The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026707	Acinetobacter baumannii strain AR_0056 chromosome, complete genome	3993843	95439	102434	3993843	transposase,integrase	Acinetobacter_phage(81.82%)	12	92132:92145	102519:102532
92132:92145	attL	TAATAATAAATTGC	NA	NA	NA	NA
AVE44478.1|95439_96702_+|integrase	integrase	integrase	A0A0P0IKP2	Acinetobacter_phage	98.8	1.4e-246
AVE44479.1|96707_96977_-	DNA-binding protein	NA	A0A0N7IRE8	Acinetobacter_phage	100.0	3.5e-43
AVE44480.1|96977_97460_-	methyltransferase domain-containing protein	NA	A0A0N7IRF6	Acinetobacter_phage	72.3	5.7e-68
AVE44481.1|97456_97843_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	50.7	1.2e-12
AVE44482.1|97839_98127_-	hypothetical protein	NA	A0A0P0J0F2	Acinetobacter_phage	86.7	1.2e-36
AVE44483.1|98132_98498_-	hypothetical protein	NA	A0A1B1P9I4	Acinetobacter_phage	83.3	3.5e-54
AVE44484.1|98498_98789_-	hypothetical protein	NA	NA	NA	NA	NA
AVE44485.1|99622_100555_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	6.1e-58
AVE47927.1|100980_101343_+	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	100.0	1.0e-69
AVE44486.1|101335_101560_+	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
AVE44487.1|101559_101961_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.9	3.1e-67
AVE44488.1|101957_102434_+	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
102519:102532	attR	TAATAATAAATTGC	NA	NA	NA	NA
>prophage 2
CP026707	Acinetobacter baumannii strain AR_0056 chromosome, complete genome	3993843	940764	977592	3993843	transposase,plate	Pandoravirus(33.33%)	33	NA	NA
AVE45251.1|940764_941854_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AVE45252.1|942363_943626_-	FAD/NAD(P)-binding oxidoreductase	NA	NA	NA	NA	NA
AVE45253.1|943625_943856_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
AVE45254.1|943856_944960_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AVE45255.1|944956_945889_-	4-hydroxyproline 2-epimerase	NA	NA	NA	NA	NA
AVE45256.1|946057_946741_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVE45257.1|947158_948067_+	EamA family transporter	NA	NA	NA	NA	NA
AVE45258.1|948124_949060_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AVE45259.1|949991_951081_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AVE45260.1|951109_951544_-	hemolysin	NA	NA	NA	NA	NA
AVE45261.1|951705_952158_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
AVE45262.1|952347_952635_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45263.1|953061_953721_+	hypothetical protein	NA	NA	NA	NA	NA
AVE47960.1|954038_954494_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVE45264.1|954573_955731_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AVE45265.1|955864_957043_-	MFS transporter	NA	NA	NA	NA	NA
AVE45266.1|957042_957525_-	nucleoside deaminase	NA	S4VYT2	Pandoravirus	40.6	8.3e-19
AVE47961.1|957540_958188_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45267.1|958360_959212_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVE45268.1|959214_960168_-	D-alanyl-D-alanine carboxypeptidase	NA	A0A0H4TGB9	Bacillus_phage	33.3	2.8e-10
AVE45269.1|960175_960778_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45270.1|960790_961597_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45271.1|961614_962979_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVE45272.1|962995_964090_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AVE45273.1|964113_966795_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	30.8	1.3e-81
AVE45274.1|967014_967278_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AVE45275.1|967294_968062_-	OmpA family protein	NA	NA	NA	NA	NA
AVE45276.1|968064_969024_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
AVE45277.1|969061_972886_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AVE45278.1|972916_974329_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45279.1|974325_975324_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVE45280.1|975287_977099_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVE45281.1|977115_977592_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
CP026707	Acinetobacter baumannii strain AR_0056 chromosome, complete genome	3993843	1122088	1191278	3993843	tRNA,transposase	Escherichia_phage(33.33%)	57	NA	NA
AVE45412.1|1122088_1124725_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.6	1.8e-75
AVE45413.1|1124790_1126071_+	aspartate kinase	NA	NA	NA	NA	NA
AVE45414.1|1126317_1126572_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
AVE45415.1|1126641_1127208_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.4	1.8e-25
AVE45416.1|1127273_1127663_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45417.1|1127901_1128459_+	cytochrome b	NA	NA	NA	NA	NA
AVE45418.1|1128502_1129501_-	adenosine deaminase	NA	NA	NA	NA	NA
AVE45419.1|1129612_1130932_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.8	7.8e-59
AVE45420.1|1131254_1131482_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45421.1|1133187_1133892_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVE45422.1|1135084_1135627_-	tunicamycin resistance protein	NA	NA	NA	NA	NA
AVE45423.1|1135639_1136500_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
AVE45424.1|1136806_1137896_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AVE45425.1|1139208_1139968_+|transposase	IS5-like element ISKpn12 family transposase	transposase	NA	NA	NA	NA
AVE45426.1|1140036_1140588_+	hypothetical protein	NA	NA	NA	NA	NA
AVE45427.1|1140913_1141618_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVE45428.1|1141747_1142563_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
AVE45429.1|1142716_1142896_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45430.1|1143120_1143825_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVE45431.1|1144774_1145650_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVE45432.1|1145708_1146629_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVE45433.1|1146866_1148165_+	MFS transporter	NA	NA	NA	NA	NA
AVE45434.1|1148214_1149114_+	L(+)-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
AVE45435.1|1149110_1149719_+	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
AVE45436.1|1149762_1150776_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVE45437.1|1150912_1152400_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AVE45438.1|1152444_1153299_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVE45439.1|1153371_1154265_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVE45440.1|1154293_1155964_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
AVE45441.1|1156023_1157304_-	outer membrane porin, OprD family	NA	NA	NA	NA	NA
AVE45442.1|1157335_1158682_-	MFS transporter	NA	NA	NA	NA	NA
AVE47965.1|1160769_1161723_+	formylglycine-generating enzyme family protein	NA	NA	NA	NA	NA
AVE45443.1|1161735_1162923_+	outer membrane porin, OprD family	NA	NA	NA	NA	NA
AVE45444.1|1163156_1164233_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
AVE45445.1|1164245_1165190_+	oxidoreductase	NA	NA	NA	NA	NA
AVE45446.1|1165233_1165926_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVE45447.1|1166032_1166491_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVE45448.1|1166561_1167794_-	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
AVE45449.1|1168047_1168881_+	p-hydroxycinnamoyl CoA hydratase/lyase	NA	NA	NA	NA	NA
AVE45450.1|1168918_1170370_+	salicylaldehyde dehydrogenase	NA	NA	NA	NA	NA
AVE45451.1|1170460_1172338_+	feruloyl-CoA synthase	NA	NA	NA	NA	NA
AVE45452.1|1172412_1173552_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVE45453.1|1173663_1174884_+	outer membrane porin, OprD family	NA	NA	NA	NA	NA
AVE45454.1|1174940_1175477_+	DUF3237 domain-containing protein	NA	NA	NA	NA	NA
AVE45455.1|1175517_1175907_+	PaaI family thioesterase	NA	NA	NA	NA	NA
AVE45456.1|1175940_1177692_+	tannase/feruloyl esterase family alpha/beta hydrolase	NA	NA	NA	NA	NA
AVE45457.1|1177756_1178470_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
AVE45458.1|1178712_1180299_-	aldehyde dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AVE45459.1|1180329_1181241_-	5-dehydro-4-deoxyglucarate dehydratase	NA	NA	NA	NA	NA
AVE45460.1|1181403_1182735_-	glucarate dehydratase	NA	NA	NA	NA	NA
AVE45461.1|1183020_1184379_+	MFS transporter	NA	NA	NA	NA	NA
AVE45462.1|1184449_1185997_+	galactarate dehydratase	NA	NA	NA	NA	NA
AVE45463.1|1186121_1187018_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AVE45464.1|1187033_1188104_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVE45465.1|1188233_1189694_+	coniferyl aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVE45466.1|1189775_1190312_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45467.1|1190345_1191278_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	6.1e-58
>prophage 4
CP026707	Acinetobacter baumannii strain AR_0056 chromosome, complete genome	3993843	1256775	1292654	3993843	head,transposase,tail,terminase,integrase	Acinetobacter_phage(88.24%)	42	1252957:1252972	1290653:1290668
1252957:1252972	attL	ATCTTGAGTTAAAGCA	NA	NA	NA	NA
AVE45513.1|1256775_1258149_+|integrase	integrase	integrase	A0A0R6PGY7	Moraxella_phage	41.5	1.9e-76
AVE45514.1|1258238_1258727_+	hypothetical protein	NA	NA	NA	NA	NA
AVE45515.1|1259037_1260684_-	lipid A phosphoethanolamine transferase	NA	NA	NA	NA	NA
AVE45516.1|1260923_1261856_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	6.1e-58
AVE47973.1|1263980_1264526_-	hypothetical protein	NA	A0A0B5L5G7	Acinetobacter_phage	100.0	4.7e-103
AVE45517.1|1264567_1264957_-	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	99.2	3.3e-66
AVE45518.1|1265024_1268450_-	hypothetical protein	NA	A0A0P0HSH9	Acinetobacter_phage	94.2	0.0e+00
AVE45519.1|1268442_1268805_-	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	79.2	8.1e-51
AVE45520.1|1268801_1269308_-	DUF1833 domain-containing protein	NA	J7HXQ5	Acinetobacter_phage	97.0	1.5e-90
AVE45521.1|1269307_1269706_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	4.1e-72
AVE45522.1|1269798_1270386_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45523.1|1270476_1274787_-|tail	phage tail tape measure protein	tail	A0A0D4DC37	Acinetobacter_phage	98.3	0.0e+00
AVE45524.1|1274914_1275178_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45525.1|1275179_1275860_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
AVE45526.1|1275964_1276423_-	transcriptional regulator	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
AVE45527.1|1276431_1276731_-	DUF4258 domain-containing protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
AVE45528.1|1276976_1277306_-	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	55.1	4.5e-24
AVE45529.1|1277233_1277749_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.6	2.5e-77
AVE45530.1|1277818_1278736_-	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	98.0	1.0e-166
AVE45531.1|1278788_1279967_-|tail	phage tail protein	tail	A0A0D4DCQ4	Acinetobacter_phage	65.8	1.3e-102
AVE45532.1|1279966_1280320_-	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
AVE45533.1|1280416_1280938_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AVE45534.1|1281046_1281265_-	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
AVE45535.1|1281266_1281710_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	95.2	3.1e-76
AVE45536.1|1281666_1282035_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	82.8	2.0e-52
AVE45537.1|1282006_1282417_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.3	7.7e-50
AVE45538.1|1282468_1282762_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45539.1|1282769_1282967_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45540.1|1283035_1283404_-	glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	92.6	8.7e-61
AVE45541.1|1283404_1283785_-	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	84.9	6.9e-53
AVE45542.1|1283788_1284124_-	HeH/LEM domain protein	NA	A0A0N7IRE4	Acinetobacter_phage	99.1	6.1e-53
AVE45543.1|1284168_1285119_-	methyltransferase	NA	A0A0P0HSG2	Acinetobacter_phage	94.9	3.7e-172
AVE45544.1|1285132_1285924_-	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	74.2	2.3e-90
AVE45545.1|1286010_1286325_-	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	50.5	5.2e-14
AVE45546.1|1286544_1286775_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45547.1|1286771_1287878_-|head	phage head morphogenesis protein	head	A0A0P0IR98	Acinetobacter_phage	90.2	2.1e-190
AVE45548.1|1287887_1289228_-	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	92.2	3.4e-235
AVE45549.1|1289267_1290560_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	86.0	6.4e-215
AVE45550.1|1290519_1291035_-	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.3	3.2e-45
1290653:1290668	attR	TGCTTTAACTCAAGAT	NA	NA	NA	NA
AVE45551.1|1291093_1291735_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	88.7	6.3e-115
AVE45552.1|1291703_1292138_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	84.7	7.4e-67
AVE45553.1|1292198_1292654_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	95.4	2.7e-80
>prophage 5
CP026707	Acinetobacter baumannii strain AR_0056 chromosome, complete genome	3993843	1296612	1324827	3993843		Acinetobacter_phage(97.37%)	38	NA	NA
AVE45560.1|1296612_1297089_-	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
AVE45561.1|1297085_1297487_-	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.9	3.1e-67
AVE45562.1|1297486_1297711_-	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
AVE47974.1|1297703_1298066_-	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	100.0	1.0e-69
AVE45563.1|1298115_1298538_-	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	100.0	1.0e-76
AVE45564.1|1298655_1299405_-	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	97.2	6.4e-135
AVE45565.1|1299397_1300327_-	DUF1376 domain-containing protein	NA	A0A0P0I481	Acinetobacter_phage	99.0	1.1e-171
AVE45566.1|1300326_1300680_-	hypothetical protein	NA	A0A0P0IVS7	Acinetobacter_phage	97.5	2.0e-54
AVE45567.1|1300676_1300973_-	hypothetical protein	NA	J7HXM0	Acinetobacter_phage	99.0	2.3e-48
AVE45568.1|1300969_1301242_-	hypothetical protein	NA	J7I0V3	Acinetobacter_phage	97.8	2.2e-40
AVE45569.1|1301302_1301659_-	transcriptional regulator	NA	J7I452	Acinetobacter_phage	100.0	6.1e-59
AVE45570.1|1301668_1301854_-	hypothetical protein	NA	J7HXD2	Acinetobacter_phage	100.0	4.9e-28
AVE45571.1|1301932_1302697_+	phage repressor protein	NA	J7I4M9	Acinetobacter_phage	99.2	5.5e-142
AVE45572.1|1302711_1302927_+	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
AVE45573.1|1302978_1303986_+	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
AVE45574.1|1303987_1304491_+	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
AVE45575.1|1304629_1304833_+	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
AVE45576.1|1304839_1305082_-	hypothetical protein	NA	A0A0P0I4B0	Acinetobacter_phage	100.0	5.2e-38
AVE45577.1|1305267_1305708_+	hypothetical protein	NA	A0A0D4DBH9	Acinetobacter_phage	95.2	8.3e-74
AVE45578.1|1305707_1305998_+	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	97.9	6.0e-49
AVE45579.1|1305990_1306314_+	hypothetical protein	NA	A0A0P0IVW1	Acinetobacter_phage	79.4	1.5e-43
AVE45580.1|1306324_1307446_+	AAA family ATPase	NA	A0A0D4DBX7	Acinetobacter_phage	99.7	1.3e-211
AVE45581.1|1307442_1308519_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	75.1	5.1e-141
AVE45582.1|1308520_1308766_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	1.5e-40
AVE45583.1|1308769_1309219_+	DUF551 domain-containing protein	NA	A0A0P0HSE1	Acinetobacter_phage	93.1	6.0e-80
AVE45584.1|1309215_1309425_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	92.8	4.1e-31
AVE45585.1|1309421_1309637_+	hypothetical protein	NA	I2GUB6	Acinetobacter_phage	94.3	3.8e-32
AVE45586.1|1309637_1309907_+	hypothetical protein	NA	A0A0P0J067	Acinetobacter_phage	100.0	8.7e-42
AVE45587.1|1310021_1310606_+	type 1 glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	1.7e-111
AVE45588.1|1310701_1313401_-	aminopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	100.0	0.0e+00
AVE45589.1|1313480_1316213_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	99.9	0.0e+00
AVE47975.1|1316568_1317618_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
AVE45590.1|1317627_1318434_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	98.5	1.9e-145
AVE45591.1|1318443_1319139_+	DNA mismatch repair protein MutS	NA	A0A0P0IDT4	Acinetobacter_phage	99.6	9.9e-122
AVE45592.1|1319149_1320133_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	95.7	9.2e-182
AVE45593.1|1320139_1322515_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	99.4	0.0e+00
AVE45594.1|1322516_1324016_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	100.0	6.1e-286
AVE45595.1|1324272_1324827_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	2.7e-98
>prophage 6
CP026707	Acinetobacter baumannii strain AR_0056 chromosome, complete genome	3993843	1770344	1823278	3993843	head,tail,capsid,terminase,integrase	Acinetobacter_phage(92.86%)	73	1770156:1770176	1824017:1824037
1770156:1770176	attL	TTCGAGTCCCGCAGGGCGCAC	NA	NA	NA	NA
AVE45944.1|1770344_1771589_+|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	42.5	3.6e-82
AVE45945.1|1771581_1771779_-	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	66.7	3.7e-10
AVE45946.1|1771916_1772321_+	hypothetical protein	NA	NA	NA	NA	NA
AVE45947.1|1772361_1772868_+	hypothetical protein	NA	NA	NA	NA	NA
AVE45948.1|1772987_1773254_+	hypothetical protein	NA	NA	NA	NA	NA
AVE45949.1|1773459_1774002_-	hypothetical protein	NA	J7I0Y1	Acinetobacter_phage	88.9	1.2e-90
AVE45950.1|1774340_1775240_-	alpha/beta hydrolase	NA	A0A0P0J0J7	Acinetobacter_phage	85.4	4.2e-149
AVE45951.1|1775405_1775666_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AVE45952.1|1775685_1776177_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45953.1|1776233_1776560_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45954.1|1776563_1776905_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45955.1|1777103_1777493_-	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	98.4	5.6e-66
AVE45956.1|1777560_1781007_-	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	99.1	0.0e+00
AVE45957.1|1780999_1781362_-	hypothetical protein	NA	A0A0D4DCJ1	Acinetobacter_phage	100.0	2.3e-66
AVE45958.1|1781358_1781865_-	DUF1833 domain-containing protein	NA	A0A0P0IKN4	Acinetobacter_phage	99.4	3.1e-93
AVE45959.1|1781864_1782263_-	hypothetical protein	NA	A0A0P0IY66	Acinetobacter_phage	96.2	3.5e-71
AVE45960.1|1782327_1782720_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45961.1|1782723_1783476_-	hypothetical protein	NA	J7HXF9	Acinetobacter_phage	35.6	3.4e-35
AVE45962.1|1783550_1788737_-|tail	phage tail protein	tail	J7I4Q7	Acinetobacter_phage	66.3	0.0e+00
AVE45963.1|1789217_1789724_-	DUF4468 domain-containing protein	NA	A0A0P0I8L3	Acinetobacter_phage	34.1	1.6e-12
AVE45964.1|1789832_1790360_-	DUF4411 domain-containing protein	NA	NA	NA	NA	NA
AVE45965.1|1790359_1791481_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AVE45966.1|1791604_1791925_-	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	57.7	3.9e-25
AVE47991.1|1791852_1792362_-	hypothetical protein	NA	A0A0P0J095	Acinetobacter_phage	86.0	2.2e-62
AVE45967.1|1792433_1793351_-	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	98.4	7.8e-167
AVE45968.1|1793447_1794596_-|tail	phage tail protein	tail	A0A0D4DCQ4	Acinetobacter_phage	80.2	6.8e-152
AVE45969.1|1794595_1794949_-	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	95.7	6.6e-58
AVE45970.1|1795044_1795263_-	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	94.4	4.3e-31
AVE45971.1|1795264_1795663_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	91.7	6.1e-68
AVE47992.1|1795664_1796033_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	93.4	5.1e-61
AVE45972.1|1796004_1796412_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.1	9.1e-51
AVE45973.1|1796627_1797302_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45974.1|1797339_1797708_-	glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	98.4	6.5e-64
AVE45975.1|1797709_1798099_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	100.0	6.6e-67
AVE45976.1|1798103_1798769_-	stress-responsive nuclear envelope protein	NA	A0A0D4DBW4	Acinetobacter_phage	68.8	1.5e-71
AVE45977.1|1798835_1799792_-|capsid	phage capsid protein	capsid	A0A0D4DBM4	Acinetobacter_phage	99.7	6.0e-178
AVE45978.1|1799819_1800587_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
AVE45979.1|1800700_1800892_-	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
AVE45980.1|1801109_1801352_-	hypothetical protein	NA	A0A0P0IY55	Acinetobacter_phage	100.0	2.1e-39
AVE45981.1|1801450_1801879_-	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	99.3	3.4e-72
AVE45982.1|1801887_1802991_-|head	phage head morphogenesis protein	head	A0A0D4DBL9	Acinetobacter_phage	98.1	4.0e-202
AVE45983.1|1802997_1804443_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	96.3	1.1e-276
AVE45984.1|1804439_1805867_-|terminase	terminase	terminase	A0A0D4DCE6	Acinetobacter_phage	98.3	6.5e-269
AVE45985.1|1805856_1806327_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	85.3	2.4e-71
AVE45986.1|1806995_1807463_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	76.8	9.7e-65
AVE45987.1|1807634_1807838_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45988.1|1808894_1809125_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45989.1|1809305_1809869_-	hypothetical protein	NA	A0A1B1P9I8	Acinetobacter_phage	52.5	3.2e-46
AVE45990.1|1809890_1810175_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45991.1|1810184_1810592_-	DUF1064 domain-containing protein	NA	A0A0R6PIZ9	Moraxella_phage	51.8	4.0e-22
AVE45992.1|1810588_1810990_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45993.1|1810976_1811159_-	hypothetical protein	NA	NA	NA	NA	NA
AVE45994.1|1811155_1811554_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	48.5	1.5e-26
AVE45995.1|1811565_1812432_-	hypothetical protein	NA	A0A2H4J5Y9	uncultured_Caudovirales_phage	43.7	1.4e-72
AVE45996.1|1812883_1813987_-	hypothetical protein	NA	A0A0P0IKQ2	Acinetobacter_phage	56.1	1.4e-29
AVE45997.1|1813983_1814838_-	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
AVE45998.1|1814834_1815146_-	hypothetical protein	NA	J7HXM0	Acinetobacter_phage	62.0	2.2e-25
AVE45999.1|1815142_1815418_-	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	96.7	6.3e-40
AVE46000.1|1815473_1815794_-	transcriptional regulator	NA	A0A0P0HSE9	Acinetobacter_phage	87.7	3.5e-42
AVE46001.1|1815804_1816056_-	hypothetical protein	NA	A0A0N7IRE1	Acinetobacter_phage	94.0	9.2e-38
AVE46002.1|1816164_1816929_+	phage repressor protein	NA	A0A0P0J076	Acinetobacter_phage	98.0	1.7e-143
AVE46003.1|1816943_1817159_+	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
AVE46004.1|1817210_1818218_+	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
AVE46005.1|1818219_1818723_+	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
AVE46006.1|1818861_1819065_+	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
AVE46007.1|1819071_1819314_-	hypothetical protein	NA	A0A0P0I4B0	Acinetobacter_phage	100.0	5.2e-38
AVE46008.1|1819501_1819942_+	hypothetical protein	NA	A0A0N7IRE9	Acinetobacter_phage	96.6	2.4e-73
AVE46009.1|1819944_1820268_+	hypothetical protein	NA	A0A0P0IRC4	Acinetobacter_phage	99.1	1.5e-56
AVE46010.1|1820279_1821401_+	AAA family ATPase	NA	A0A0N7IRE0	Acinetobacter_phage	99.5	4.4e-212
AVE46011.1|1821397_1822372_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	81.8	1.7e-143
AVE46012.1|1822373_1822619_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	98.8	3.3e-40
AVE46013.1|1822622_1823072_+	DUF551 domain-containing protein	NA	A0A0P0HSE1	Acinetobacter_phage	92.4	1.3e-79
AVE46014.1|1823068_1823278_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	94.2	3.7e-32
1824017:1824037	attR	TTCGAGTCCCGCAGGGCGCAC	NA	NA	NA	NA
>prophage 7
CP026707	Acinetobacter baumannii strain AR_0056 chromosome, complete genome	3993843	3507520	3555864	3993843	head,transposase,tail,capsid,terminase,integrase	Acinetobacter_phage(92.98%)	65	3507330:3507345	3552011:3552026
3507330:3507345	attL	CCCGCCATCTCCACCA	NA	NA	NA	NA
AVE47458.1|3507520_3508672_+|integrase	integrase	integrase	A0A2H4J339	uncultured_Caudovirales_phage	62.3	1.6e-132
AVE47459.1|3508656_3509340_+	hypothetical protein	NA	NA	NA	NA	NA
AVE47460.1|3509531_3509816_-	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	92.6	1.8e-42
AVE47461.1|3509812_3510262_-	DUF551 domain-containing protein	NA	A0A0P0HSE1	Acinetobacter_phage	97.2	3.4e-83
AVE47462.1|3510265_3510511_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	1.5e-40
AVE47463.1|3510512_3511589_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	75.4	4.6e-142
AVE47464.1|3511585_3512707_-	AAA family ATPase	NA	A0A0D4DBX7	Acinetobacter_phage	99.5	6.3e-211
AVE47465.1|3512717_3513041_-	hypothetical protein	NA	A0A0P0IKP4	Acinetobacter_phage	98.1	5.7e-56
AVE47466.1|3513043_3513484_-	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	99.3	6.8e-76
AVE47467.1|3513679_3515947_-	response regulator	NA	J7I0U9	Acinetobacter_phage	100.0	0.0e+00
AVE47468.1|3516079_3516295_-	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	100.0	2.5e-31
AVE48070.1|3516315_3516978_-	LexA family transcriptional regulator	NA	A0A0P0IYD9	Acinetobacter_phage	100.0	2.3e-120
AVE47469.1|3517091_3517292_+	transcriptional regulator	NA	A0A0P0IKT3	Acinetobacter_phage	100.0	3.5e-32
AVE47470.1|3517302_3517659_+	transcriptional regulator	NA	J7I452	Acinetobacter_phage	98.3	8.8e-58
AVE47471.1|3517618_3518005_+	hypothetical protein	NA	NA	NA	NA	NA
AVE47472.1|3518001_3519048_+	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	57.9	1.7e-109
AVE47473.1|3519044_3519995_+	DUF1376 domain-containing protein	NA	A0A0P0I481	Acinetobacter_phage	63.3	1.6e-98
AVE47474.1|3519987_3520737_+	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	99.6	6.2e-138
AVE47475.1|3520733_3521156_+	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	100.0	2.9e-76
AVE48071.1|3521205_3521568_+	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	100.0	1.0e-69
AVE47476.1|3521560_3521785_+	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
AVE47477.1|3521784_3522180_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	100.0	1.6e-68
AVE47478.1|3522176_3522677_+	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	100.0	3.1e-93
AVE47479.1|3522872_3523523_+	hypothetical protein	NA	A0A0P0IKQ5	Acinetobacter_phage	99.5	2.1e-94
AVE47480.1|3523712_3523904_+	hypothetical protein	NA	J7I0V8	Acinetobacter_phage	85.7	5.8e-24
AVE47481.1|3523916_3524345_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	66.2	3.5e-45
AVE47482.1|3524313_3524955_+	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	98.6	5.2e-125
AVE47483.1|3525013_3525484_+	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	85.3	2.4e-71
AVE47484.1|3525473_3526901_+|terminase	terminase	terminase	A0A0D4DCE6	Acinetobacter_phage	98.3	6.5e-269
AVE47485.1|3526897_3528343_+	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	96.3	1.1e-276
AVE47486.1|3528349_3529453_+|head	phage head morphogenesis protein	head	A0A0D4DBL9	Acinetobacter_phage	98.1	4.0e-202
AVE47487.1|3529461_3529890_+	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	99.3	3.4e-72
AVE47488.1|3530050_3531270_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.6	3.1e-78
AVE47489.1|3531291_3531543_+	hypothetical protein	NA	A0A0P0IY55	Acinetobacter_phage	98.7	1.7e-36
AVE47490.1|3531760_3531952_+	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
AVE47491.1|3532065_3532833_+	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
AVE47492.1|3532860_3533817_+|capsid	phage capsid protein	capsid	A0A0D4DBM4	Acinetobacter_phage	99.7	6.0e-178
AVE47493.1|3533883_3534549_+	stress-responsive nuclear envelope protein	NA	A0A0D4DBW4	Acinetobacter_phage	68.8	1.5e-71
AVE47494.1|3534553_3534943_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	100.0	6.6e-67
AVE47495.1|3534944_3535313_+	glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	98.4	6.5e-64
AVE47496.1|3535350_3536025_+	hypothetical protein	NA	NA	NA	NA	NA
AVE47497.1|3536240_3536648_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.1	9.1e-51
AVE48072.1|3536619_3536988_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	93.4	5.1e-61
AVE47498.1|3536989_3537388_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	91.7	6.1e-68
AVE47499.1|3537389_3537608_+	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	94.4	4.3e-31
AVE47500.1|3537703_3538057_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	95.7	6.6e-58
AVE47501.1|3538056_3539205_+|tail	phage tail protein	tail	A0A0D4DCQ4	Acinetobacter_phage	80.2	2.8e-158
AVE47502.1|3539257_3540175_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	98.0	1.0e-166
AVE47503.1|3540244_3540760_+	hypothetical protein	NA	A0A0D4DBX8	Acinetobacter_phage	97.9	1.4e-77
AVE47504.1|3540687_3541017_+	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	58.0	8.2e-26
AVE47505.1|3541085_3541268_+	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
AVE47506.1|3541360_3541765_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	100.0	3.9e-70
AVE47507.1|3541863_3542544_+	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
AVE47508.1|3542545_3542809_+	hypothetical protein	NA	NA	NA	NA	NA
AVE47509.1|3542936_3547271_+|tail	phage tail tape measure protein	tail	A0A0D4DC37	Acinetobacter_phage	71.0	0.0e+00
AVE47510.1|3547899_3548298_+	hypothetical protein	NA	A0A0P0IY66	Acinetobacter_phage	95.5	1.0e-70
AVE47511.1|3548297_3548804_+	DUF1833 domain-containing protein	NA	A0A0D4DCA4	Acinetobacter_phage	99.4	2.7e-92
AVE47512.1|3548800_3549163_+	hypothetical protein	NA	A0A0D4DCJ1	Acinetobacter_phage	98.3	4.4e-65
AVE47513.1|3549155_3552602_+	hypothetical protein	NA	A0A0D4DBG7	Acinetobacter_phage	97.8	0.0e+00
3552011:3552026	attR	TGGTGGAGATGGCGGG	NA	NA	NA	NA
AVE47514.1|3552669_3553059_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	98.4	5.6e-66
AVE47515.1|3553257_3553599_+	hypothetical protein	NA	NA	NA	NA	NA
AVE47516.1|3553602_3553929_+	hypothetical protein	NA	NA	NA	NA	NA
AVE47517.1|3553985_3554477_+	hypothetical protein	NA	NA	NA	NA	NA
AVE47518.1|3554496_3554757_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AVE47519.1|3554922_3555864_+	alpha/beta hydrolase	NA	A0A0P0J0J7	Acinetobacter_phage	85.4	4.4e-149
>prophage 8
CP026707	Acinetobacter baumannii strain AR_0056 chromosome, complete genome	3993843	3704485	3761808	3993843	head,transposase,tail,terminase,protease	Acinetobacter_phage(89.29%)	78	NA	NA
AVE47638.1|3704485_3705208_-	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	88.2	1.7e-55
AVE47639.1|3705204_3705612_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
AVE47640.1|3705612_3705864_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	6.4e-39
AVE47641.1|3705865_3706798_-	hypothetical protein	NA	A0A0P0I438	Acinetobacter_phage	80.0	2.2e-137
AVE47642.1|3706794_3707916_-	AAA family ATPase	NA	A0A0N7IRE0	Acinetobacter_phage	99.5	2.8e-211
AVE47643.1|3707927_3708251_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	95.3	4.8e-55
AVE47644.1|3708243_3708534_-	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	95.8	5.1e-48
AVE47645.1|3708533_3708977_-	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	94.5	1.7e-71
AVE48084.1|3709170_3709413_+	hypothetical protein	NA	A0A0P0I4B0	Acinetobacter_phage	100.0	5.2e-38
AVE47646.1|3709419_3709623_-	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
AVE47647.1|3709761_3710265_-	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
AVE47648.1|3710266_3711274_-	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
AVE47649.1|3711325_3711541_-	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
AVE47650.1|3711555_3712308_-	phage repressor protein	NA	J7I4M9	Acinetobacter_phage	74.3	5.5e-102
AVE47651.1|3712412_3712601_+	hypothetical protein	NA	NA	NA	NA	NA
AVE47652.1|3712611_3712932_+	transcriptional regulator	NA	A0A0P0HSE9	Acinetobacter_phage	87.7	1.2e-42
AVE47653.1|3712987_3713266_+	hypothetical protein	NA	J7I0V3	Acinetobacter_phage	90.2	6.6e-37
AVE47654.1|3713337_3713562_+	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	97.3	3.2e-34
AVE47655.1|3713554_3714436_+	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	95.2	3.3e-138
AVE47656.1|3714438_3715239_+	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	95.5	2.8e-144
AVE47657.1|3715235_3715574_+	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	56.3	1.1e-30
AVE47658.1|3715967_3716369_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.9	3.1e-67
AVE47659.1|3716365_3716842_+	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
AVE47660.1|3716813_3717068_+	hypothetical protein	NA	NA	NA	NA	NA
AVE47661.1|3717313_3717532_+	hypothetical protein	NA	NA	NA	NA	NA
AVE47662.1|3717745_3718297_+	hypothetical protein	NA	NA	NA	NA	NA
AVE47663.1|3718470_3718704_-	hypothetical protein	NA	NA	NA	NA	NA
AVE47664.1|3719346_3719691_+	hypothetical protein	NA	NA	NA	NA	NA
AVE47665.1|3719808_3721027_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.6	3.1e-78
AVE47666.1|3721211_3721448_+	hypothetical protein	NA	NA	NA	NA	NA
AVE47667.1|3722112_3722568_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	95.4	2.7e-80
AVE47668.1|3722628_3723063_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	84.7	7.4e-67
AVE47669.1|3723031_3723673_+	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	88.7	6.3e-115
AVE47670.1|3723731_3724247_+	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.3	3.2e-45
AVE47671.1|3724206_3725499_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	86.0	6.4e-215
AVE47672.1|3725538_3726879_+	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	92.2	3.4e-235
AVE47673.1|3726888_3727995_+|head	phage head morphogenesis protein	head	A0A0P0IR98	Acinetobacter_phage	90.2	2.1e-190
AVE47674.1|3727991_3728222_+	hypothetical protein	NA	NA	NA	NA	NA
AVE47675.1|3728441_3728756_+	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	50.5	5.2e-14
AVE47676.1|3728842_3729634_+	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	74.2	2.3e-90
AVE47677.1|3729647_3730598_+	methyltransferase	NA	A0A0P0HSG2	Acinetobacter_phage	94.9	3.7e-172
AVE47678.1|3730642_3730978_+	HeH/LEM domain protein	NA	A0A0N7IRE4	Acinetobacter_phage	99.1	6.1e-53
AVE47679.1|3730981_3731362_+	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	84.9	6.9e-53
AVE47680.1|3731362_3731731_+	glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	92.6	8.7e-61
AVE47681.1|3731799_3731997_+	hypothetical protein	NA	NA	NA	NA	NA
AVE47682.1|3732004_3732298_+	hypothetical protein	NA	NA	NA	NA	NA
AVE47683.1|3732349_3732760_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.3	7.7e-50
AVE47684.1|3732731_3733100_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	82.8	3.9e-53
AVE47685.1|3733101_3733500_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	90.9	1.8e-67
AVE47686.1|3733501_3733720_+	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	94.4	4.3e-31
AVE47687.1|3733815_3734169_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	94.9	5.6e-57
AVE47688.1|3734168_3735317_+|tail	phage tail protein	tail	A0A0D4DCQ4	Acinetobacter_phage	80.2	2.8e-158
AVE47689.1|3735369_3736287_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	98.0	1.0e-166
AVE47690.1|3736356_3736872_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.6	2.5e-77
AVE47691.1|3736799_3737129_+	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	55.1	4.5e-24
AVE47692.1|3737374_3737674_+	DUF4258 domain-containing protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
AVE47693.1|3737682_3738141_+	transcriptional regulator	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
AVE47694.1|3738245_3738566_+	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	97.2	1.7e-52
AVE47695.1|3738668_3739412_+	hypothetical protein	NA	A0A0N7IRG5	Acinetobacter_phage	98.8	2.3e-132
AVE47696.1|3739425_3739737_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AVE47697.1|3739852_3740023_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AVE47698.1|3740019_3741021_+	DNA-binding protein	NA	A0A0P0ZCS0	Stx2-converting_phage	42.2	6.4e-21
AVE47699.1|3741077_3742022_-	hypothetical protein	NA	A0A0P0J0J7	Acinetobacter_phage	98.4	4.1e-102
AVE47700.1|3742230_3742467_+	transcriptional regulator	NA	NA	NA	NA	NA
AVE47701.1|3742553_3743075_+	DUF4468 domain-containing protein	NA	A0A0P0I8L3	Acinetobacter_phage	67.8	7.8e-63
AVE47702.1|3743093_3743369_+	hypothetical protein	NA	NA	NA	NA	NA
AVE47703.1|3747497_3748430_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	6.1e-58
AVE47704.1|3748967_3750770_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	100.0	0.0e+00
AVE47705.1|3750766_3752308_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	100.0	3.9e-288
AVE47706.1|3753048_3754458_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
AVE47707.1|3754583_3755093_+	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AVE47708.1|3755089_3755968_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AVE47709.1|3756078_3757524_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVE47710.1|3757635_3757836_+	hypothetical protein	NA	NA	NA	NA	NA
AVE47711.1|3757845_3758289_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AVE47712.1|3758908_3759535_-	superoxide dismutase	NA	NA	NA	NA	NA
AVE47713.1|3759680_3760439_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AVE47714.1|3760632_3761808_+|protease	serine protease	protease	W5SAB9	Pithovirus	29.6	8.0e-07
>prophage 1
CP026705	Acinetobacter baumannii strain AR_0056 plasmid tig00000058_pilon, complete sequence	113706	0	14275	113706		Pseudomonas_phage(66.67%)	15	NA	NA
AVE44175.1|2248_3355_+	hypothetical protein	NA	A0A2H4P749	Pseudomonas_phage	30.9	7.8e-12
AVE44176.1|3505_4393_+	regulator	NA	A0A2H4P7I7	Pseudomonas_phage	40.5	1.1e-40
AVE44177.1|4449_5514_+	5'-3' exonuclease	NA	J9Q7S6	Salmonella_phage	36.6	7.7e-49
AVE44178.1|5524_7021_+	recombinase	NA	A0A2H4P740	Pseudomonas_phage	29.4	3.0e-51
AVE44304.1|7093_7447_+	hypothetical protein	NA	A0A2H4P744	Pseudomonas_phage	37.9	1.3e-08
AVE44179.1|7443_7842_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44180.1|7841_8279_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44181.1|8275_8794_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44182.1|8790_9156_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44183.1|9190_9439_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
AVE44184.1|9438_9837_+	cell wall hydrolase	NA	W8FWV7	Vibrio_phage	34.1	1.4e-08
AVE44185.1|9898_10993_+	serine/threonine protein phosphatase	NA	A0A2H4P756	Pseudomonas_phage	38.7	5.2e-69
AVE44186.1|10992_12945_+	hypothetical protein	NA	L7TNH6	Rhizobium_phage	39.7	1.3e-118
AVE44187.1|13045_13678_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44188.1|13681_14275_+	hypothetical protein	NA	A0A2H4P7J7	Pseudomonas_phage	46.5	1.1e-33
>prophage 2
CP026705	Acinetobacter baumannii strain AR_0056 plasmid tig00000058_pilon, complete sequence	113706	17543	46218	113706	transposase	Escherichia_phage(21.05%)	48	NA	NA
AVE44191.1|17543_18248_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVE44192.1|18685_19390_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVE44193.1|19473_20358_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AVE44194.1|20413_21889_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
AVE44195.1|22338_23043_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVE44196.1|23454_24159_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVE44197.1|24206_24452_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44198.1|24531_25524_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A2H4P762	Pseudomonas_phage	37.7	4.8e-53
AVE44199.1|25550_25970_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
AVE44200.1|25969_26332_-	hypothetical protein	NA	NA	NA	NA	NA
AVE44201.1|26562_27423_+	hypothetical protein	NA	W6ASM9	Erwinia_phage	48.4	6.6e-75
AVE44202.1|27419_27713_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44203.1|27712_28171_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	51.7	4.2e-36
AVE44204.1|28170_28854_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44205.1|28946_29150_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44206.1|29484_29880_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44207.1|29866_30055_+	hypothetical protein	NA	A0A2I7R1N0	Vibrio_phage	52.5	8.0e-10
AVE44208.1|30051_30360_+	hypothetical protein	NA	A0A068CDI0	Acinetobacter_phage	39.0	3.2e-08
AVE44209.1|30356_30593_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44210.1|30582_30786_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44211.1|30778_31201_+	hypothetical protein	NA	A0A2H4J8D3	uncultured_Caudovirales_phage	78.8	3.0e-41
AVE44212.1|31292_31568_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44213.1|31577_31943_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44214.1|31917_32769_+	hypothetical protein	NA	G3KB14	Pseudomonas_phage	57.6	3.1e-45
AVE44215.1|32851_33343_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44216.1|33332_33791_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44217.1|33796_34135_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44218.1|34287_35004_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44219.1|35006_35240_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44220.1|35236_35419_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44221.1|35420_36242_+	hypothetical protein	NA	A0A0K2FLL1	Brevibacillus_phage	29.7	2.3e-05
AVE44222.1|36337_36613_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44223.1|36609_37143_+	3'-5' exonuclease	NA	A0A2H4P776	Pseudomonas_phage	52.3	7.5e-45
AVE44224.1|37297_37573_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44225.1|37761_38013_+	transcriptional regulator	NA	A0A0M3LSW2	Mannheimia_phage	40.9	3.5e-05
AVE44226.1|38101_38812_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44227.1|38930_39869_+	hypothetical protein	NA	A0A2H4P788	Pseudomonas_phage	34.1	4.0e-09
AVE44228.1|39917_40262_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44229.1|40473_40881_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44230.1|40947_42150_+	hypothetical protein	NA	A0A172Q0J5	Acinetobacter_phage	41.6	2.3e-57
AVE44231.1|42220_42817_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44232.1|42813_43350_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44233.1|43327_43819_+	hypothetical protein	NA	A0A2H4J360	uncultured_Caudovirales_phage	62.0	4.3e-47
AVE44234.1|43895_44522_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44305.1|44621_44999_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44235.1|44998_45631_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44236.1|45661_46003_+	HTH domain-containing protein	NA	NA	NA	NA	NA
AVE44237.1|45999_46218_+	hypothetical protein	NA	A0A1X9Y878	Proteus_phage	64.3	6.0e-17
>prophage 3
CP026705	Acinetobacter baumannii strain AR_0056 plasmid tig00000058_pilon, complete sequence	113706	49233	49608	113706		Cronobacter_phage(100.0%)	1	NA	NA
AVE44240.1|49233_49608_+	hypothetical protein	NA	A0A060AGD7	Cronobacter_phage	45.3	7.6e-12
>prophage 4
CP026705	Acinetobacter baumannii strain AR_0056 plasmid tig00000058_pilon, complete sequence	113706	53448	110905	113706	tail,integrase,capsid,terminase	Salmonella_phage(33.33%)	54	55208:55224	109604:109620
AVE44248.1|53448_55164_-	ATP-dependent helicase	NA	L7TNS5	Rhizobium_phage	45.7	1.5e-123
AVE44249.1|55194_55875_+	chromosome partitioning protein ParB	NA	L7TL04	Rhizobium_phage	40.9	1.8e-43
55208:55224	attL	AGTCAGTACTGACTGAT	NA	NA	NA	NA
AVE44250.1|55886_56408_+	hypothetical protein	NA	A0A2I7QK91	Vibrio_phage	39.4	4.2e-24
AVE44251.1|56415_57057_+	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	42.8	4.3e-31
AVE44252.1|57053_57710_+	ABC transporter	NA	J9Q807	Salmonella_phage	60.3	1.6e-65
AVE44253.1|57720_58074_+	thioredoxin	NA	NA	NA	NA	NA
AVE44254.1|58117_59068_+	hypothetical protein	NA	A0A2H4P6X5	Pseudomonas_phage	44.1	3.5e-61
AVE44255.1|59057_59384_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44256.1|59486_59882_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44257.1|60001_60592_+	winged helix-turn-helix domain-containing protein	NA	J9Q6D4	Salmonella_phage	26.2	6.2e-08
AVE44258.1|60594_61839_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	60.1	1.3e-148
AVE44259.1|61878_63579_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	52.4	1.4e-153
AVE44260.1|63628_64480_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	32.0	6.4e-30
AVE44261.1|64650_65553_+|capsid	phage major capsid protein	capsid	A0A2H4P701	Pseudomonas_phage	55.0	1.9e-88
AVE44262.1|65675_66173_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	27.0	2.9e-06
AVE44263.1|66172_66946_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44264.1|66945_67422_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44265.1|67408_67774_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	35.4	3.5e-09
AVE44266.1|67751_68141_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44267.1|68141_68642_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44268.1|68711_69239_+	hypothetical protein	NA	A0A2H4P707	Pseudomonas_phage	55.2	2.5e-48
AVE44269.1|69327_69651_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44270.1|69707_69986_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44271.1|70002_75747_+|tail	phage tail protein	tail	G8C7Q6	Escherichia_phage	38.3	1.6e-07
AVE44272.1|75783_76113_+|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	35.8	2.2e-15
AVE44273.1|76121_76832_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	52.2	3.1e-70
AVE44274.1|76818_77577_+|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	38.2	5.3e-44
AVE44275.1|77566_78187_+|tail	tail assembly protein	tail	C7BGD3	Burkholderia_phage	29.6	3.9e-13
AVE44276.1|78155_89831_+|tail	phage tail protein	tail	A0A0R6PH26	Moraxella_phage	36.2	1.2e-158
AVE44277.1|89830_90388_+	DUF4376 domain-containing protein	NA	A0A172Q083	Acinetobacter_phage	40.4	5.1e-28
AVE44278.1|91071_91389_+	hypothetical protein	NA	I3PUY0	Vibrio_phage	34.1	1.6e-07
AVE44279.1|91388_91958_+	TIGR02594 family protein	NA	A0A0B5KZH1	Acinetobacter_phage	100.0	1.3e-111
AVE44280.1|92806_93655_+	RepB family plasmid replication initiator protein	NA	A0A218MNI2	uncultured_virus	26.2	9.2e-13
AVE44281.1|93770_94511_+	hypothetical protein	NA	L7TM14	Rhizobium_phage	26.7	3.8e-15
AVE44282.1|94579_95119_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44283.1|95128_96526_+	DNA helicase	NA	A0A2H4P718	Pseudomonas_phage	42.2	1.6e-91
AVE44284.1|96712_97825_+	DNA primase	NA	A0A2H4P738	Pseudomonas_phage	41.7	2.4e-77
AVE44285.1|97821_98178_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44286.1|98189_98705_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44287.1|98701_99124_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44288.1|99206_99806_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44289.1|99826_100084_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44290.1|100112_101516_+	DNA ligase	NA	A0A2H4P729	Pseudomonas_phage	42.1	1.2e-94
AVE44291.1|101521_101911_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44292.1|101923_102550_+	guanylate kinase	NA	A0A1W6JK60	Lactococcus_phage	44.4	5.7e-12
AVE44293.1|102629_103244_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44294.1|103258_103663_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44295.1|103848_104265_-	hypothetical protein	NA	NA	NA	NA	NA
AVE44296.1|104251_104929_-	chromosome partitioning protein ParA	NA	J9Q7R7	Salmonella_phage	27.7	3.1e-11
AVE44297.1|105130_105718_-|integrase	site-specific integrase	integrase	A0A0A8WF93	Clostridium_phage	29.7	2.3e-07
AVE44298.1|106082_106547_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVE44299.1|107148_107349_+	hypothetical protein	NA	NA	NA	NA	NA
AVE44300.1|107508_109566_+	hypothetical protein	NA	A0A2H4P735	Pseudomonas_phage	44.2	3.6e-71
AVE44301.1|109705_110905_+	porphyrin biosynthesis protein	NA	L7TKP0	Rhizobium_phage	40.5	3.7e-76
109604:109620	attR	ATCAGTCAGTACTGACT	NA	NA	NA	NA
