|4664802_4665489_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	6.5e-126
AVE65806.1|4665430_4666672_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
AVE65807.1|4666671_4666854_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
AVE65808.1|4666865_4668599_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
AVE65809.1|4668595_4669099_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	3.6e-89
AVE65810.1|4669215_4669566_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
AVE65811.1|4669626_4669929_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
AVE65812.1|4670148_4670568_-	hypothetical protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
AVE65813.1|4670780_4671266_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
AVE65814.1|4671262_4671877_-	endolysin	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
AVE65815.1|4671879_4672224_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
AVE65816.1|4672385_4672820_+	hypothetical protein	NA	NA	NA	NA	NA
AVE66194.1|4672749_4673007_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
AVE65817.1|4673139_4673763_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
AVE66195.1|4673773_4674763_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	9.2e-190
AVE65818.1|4674770_4675631_-	DNA-binding protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
AVE65819.1|4675647_4676037_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
AVE65820.1|4676033_4676927_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
AVE65821.1|4676926_4677451_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	2.4e-96
AVE65822.1|4677410_4678229_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
AVE65823.1|4678225_4678450_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
AVE65824.1|4678446_4679604_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
AVE65825.1|4679600_4680155_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
AVE65826.1|4680183_4680408_-	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
AVE65827.1|4680346_4680532_-	amino acid permease	NA	NA	NA	NA	NA
AVE65828.1|4680505_4681201_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
AVE65829.1|4681732_4681918_-	hypothetical protein	NA	NA	NA	NA	NA
AVE65830.1|4682015_4682387_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
AVE65831.1|4682444_4683272_+	DUF2303 domain-containing protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
AVE65832.1|4683408_4683948_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
AVE65833.1|4684018_4684249_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
AVE65834.1|4684245_4684761_+	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
AVE65835.1|4684757_4685375_+	hypothetical protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
AVE65836.1|4685371_4686205_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
AVE65837.1|4686208_4686778_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
AVE65838.1|4686802_4687045_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
AVE65839.1|4687046_4688036_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
AVE65840.1|4688327_4689125_+	protein MtfA	NA	NA	NA	NA	NA
AVE65841.1|4689496_4689787_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
AVE65842.1|4690434_4690908_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
4692531:4692546	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 9
CP026700	Salmonella enterica subsp. enterica serovar Typhimurium strain AR_0031 chromosome, complete genome	4870262	4776902	4787408	4870262		Enterobacteria_phage(37.5%)	10	NA	NA
AVE65927.1|4776902_4778216_-	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AVE65928.1|4778242_4779322_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
AVE65929.1|4779326_4780100_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AVE65930.1|4780096_4781089_-	protein RfbI	NA	NA	NA	NA	NA
AVE65931.1|4781094_4781646_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
AVE65932.1|4781646_4782525_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
AVE65933.1|4782572_4783472_-	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
AVE65934.1|4783471_4784557_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
AVE65935.1|4784933_4785827_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AVE65936.1|4786004_4787408_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 10
CP026700	Salmonella enterica subsp. enterica serovar Typhimurium strain AR_0031 chromosome, complete genome	4870262	4855716	4864887	4870262	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AVE65991.1|4855716_4857750_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
AVE65992.1|4857990_4858449_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AVE65993.1|4858620_4859151_+	hypothetical protein	NA	NA	NA	NA	NA
AVE65994.1|4859207_4859675_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AVE65995.1|4859721_4860441_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVE66201.1|4860437_4862123_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
AVE65996.1|4862345_4863077_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AVE65997.1|4863136_4863244_+	hypothetical protein	NA	NA	NA	NA	NA
AVE65998.1|4863224_4863956_-	ABC transporter permease	NA	NA	NA	NA	NA
AVE65999.1|4863939_4864887_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 1
CP026701	Salmonella enterica subsp. enterica serovar Typhimurium strain AR_0031 plasmid unitig_1_pilon, complete sequence	93832	976	10272	93832	transposase	Escherichia_phage(28.57%)	12	NA	NA
AVE66309.1|976_1393_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
AVE66203.1|1576_1912_+	hypothetical protein	NA	NA	NA	NA	NA
AVE66204.1|1968_2535_+	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
AVE66205.1|2566_3508_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
AVE66206.1|3922_5128_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
AVE66207.1|5124_6102_+	chromosome partitioning protein ParB	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
AVE66208.1|6183_7458_-	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
AVE66209.1|7457_7880_-	protein SamA	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
AVE66210.1|8390_8861_+	hypothetical protein	NA	NA	NA	NA	NA
AVE66211.1|8853_9210_+	hypothetical protein	NA	NA	NA	NA	NA
AVE66212.1|9258_9447_+	hypothetical protein	NA	NA	NA	NA	NA
AVE66213.1|9591_10272_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
