The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026719	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 chromosome, complete genome	5104736	96063	141844	5104736	integrase,terminase,portal,tail,head,holin,capsid	Enterobacterial_phage(33.33%)	63	87781:87796	147436:147451
87781:87796	attL	ACCAGCTCAGGATCGA	NA	NA	NA	NA
AVE71005.1|96063_96939_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	25.3	4.0e-11
AVE71006.1|96935_97652_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	1.0e-12
AVE71007.1|97817_98288_+	hypothetical protein	NA	NA	NA	NA	NA
AVE71008.1|98293_99220_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVE71009.1|99774_100095_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	55.7	7.2e-27
AVE71010.1|100094_100334_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	71.8	3.5e-26
AVE71011.1|100416_101691_-|tail	phage tail protein	tail	K7PKG5	Enterobacteria_phage	69.4	5.2e-161
AVE71012.1|101749_101983_-	cor protein	NA	E4WL42	Enterobacteria_phage	78.9	3.9e-30
AVE71013.1|102090_102762_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.1	3.4e-87
AVE71014.1|102762_103077_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	66.7	5.9e-34
AVE71015.1|103119_106953_-	host specificity protein	NA	K7P840	Enterobacteria_phage	78.1	0.0e+00
AVE71016.1|107006_107606_-|tail	phage tail protein	tail	K7PM97	Enterobacterial_phage	73.3	4.6e-75
AVE71017.1|107662_107998_-	hypothetical protein	NA	Q6UAW3	Klebsiella_phage	47.7	1.6e-21
AVE71018.1|108004_108352_-	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	51.7	2.0e-06
AVE71019.1|108385_109096_-	peptidase P60	NA	K7PGV2	Enterobacterial_phage	96.6	4.6e-143
AVE71020.1|109097_109856_-|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	99.6	1.1e-147
AVE71021.1|109852_110191_-|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	99.1	1.1e-62
AVE71022.1|110193_113472_-|tail	phage tail tape measure protein	tail	A0A220NRN7	Escherichia_phage	95.7	0.0e+00
AVE71023.1|113507_113771_-	DUF4035 domain-containing protein	NA	K7P7L5	Enterobacteria_phage	93.1	2.7e-40
AVE71024.1|113794_114196_-|tail	phage tail protein	tail	K7P7C2	Enterobacteria_phage	95.5	1.3e-65
AVE71025.1|114250_114721_-|tail	phage tail protein	tail	K7PJR9	Enterobacterial_phage	80.8	9.1e-63
AVE71026.1|114775_115123_-	DUF3168 domain-containing protein	NA	K7P7Q9	Enterobacteria_phage	93.0	5.2e-55
AVE71027.1|115119_115569_-	hypothetical protein	NA	K7PH84	Enterobacterial_phage	98.7	7.6e-75
AVE71028.1|115565_115904_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	6.0e-40
AVE71029.1|115912_116239_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	81.5	1.3e-47
AVE71030.1|116282_117494_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.9	9.5e-197
AVE71031.1|117503_118352_-	peptidase S14	NA	K7PH05	Enterobacteria_phage	91.4	4.6e-137
AVE71032.1|118365_119670_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	88.9	4.4e-224
AVE71033.1|119669_121412_-|terminase	phage terminase small subunit P27 family	terminase	A0A0U2C138	Paracoccus_phage	44.9	2.0e-139
AVE71034.1|121365_121830_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.7e-48
AVE71035.1|121957_122302_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	73.9	3.0e-47
AVE71036.1|122298_122889_-	hypothetical protein	NA	S4TR53	Salmonella_phage	79.5	7.6e-91
AVE71037.1|123054_123339_+	hypothetical protein	NA	NA	NA	NA	NA
AVE71038.1|123354_123585_-	hypothetical protein	NA	NA	NA	NA	NA
AVE71039.1|123603_125061_-	glycosyltransferase	NA	K7PKP3	Enterobacterial_phage	89.1	1.4e-263
AVE71040.1|125078_125306_-	hypothetical protein	NA	NA	NA	NA	NA
AVE71041.1|125317_126157_-	DUF1983 domain-containing protein	NA	M9NZE9	Enterobacteria_phage	57.4	8.4e-51
AVE71042.1|126506_126701_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	87.8	4.8e-18
AVE75489.1|126651_126933_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	78.5	5.7e-28
AVE71043.1|126940_127570_-	endolysin	NA	G8C7W0	Escherichia_phage	88.0	2.4e-103
AVE71044.1|127569_127851_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	95.7	1.9e-44
AVE71045.1|127837_128233_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
AVE71046.1|128431_129262_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	46.9	3.9e-56
AVE71047.1|129274_130264_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	86.0	8.4e-167
AVE71048.1|130260_130986_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	52.2	1.7e-55
AVE71049.1|131001_131391_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	87.3	1.4e-61
AVE71050.1|131387_131708_-	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	79.2	5.8e-45
AVE71051.1|131704_131932_-	hypothetical protein	NA	NA	NA	NA	NA
AVE71052.1|131928_132588_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	78.9	2.7e-97
AVE71053.1|132587_133082_-	hypothetical protein	NA	NA	NA	NA	NA
AVE71054.1|133078_134032_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	93.7	3.2e-171
AVE71055.1|134364_134919_-	hypothetical protein	NA	S5FXP0	Shigella_phage	54.2	1.1e-46
AVE71056.1|134941_135145_-	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	60.9	2.1e-16
AVE71057.1|135245_135878_+	LexA family transcriptional repressor	NA	A0A1W6JP50	Morganella_phage	56.1	1.1e-50
AVE71058.1|136200_136401_-	hypothetical protein	NA	NA	NA	NA	NA
AVE75490.1|136732_137146_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	86.1	6.2e-55
AVE71059.1|137145_137973_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	86.7	5.1e-125
AVE71060.1|138436_138685_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	86.2	3.7e-31
AVE71061.1|138681_139062_+	hypothetical protein	NA	NA	NA	NA	NA
AVE75491.1|139919_140237_+	hypothetical protein	NA	K7P7P8	Enterobacteria_phage	92.3	4.3e-48
AVE71062.1|140303_140573_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	84.3	1.4e-36
AVE71063.1|140606_140834_+	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	100.0	3.4e-39
AVE71064.1|140833_141844_+|integrase	integrase	integrase	K7PLZ2	Enterobacterial_phage	91.4	6.8e-180
147436:147451	attR	ACCAGCTCAGGATCGA	NA	NA	NA	NA
>prophage 2
CP026719	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 chromosome, complete genome	5104736	318432	327318	5104736		Tupanvirus(28.57%)	8	NA	NA
AVE71212.1|318432_319044_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.8	9.2e-15
AVE71213.1|319083_320064_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
AVE71214.1|320256_321261_+	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.0	3.8e-34
AVE71215.1|321308_322475_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	4.1e-112
AVE71216.1|322714_323596_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.7	6.9e-104
AVE71217.1|323596_324682_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.3	6.3e-99
AVE71218.1|324771_326178_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	5.2e-37
AVE71219.1|326304_327318_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	48.3	2.3e-87
>prophage 3
CP026719	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 chromosome, complete genome	5104736	1362689	1430519	5104736	integrase,tRNA,plate,terminase,portal,tail,head,holin,capsid	Salmonella_phage(45.21%)	86	1355653:1355672	1442282:1442301
1355653:1355672	attL	CGGTATCGCGCTCGGGGGAA	NA	NA	NA	NA
AVE72111.1|1362689_1363703_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	1.4e-108
AVE72112.1|1363939_1364155_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVE72113.1|1364270_1366016_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
AVE72114.1|1366168_1368013_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
AVE72115.1|1368113_1368620_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
AVE75527.1|1368956_1369175_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	75.0	4.9e-27
AVE72116.1|1369244_1370345_-	late control protein D	NA	E5G6Q3	Salmonella_phage	92.9	3.7e-187
AVE72117.1|1370341_1370827_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.8	5.0e-72
AVE72118.1|1370823_1374273_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	63.8	0.0e+00
AVE75528.1|1374265_1374385_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	5.7e-14
AVE72119.1|1374399_1374702_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	97.0	1.4e-43
AVE72120.1|1374756_1375272_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	98.2	5.1e-91
AVE72121.1|1375281_1376454_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	7.3e-210
AVE72122.1|1376587_1377184_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	47.9	4.3e-49
AVE72123.1|1377183_1378488_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	52.0	1.3e-127
AVE72124.1|1378484_1379090_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	96.0	4.3e-113
AVE72125.1|1379082_1379991_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.7	2.4e-144
AVE72126.1|1379977_1380337_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	92.4	1.8e-55
AVE72127.1|1380333_1380912_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	97.9	1.3e-106
AVE72128.1|1380980_1381427_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.7	6.4e-66
AVE72129.1|1381419_1381851_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	97.2	4.7e-74
AVE72130.1|1381946_1382372_-	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	97.2	5.5e-67
AVE72131.1|1382371_1382749_-	peptidase	NA	A0A1S6KZZ2	Salmonella_phage	96.8	7.6e-60
AVE72132.1|1382753_1383263_-	glycoside hydrolase	NA	A0A1S6KZY9	Salmonella_phage	97.6	1.9e-93
AVE72133.1|1383243_1383459_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
AVE72134.1|1383462_1383666_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	98.5	1.1e-33
AVE72135.1|1383665_1384130_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	1.9e-84
AVE72136.1|1384223_1384874_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	99.5	1.4e-114
AVE72137.1|1384877_1385939_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	98.9	2.3e-194
AVE72138.1|1385955_1386789_-|capsid	capsid protein	capsid	E5G6M5	Salmonella_phage	97.5	3.8e-128
AVE72139.1|1386931_1388698_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	94.9	0.0e+00
AVE72140.1|1388966_1390007_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.4	8.8e-175
AVE72141.1|1390057_1390396_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
AVE72142.1|1390395_1391370_-	hypothetical protein	NA	A4PE73	Ralstonia_virus	41.5	1.6e-53
AVE72143.1|1391716_1391950_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
AVE72144.1|1391961_1392150_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
AVE72145.1|1392314_1394723_-	endonuclease	NA	A0A1S6L028	Salmonella_phage	97.1	0.0e+00
AVE72146.1|1394713_1395571_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	94.0	1.9e-154
AVE72147.1|1395567_1395795_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	93.3	5.1e-35
AVE72148.1|1395794_1396028_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	80.5	5.4e-24
AVE72149.1|1396095_1396437_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	86.7	2.6e-51
AVE72150.1|1396400_1396601_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.9	8.7e-31
AVE72151.1|1396608_1397118_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	93.5	1.0e-83
AVE72152.1|1397152_1397389_-	regulator	NA	NA	NA	NA	NA
AVE72153.1|1397476_1398127_+	phage repressor protein	NA	F1BUN8	Cronobacter_phage	33.5	1.1e-26
AVE72154.1|1398152_1398698_+	hypothetical protein	NA	NA	NA	NA	NA
AVE72155.1|1398703_1399717_+|integrase	integrase	integrase	F1BUS9	Erwinia_phage	60.2	4.8e-117
AVE72156.1|1400062_1400953_+	hypothetical protein	NA	NA	NA	NA	NA
AVE72157.1|1401567_1403244_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	63.0	2.5e-203
AVE72158.1|1403246_1403795_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	74.7	6.0e-66
AVE72159.1|1403766_1404492_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	51.0	2.0e-61
AVE72160.1|1404481_1404997_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	54.4	1.3e-46
AVE72161.1|1407418_1408006_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	80.5	9.9e-91
AVE72162.1|1407998_1409183_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.5	2.6e-175
AVE72163.1|1409179_1409509_-	DUF2590 domain-containing protein	NA	F1BUK8	Cronobacter_phage	73.4	5.4e-38
AVE72164.1|1409505_1411818_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	56.7	1.8e-215
AVE72165.1|1412005_1412266_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	62.8	1.6e-21
AVE72166.1|1412249_1412489_-	hypothetical protein	NA	F1BUL1	Cronobacter_phage	57.9	6.6e-17
AVE72167.1|1412385_1412754_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	52.4	1.8e-21
AVE72168.1|1412753_1413095_-	hypothetical protein	NA	F1BUL3	Cronobacter_phage	89.1	5.4e-49
AVE72169.1|1413091_1413379_-|holin	holin	holin	C7BGD7	Burkholderia_phage	51.8	2.1e-14
AVE72170.1|1413388_1413844_-	DUF2597 domain-containing protein	NA	F1BUL4	Cronobacter_phage	73.5	5.4e-60
AVE72171.1|1413840_1414968_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	82.7	9.6e-175
AVE72172.1|1414964_1415672_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	78.6	2.7e-103
AVE72173.1|1415668_1416175_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	70.9	3.9e-67
AVE72174.1|1416171_1416624_-|head	head completion protein	head	F1BUL8	Cronobacter_phage	77.3	2.2e-58
AVE72175.1|1416722_1417424_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.7	5.2e-86
AVE72176.1|1417427_1418450_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	79.4	4.2e-153
AVE72177.1|1418509_1419304_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	52.4	2.5e-68
AVE72178.1|1419476_1421252_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	82.9	1.7e-290
AVE72179.1|1421248_1422301_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	78.6	4.0e-159
AVE72180.1|1422297_1422621_+	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	90.4	2.0e-48
AVE72181.1|1422594_1422801_-	hypothetical protein	NA	NA	NA	NA	NA
AVE72182.1|1422922_1424971_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	75.6	4.7e-305
AVE72183.1|1424939_1425152_-	hypothetical protein	NA	NA	NA	NA	NA
AVE72184.1|1425148_1426015_-	adenine methylase	NA	F1BUN1	Cronobacter_phage	93.6	1.1e-146
AVE72185.1|1426011_1426287_-	hypothetical protein	NA	NA	NA	NA	NA
AVE72186.1|1426277_1426511_-	hypothetical protein	NA	NA	NA	NA	NA
AVE72187.1|1426577_1426979_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	54.1	6.0e-39
AVE72188.1|1426978_1427407_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.2	4.5e-24
AVE72189.1|1427396_1427591_-	hypothetical protein	NA	NA	NA	NA	NA
AVE72190.1|1427689_1427932_+	hypothetical protein	NA	NA	NA	NA	NA
AVE72191.1|1428012_1428516_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	69.5	5.6e-58
AVE72192.1|1428546_1428768_-	regulator	NA	NA	NA	NA	NA
AVE72193.1|1428901_1429483_+	phage repressor protein	NA	F1BUS8	Erwinia_phage	35.5	1.4e-28
AVE72194.1|1429484_1430519_+|integrase	integrase	integrase	F1BUS9	Erwinia_phage	63.4	1.9e-121
1442282:1442301	attR	CGGTATCGCGCTCGGGGGAA	NA	NA	NA	NA
>prophage 4
CP026719	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 chromosome, complete genome	5104736	3340045	3383127	5104736	integrase,terminase,tail,holin,head	Salmonella_phage(25.86%)	69	3339986:3340032	3389093:3389139
3339986:3340032	attL	CTTCTAAGCCGTAGGTCGTAGGTTCGAATCCTACAGGGCGTGCCATT	NA	NA	NA	NA
AVE75583.1|3340045_3341089_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	99.1	5.3e-204
AVE75582.1|3341085_3341421_-	DNA-binding protein	NA	NA	NA	NA	NA
AVE73891.1|3341531_3341792_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	48.1	4.3e-06
AVE73892.1|3341801_3342041_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	75.6	7.5e-29
AVE73893.1|3342018_3342516_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.1	2.8e-70
AVE73894.1|3342515_3342734_-	hypothetical protein	NA	M1FQT7	Enterobacteria_phage	68.1	1.3e-19
AVE73895.1|3343000_3343192_-	hypothetical protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	2.1e-13
AVE73896.1|3343188_3343461_-	nucleoside 2-deoxyribosyltransferase	NA	A0A0U2SAZ1	Escherichia_phage	65.9	5.7e-25
AVE73897.1|3343480_3343699_-	hypothetical protein	NA	NA	NA	NA	NA
AVE73898.1|3343695_3344298_-	Fis family transcriptional regulator	NA	A0A142IF90	Pseudomonas_phage	43.7	1.1e-23
AVE73899.1|3344281_3344923_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	90.9	9.4e-111
AVE73900.1|3344919_3345072_-	DUF1317 domain-containing protein	NA	T1SAR0	Salmonella_phage	44.2	1.6e-05
AVE73901.1|3345068_3345497_-	regulator	NA	M9NYX4	Enterobacteria_phage	97.9	4.0e-73
AVE73902.1|3345493_3346174_-	exonuclease	NA	M9NZE1	Enterobacteria_phage	94.7	1.0e-126
AVE73903.1|3346170_3347016_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	60.3	1.2e-68
AVE73904.1|3347034_3347319_-	hypothetical protein	NA	G8C7T1	Escherichia_phage	94.7	1.5e-47
AVE73905.1|3347391_3347601_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	95.7	6.7e-34
AVE73906.1|3348287_3348620_-	hypothetical protein	NA	A0A2I7R1U5	Vibrio_phage	41.8	8.8e-12
AVE73907.1|3348825_3349188_-	antitermination protein	NA	C6ZR44	Salmonella_phage	74.2	5.6e-44
AVE73908.1|3349395_3349578_+	ATP-NAD kinase	NA	NA	NA	NA	NA
AVE73909.1|3350167_3350365_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	93.8	9.2e-25
AVE73910.1|3350500_3351448_-	hypothetical protein	NA	A9YX09	Burkholderia_phage	42.3	2.0e-61
AVE73911.1|3351586_3352228_-	LexA family transcriptional repressor	NA	K7PH71	Enterobacterial_phage	76.8	5.2e-93
AVE73912.1|3352331_3352547_+	XRE family transcriptional regulator	NA	K7PMD5	Enterobacterial_phage	81.7	2.8e-27
AVE73913.1|3352577_3353123_+	hypothetical protein	NA	G8C7U3	Escherichia_phage	97.8	2.8e-95
AVE73914.1|3353208_3353901_+	hypothetical protein	NA	A0A088F856	Sulfitobacter_phage	46.3	5.4e-11
AVE73915.1|3353901_3354765_+	hypothetical protein	NA	G8C7U5	Escherichia_phage	95.5	1.4e-154
AVE73916.1|3354761_3355451_+	phage replication protein	NA	G8C7U6	Escherichia_phage	96.1	7.7e-127
AVE73917.1|3355452_3356025_+	protein ren	NA	K7P7J0	Enterobacteria_phage	38.3	1.1e-09
AVE73918.1|3356021_3356489_+	hypothetical protein	NA	A0A2H4N7F5	Pectobacterium_phage	58.9	1.1e-10
AVE73919.1|3356485_3356722_+	hypothetical protein	NA	NA	NA	NA	NA
AVE73920.1|3356718_3357192_+	hypothetical protein	NA	K7P6V8	Enterobacteria_phage	47.8	2.6e-09
AVE73921.1|3357326_3358184_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	38.3	8.7e-19
AVE75584.1|3358263_3358773_+	hypothetical protein	NA	NA	NA	NA	NA
AVE73922.1|3359025_3359475_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	49.0	1.6e-35
AVE73923.1|3359467_3360115_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	73.0	1.1e-82
AVE73924.1|3360111_3360336_+	protein ninY	NA	Q76H69	Enterobacteria_phage	68.9	2.5e-26
AVE73925.1|3360332_3360449_+	hypothetical protein	NA	NA	NA	NA	NA
AVE73926.1|3360448_3361072_+	hypothetical protein	NA	A0A2H4FND2	Salmonella_phage	71.6	5.6e-84
AVE73927.1|3361888_3362290_+	hypothetical protein	NA	NA	NA	NA	NA
AVE73928.1|3362286_3362562_+|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
AVE73929.1|3362564_3363107_+	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	70.4	1.6e-74
AVE73930.1|3363103_3363382_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	49.4	7.4e-12
AVE73931.1|3363332_3363515_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	93.2	2.0e-18
AVE73932.1|3363614_3363824_+	hypothetical protein	NA	NA	NA	NA	NA
AVE73933.1|3363970_3364174_+	hypothetical protein	NA	NA	NA	NA	NA
AVE73934.1|3364177_3364816_+	hypothetical protein	NA	I6S676	Salmonella_phage	92.0	1.2e-113
AVE73935.1|3364846_3365305_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	80.3	8.1e-64
AVE73936.1|3365297_3366551_+|terminase	PBSX family phage terminase large subunit	terminase	I6RSK1	Salmonella_phage	96.2	2.9e-212
AVE73937.1|3366644_3366848_+	hypothetical protein	NA	NA	NA	NA	NA
AVE73938.1|3367270_3368593_+	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	88.0	1.0e-228
AVE73939.1|3368579_3369506_+|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	93.5	6.2e-164
AVE75585.1|3369572_3370832_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	89.0	4.7e-215
AVE73940.1|3370844_3371294_+	hypothetical protein	NA	H6WRT3	Salmonella_phage	86.6	1.9e-65
AVE73941.1|3371311_3372388_+	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	91.6	1.0e-189
AVE73942.1|3372397_3372691_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	88.7	1.1e-42
AVE73943.1|3372753_3373155_+	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	80.8	1.6e-55
AVE73944.1|3373154_3373328_+	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	49.1	7.8e-12
AVE73945.1|3373327_3373678_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	66.1	7.6e-38
AVE73946.1|3373691_3373880_+	hypothetical protein	NA	NA	NA	NA	NA
AVE73947.1|3373922_3374291_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	74.6	3.0e-45
AVE73948.1|3374287_3374671_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	50.4	1.9e-34
AVE73949.1|3374729_3375485_+	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	53.6	9.9e-59
AVE73950.1|3375535_3376276_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	53.5	3.8e-63
AVE73951.1|3376812_3379317_+|tail	phage tail tape measure protein	tail	A0A1B1W284	Salmonella_phage	39.4	1.5e-98
AVE73952.1|3379316_3379814_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	89.1	4.8e-86
AVE73953.1|3379813_3380284_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	92.9	7.0e-79
AVE73954.1|3380297_3380663_+	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	90.8	1.4e-63
AVE73955.1|3380649_3383127_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.4	0.0e+00
3389093:3389139	attR	CTTCTAAGCCGTAGGTCGTAGGTTCGAATCCTACAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 5
CP026719	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 chromosome, complete genome	5104736	4019763	4151708	5104736	integrase,tRNA,plate,terminase,portal,transposase,tail,capsid,holin,head	Enterobacteria_phage(27.43%)	152	4026183:4026205	4136910:4136925
AVE74516.1|4019763_4020882_-|integrase	integrase	integrase	O21940	Phage_21	44.7	3.0e-80
AVE75608.1|4020856_4021120_-	excisionase	NA	NA	NA	NA	NA
AVE74517.1|4021187_4023752_-	hypothetical protein	NA	K7P6V4	Enterobacteria_phage	46.5	6.4e-142
AVE74518.1|4023892_4024189_-	hypothetical protein	NA	NA	NA	NA	NA
AVE74519.1|4024354_4024537_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVE74520.1|4024927_4025308_-	transcriptional regulator	NA	K7PH71	Enterobacterial_phage	69.6	3.3e-18
AVE74521.1|4025414_4025630_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVE74522.1|4025633_4026188_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	36.0	2.9e-15
4026183:4026205	attL	TTTTAATCGAGTTTTGACCAATG	NA	NA	NA	NA
AVE74523.1|4027158_4027740_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	76.8	2.6e-67
4026183:4026205	attL	TTTTAATCGAGTTTTGACCAATG	NA	NA	NA	NA
AVE74524.1|4027754_4028174_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AVE74525.1|4028177_4028438_+	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	73.5	8.1e-29
AVE74526.1|4028767_4029172_+	hypothetical protein	NA	Q5G8V2	Enterobacteria_phage	74.0	7.5e-13
AVE75609.1|4029677_4029923_+	hypothetical protein	NA	NA	NA	NA	NA
AVE74527.1|4032102_4033125_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.7	4.7e-104
AVE74528.1|4033163_4033397_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	61.8	5.2e-19
AVE74529.1|4033441_4033843_+	DNA-binding protein	NA	Q8SBE8	Shigella_phage	46.2	1.2e-15
AVE74530.1|4033839_4034040_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	50.8	4.6e-08
AVE74531.1|4034047_4035067_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	52.8	1.1e-97
AVE75610.1|4035079_4035685_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	67.3	9.3e-76
AVE74532.1|4036023_4036428_+	hypothetical protein	NA	NA	NA	NA	NA
AVE74533.1|4036424_4036721_+|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	33.8	5.5e-05
AVE74534.1|4036717_4037347_+	endolysin	NA	G8C7W0	Escherichia_phage	89.5	5.4e-103
AVE74535.1|4037354_4037633_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	43.2	5.9e-09
AVE74536.1|4037583_4037769_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	76.4	4.6e-18
AVE74537.1|4037825_4038059_-	hypothetical protein	NA	NA	NA	NA	NA
AVE74538.1|4038463_4038967_+	DUF1441 domain-containing protein	NA	K7PJY2	Enterobacterial_phage	61.7	3.4e-47
AVE74539.1|4038970_4041091_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.5	2.0e-303
AVE74540.1|4041087_4041303_+	hypothetical protein	NA	NA	NA	NA	NA
AVE74541.1|4041311_4042832_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.4	3.7e-153
AVE75611.1|4042821_4044900_+	peptidase S14	NA	S5M7Q8	Escherichia_phage	51.8	8.7e-198
AVE74542.1|4044968_4045304_+	DUF2190 domain-containing protein	NA	Q9EYD5	Enterobacteria_phage	43.6	4.4e-11
AVE74543.1|4045303_4045660_+	hypothetical protein	NA	NA	NA	NA	NA
AVE74544.1|4045661_4046324_+	hypothetical protein	NA	R9TR34	Vibrio_phage	36.7	1.4e-21
AVE74545.1|4046332_4046887_+	hypothetical protein	NA	NA	NA	NA	NA
AVE74546.1|4046879_4047503_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	30.3	3.6e-06
AVE74547.1|4047541_4049011_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	47.4	3.7e-78
AVE74548.1|4049007_4049514_+|tail	phage tail protein	tail	NA	NA	NA	NA
AVE74549.1|4049565_4049853_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVE74550.1|4052054_4052525_+|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	34.9	6.4e-16
AVE75612.1|4052499_4052715_+|tail	phage tail protein	tail	R9TR63	Vibrio_phage	52.9	8.8e-13
AVE74551.1|4052717_4053836_+	late control protein D	NA	R9TNM7	Vibrio_phage	33.4	5.4e-37
AVE74552.1|4053872_4054226_+|plate	baseplate assembly protein	plate	E5FFH4	Burkholderia_phage	50.0	1.1e-20
AVE74553.1|4054209_4055124_+|plate	baseplate assembly protein	plate	A0A088FQL4	Escherichia_phage	49.7	5.9e-66
AVE74554.1|4055116_4055668_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	44.1	3.3e-27
AVE74555.1|4057790_4058306_+|tail	tail assembly chaperone	tail	F1BUK2	Cronobacter_phage	41.5	7.0e-24
AVE74556.1|4058302_4059169_-	benzoate transporter	NA	M1I711	Paramecium_bursaria_Chlorella_virus	34.2	5.1e-27
AVE74557.1|4059282_4059693_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	51.1	1.9e-35
AVE74558.1|4059714_4059870_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	78.4	1.2e-16
AVE74559.1|4060317_4061436_-|integrase	integrase	integrase	O21940	Phage_21	44.7	3.0e-80
AVE75613.1|4061410_4061674_-	excisionase	NA	NA	NA	NA	NA
AVE74560.1|4061741_4064306_-	hypothetical protein	NA	K7P6V4	Enterobacteria_phage	46.5	6.4e-142
AVE74561.1|4064446_4064743_-	hypothetical protein	NA	NA	NA	NA	NA
AVE74562.1|4064908_4065091_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
4064892:4064914	attR	CATTGGTCAAAACTCGATTAAAA	NA	NA	NA	NA
AVE74563.1|4065480_4065861_-	transcriptional regulator	NA	K7PH71	Enterobacterial_phage	69.6	3.3e-18
4064892:4064914	attR	CATTGGTCAAAACTCGATTAAAA	NA	NA	NA	NA
AVE74564.1|4065967_4066183_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVE74565.1|4066186_4066741_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	36.0	2.9e-15
AVE74566.1|4067711_4068293_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	76.8	2.6e-67
AVE74567.1|4068307_4068727_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AVE74568.1|4068730_4068991_+	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	73.5	8.1e-29
AVE74569.1|4068987_4069320_+	hypothetical protein	NA	NA	NA	NA	NA
AVE74570.1|4069319_4069724_+	hypothetical protein	NA	Q5G8V2	Enterobacteria_phage	74.0	7.5e-13
AVE74571.1|4069726_4070473_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.7	2.6e-67
AVE74572.1|4070469_4072353_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.1	7.1e-199
AVE74573.1|4072574_4073684_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	60.6	7.9e-105
AVE74574.1|4073722_4073956_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	61.8	5.2e-19
AVE74575.1|4074000_4074402_+	DNA-binding protein	NA	Q8SBE8	Shigella_phage	46.2	1.2e-15
AVE74576.1|4074398_4074599_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	50.8	4.6e-08
AVE74577.1|4074606_4075626_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	52.8	1.1e-97
AVE75614.1|4075638_4076244_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	67.3	9.3e-76
AVE74578.1|4076582_4076987_+	hypothetical protein	NA	NA	NA	NA	NA
AVE74579.1|4076983_4077280_+|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	33.8	5.5e-05
AVE74580.1|4077276_4077906_+	endolysin	NA	G8C7W0	Escherichia_phage	89.5	5.4e-103
AVE74581.1|4077913_4078192_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	43.2	5.9e-09
AVE74582.1|4078142_4078328_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	76.4	4.6e-18
AVE74583.1|4078384_4078618_-	hypothetical protein	NA	NA	NA	NA	NA
AVE74584.1|4079022_4079526_+	DUF1441 domain-containing protein	NA	K7PJY2	Enterobacterial_phage	61.7	3.4e-47
AVE74585.1|4079529_4081650_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.5	2.0e-303
AVE74586.1|4081646_4081862_+	hypothetical protein	NA	NA	NA	NA	NA
AVE74587.1|4081870_4083391_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.4	3.7e-153
AVE75615.1|4083380_4085459_+	peptidase S14	NA	S5M7Q8	Escherichia_phage	51.8	8.7e-198
AVE74588.1|4085527_4085863_+	DUF2190 domain-containing protein	NA	Q9EYD5	Enterobacteria_phage	43.6	4.4e-11
AVE74589.1|4085862_4086219_+	hypothetical protein	NA	NA	NA	NA	NA
AVE74590.1|4086220_4086883_+	hypothetical protein	NA	R9TR34	Vibrio_phage	36.7	1.4e-21
AVE74591.1|4086891_4087446_+	hypothetical protein	NA	NA	NA	NA	NA
AVE74592.1|4087438_4088062_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	30.3	3.6e-06
AVE74593.1|4088100_4089570_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	47.4	3.7e-78
AVE74594.1|4090114_4090510_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVE74595.1|4092208_4092607_+	hypothetical protein	NA	NA	NA	NA	NA
AVE74596.1|4092603_4093074_+|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	34.9	6.4e-16
AVE75616.1|4093048_4093264_+|tail	phage tail protein	tail	R9TR63	Vibrio_phage	52.9	8.8e-13
AVE74597.1|4093266_4094385_+	late control protein D	NA	R9TNM7	Vibrio_phage	33.4	5.4e-37
AVE74598.1|4094421_4094775_+|plate	baseplate assembly protein	plate	E5FFH4	Burkholderia_phage	50.0	1.1e-20
AVE74599.1|4094758_4095673_+|plate	baseplate assembly protein	plate	A0A088FQL4	Escherichia_phage	49.7	5.9e-66
AVE74600.1|4095665_4096217_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	44.1	3.3e-27
AVE74601.1|4098339_4098855_+|tail	tail assembly chaperone	tail	F1BUK2	Cronobacter_phage	41.5	7.0e-24
AVE74602.1|4098851_4099718_-	benzoate transporter	NA	M1I711	Paramecium_bursaria_Chlorella_virus	34.2	5.1e-27
AVE74603.1|4099831_4100242_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	51.1	1.9e-35
AVE74604.1|4100263_4100419_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	78.4	1.2e-16
AVE74605.1|4100668_4101532_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	24.8	2.7e-12
AVE74606.1|4101515_4102634_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.1	6.4e-30
AVE74607.1|4102901_4104125_+	peptidase T	NA	NA	NA	NA	NA
AVE74608.1|4104222_4104714_+|transposase	transposase	transposase	NA	NA	NA	NA
AVE74609.1|4104802_4105924_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AVE74610.1|4106015_4107479_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
AVE74611.1|4107479_4108154_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AVE74612.1|4108561_4109017_+	anti-adapter protein IraM	NA	NA	NA	NA	NA
AVE74613.1|4109103_4110474_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.8	1.1e-108
AVE74614.1|4110493_4111123_-	lysogenization regulator HflD	NA	NA	NA	NA	NA
AVE74615.1|4111150_4112263_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AVE74616.1|4112303_4112777_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AVE74617.1|4112776_4113439_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AVE74618.1|4113556_4114807_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
AVE74619.1|4114970_4115702_+	hypothetical protein	NA	NA	NA	NA	NA
AVE75617.1|4115746_4116865_-|integrase	integrase	integrase	O21925	Phage_21	58.9	1.2e-121
AVE74620.1|4116872_4118020_-	DDE domain-containing protein	NA	U5P429	Shigella_phage	92.6	5.0e-147
AVE74621.1|4118195_4118564_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	61.2	1.9e-39
AVE74622.1|4118563_4119583_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	51.6	8.0e-96
AVE74623.1|4119592_4119934_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	78.8	6.4e-50
AVE74624.1|4119965_4120961_-	hypothetical protein	NA	NA	NA	NA	NA
AVE74625.1|4120957_4122043_-	hypothetical protein	NA	NA	NA	NA	NA
AVE74626.1|4122267_4123376_-|transposase	IS3-like element ISKpn20 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.1e-42
AVE74627.1|4123452_4123668_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	78.9	1.8e-26
AVE74628.1|4123667_4124204_+	lysozyme	NA	K7PM52	Enterobacteria_phage	80.0	1.7e-81
AVE74629.1|4124200_4124716_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	93.6	5.1e-83
AVE75618.1|4125037_4125370_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	60.9	1.1e-33
AVE74630.1|4125809_4126355_+|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	93.9	7.1e-91
AVE74631.1|4126329_4128252_+|terminase	phage terminase large subunit family protein	terminase	K7PGW7	Enterobacteria_phage	93.8	0.0e+00
AVE74632.1|4128251_4128458_+|tail	phage tail protein	tail	E4WL20	Enterobacteria_phage	95.5	9.3e-28
AVE74633.1|4128454_4130044_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	91.1	2.9e-286
AVE74634.1|4130024_4131368_+	S49 family peptidase	NA	O64320	Escherichia_phage	92.4	1.9e-201
AVE74635.1|4131377_4131710_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	93.6	1.8e-52
AVE74636.1|4131764_4132790_+|capsid	minor capsid protein E	capsid	K7PGW9	Enterobacteria_phage	95.9	2.2e-186
AVE74637.1|4132835_4133249_+	DNA-packaging protein	NA	E4WL26	Enterobacteria_phage	55.3	3.5e-26
AVE74638.1|4133260_4133614_+|tail	phage tail protein	tail	E4WL27	Enterobacteria_phage	94.0	5.4e-60
AVE74639.1|4133623_4134208_+|tail	phage tail protein	tail	M9NZH5	Enterobacteria_phage	99.5	2.6e-99
AVE74640.1|4134204_4134603_+|tail	phage tail protein	tail	E4WL29	Enterobacteria_phage	100.0	3.5e-71
AVE74641.1|4134609_4135353_+|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	98.0	2.5e-131
AVE74642.1|4135363_4135795_+|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	90.2	1.6e-66
AVE74643.1|4135803_4136118_+|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	93.3	3.7e-52
AVE74644.1|4136101_4139239_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	96.5	0.0e+00
AVE74645.1|4139235_4139574_+|tail	phage tail protein	tail	E4WL34	Enterobacteria_phage	100.0	2.3e-60
AVE74646.1|4139629_4140367_+|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	100.0	5.5e-147
AVE74647.1|4140369_4141089_+	peptidase P60	NA	K7PJY5	Enterobacterial_phage	97.5	1.3e-140
AVE74648.1|4141081_4141699_+|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	99.5	3.9e-106
AVE74649.1|4141741_4145332_+	DUF1983 domain-containing protein	NA	K7PMC2	Enterobacterial_phage	90.6	0.0e+00
AVE74650.1|4145376_4145691_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	65.7	3.0e-33
AVE74651.1|4145691_4146363_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.1	2.6e-87
AVE74652.1|4146470_4146704_+	cor protein	NA	E4WL42	Enterobacteria_phage	76.6	3.9e-30
AVE75619.1|4147291_4148041_+|tail	phage tail protein	tail	G8C7K5	Escherichia_phage	66.4	2.2e-87
AVE74653.1|4148037_4148724_-	hypothetical protein	NA	A0A192Y7T9	Enterobacteria_phage	36.4	6.9e-27
AVE75620.1|4148950_4149508_+	DNA-invertase	NA	A0A1S6L009	Salmonella_phage	78.1	5.0e-76
AVE74654.1|4149710_4151708_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	3.3e-21
>prophage 6
CP026719	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 chromosome, complete genome	5104736	4166683	4184284	5104736	integrase,transposase	Enterobacterial_phage(23.53%)	20	4163849:4163863	4183316:4183330
4163849:4163863	attL	CAGCTTCAGGGCGCT	NA	NA	NA	NA
AVE74672.1|4166683_4167826_-|integrase	integrase	integrase	O21940	Phage_21	48.4	1.2e-92
AVE74673.1|4167800_4168064_-	hypothetical protein	NA	NA	NA	NA	NA
AVE74674.1|4168099_4168675_-	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	54.1	8.4e-18
AVE74675.1|4168671_4169400_-	hypothetical protein	NA	Q858D1	Salmonella_phage	90.9	3.5e-37
AVE74676.1|4169386_4170412_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	89.2	1.3e-165
AVE75623.1|4170408_4170822_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	83.9	1.4e-54
AVE74677.1|4170870_4171191_-	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	55.7	6.1e-26
AVE74678.1|4171773_4172082_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	40.5	2.6e-10
AVE74679.1|4172378_4172975_-	transcriptional regulator	NA	NA	NA	NA	NA
AVE74680.1|4173083_4173314_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	40.5	1.1e-05
AVE74681.1|4173339_4173810_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	92.9	5.2e-74
AVE74682.1|4174050_4174236_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	5.2e-14
AVE74683.1|4174408_4175555_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	5.0e-147
AVE74684.1|4176936_4179312_+	SGNH/GDSL hydrolase family protein	NA	G0XNW5	Escherichia_phage	32.6	7.3e-92
AVE74685.1|4179351_4180797_-	hypothetical protein	NA	NA	NA	NA	NA
AVE74686.1|4180793_4181711_-	glycosyltransferase	NA	U5P087	Shigella_phage	90.8	1.1e-157
AVE74687.1|4181707_4182070_-	GtrA family protein	NA	U5P0S6	Shigella_phage	82.5	1.7e-48
AVE74688.1|4182182_4182422_+	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	65.4	1.5e-24
AVE74689.1|4182421_4182742_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.8	1.4e-25
AVE74690.1|4183000_4184284_-	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.1e-09
4183316:4183330	attR	CAGCTTCAGGGCGCT	NA	NA	NA	NA
>prophage 7
CP026719	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 chromosome, complete genome	5104736	4420473	4431473	5104736	transposase	Escherichia_phage(75.0%)	11	NA	NA
AVE74915.1|4420473_4421151_+	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	62.6	4.7e-76
AVE74916.1|4421189_4421504_+	nitroreductase	NA	NA	NA	NA	NA
AVE74917.1|4421618_4421930_-	DNA damage-inducible SOS regulon protein	NA	NA	NA	NA	NA
AVE74918.1|4422039_4422654_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	34.7	3.3e-28
AVE74919.1|4422698_4423553_-	dimethylsulfoxide reductase	NA	A0A077SK59	Escherichia_phage	33.1	6.4e-22
AVE74920.1|4423554_4424172_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	58.6	4.0e-74
AVE74921.1|4424182_4425292_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	47.3	5.7e-87
AVE74922.1|4426510_4427658_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	5.0e-147
AVE74923.1|4427718_4429185_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.7	6.5e-123
AVE74924.1|4429315_4429621_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AVE74925.1|4430365_4431473_+|transposase	IS3-like element ISKpn20 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.1e-42
>prophage 8
CP026719	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 chromosome, complete genome	5104736	4602686	4699828	5104736	integrase,protease,transposase	uncultured_Caudovirales_phage(32.35%)	81	4653311:4653339	4682680:4682708
AVE75066.1|4602686_4603331_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVE75067.1|4603345_4604599_+	secretion protein HlyD	NA	NA	NA	NA	NA
AVE75068.1|4604598_4606806_+	peptidase domain-containing ABC transporter	NA	F2Y165	Organic_Lake_phycodnavirus	29.8	1.5e-14
AVE75069.1|4607190_4608186_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVE75070.1|4608230_4608971_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.5	2.5e-30
AVE75071.1|4608967_4610263_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.2	6.7e-15
AVE75072.1|4611542_4612547_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVE75073.1|4612625_4615610_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.9	9.0e-305
AVE75074.1|4615769_4616348_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	35.5	1.9e-22
AVE75075.1|4616523_4617729_+	chromate transporter	NA	NA	NA	NA	NA
AVE75076.1|4617739_4618045_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AVE75077.1|4618173_4618872_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.4	4.5e-90
AVE75078.1|4618957_4619278_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	2.2e-20
AVE75637.1|4619322_4620612_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.1	5.8e-168
AVE75079.1|4620624_4621050_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.1	1.9e-51
AVE75080.1|4621230_4622253_+|transposase	IS110 family transposase IS5708	transposase	NA	NA	NA	NA
AVE75081.1|4622587_4623592_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVE75082.1|4624626_4625773_+	DDE domain-containing protein	NA	U5P429	Shigella_phage	92.6	5.0e-147
AVE75083.1|4625775_4626723_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AVE75638.1|4627359_4628268_+	HNH endonuclease	NA	NA	NA	NA	NA
AVE75084.1|4628653_4629004_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	55.0	3.5e-19
AVE75085.1|4629151_4629583_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AVE75086.1|4629833_4631309_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	3.0e-27
AVE75087.1|4631301_4631982_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
AVE75088.1|4632171_4633557_+	hypothetical protein	NA	NA	NA	NA	NA
AVE75089.1|4633584_4633938_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVE75090.1|4634051_4635344_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVE75091.1|4635354_4638501_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
AVE75092.1|4638587_4639028_+	hypothetical protein	NA	NA	NA	NA	NA
AVE75093.1|4639154_4641602_+	YHS domain-containing protein	NA	A0A218MNH6	uncultured_virus	34.9	2.9e-83
AVE75094.1|4641642_4641840_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AVE75095.1|4641873_4642611_-	peptidase	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
AVE75096.1|4642899_4643349_-	copper resistance protein	NA	NA	NA	NA	NA
AVE75097.1|4643583_4645401_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AVE75098.1|4645400_4646297_+	copper resistance protein B	NA	NA	NA	NA	NA
AVE75099.1|4646336_4646717_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AVE75100.1|4646721_4647651_+	copper resistance protein D	NA	NA	NA	NA	NA
AVE75101.1|4647705_4648386_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AVE75102.1|4648382_4649783_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
AVE75103.1|4650000_4650435_+	copper-binding protein	NA	NA	NA	NA	NA
AVE75104.1|4650658_4650955_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AVE75105.1|4650941_4651202_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AVE75106.1|4651332_4652479_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	5.0e-147
4653311:4653339	attL	ACCCGAAATCTGATTTATTCAACAAAGCC	NA	NA	NA	NA
AVE75107.1|4653701_4654880_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
AVE75108.1|4655402_4656419_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
AVE75109.1|4656456_4656579_-	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	100.0	1.7e-13
AVE75110.1|4656891_4657881_-|integrase	integrase	integrase	A0A1P8DJ76	Virus_Rctr85	40.3	2.1e-48
AVE75111.1|4658127_4659276_+	hypothetical protein	NA	NA	NA	NA	NA
AVE75112.1|4659665_4660190_-	hypothetical protein	NA	NA	NA	NA	NA
AVE75113.1|4660203_4661058_-	WYL domain-containing protein	NA	NA	NA	NA	NA
AVE75114.1|4661194_4662370_+	metallohydrolase	NA	NA	NA	NA	NA
AVE75115.1|4662369_4664598_+	hypothetical protein	NA	NA	NA	NA	NA
AVE75116.1|4664882_4665254_-	hypothetical protein	NA	NA	NA	NA	NA
AVE75117.1|4665695_4666843_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	5.0e-147
AVE75118.1|4667685_4667856_-	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
AVE75119.1|4667912_4669166_-	MFS transporter	NA	NA	NA	NA	NA
AVE75120.1|4669217_4672292_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.8	0.0e+00
AVE75121.1|4672413_4673496_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
AVE75639.1|4673749_4673947_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AVE75640.1|4674276_4674570_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
AVE75122.1|4674668_4675436_-	ferric citrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
AVE75123.1|4675436_4676393_-	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	5.3e-17
AVE75124.1|4676389_4677388_-	iron-dicitrate transporter permease subunit	NA	NA	NA	NA	NA
AVE75125.1|4677384_4678287_-	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AVE75126.1|4678331_4680662_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AVE75127.1|4680748_4681702_-	FecR family protein	NA	NA	NA	NA	NA
AVE75128.1|4681698_4682220_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AVE75641.1|4682695_4683820_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	92.5	9.8e-204
4682680:4682708	attR	GGCTTTGTTGAATAAATCAGATTTCGGGT	NA	NA	NA	NA
AVE75129.1|4685986_4687009_+|transposase	IS110 family transposase IS5708	transposase	NA	NA	NA	NA
AVE75130.1|4687343_4688348_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVE75131.1|4688960_4689719_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
AVE75132.1|4689803_4690388_-	GDP-mannose pyrophosphatase	NA	NA	NA	NA	NA
AVE75133.1|4690474_4691233_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AVE75134.1|4691337_4692630_+	glycoside hydrolase	NA	NA	NA	NA	NA
AVE75135.1|4693123_4694602_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
AVE75136.1|4694620_4695448_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	8.3e-43
AVE75137.1|4695507_4695933_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
AVE75138.1|4695945_4697235_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
AVE75139.1|4697280_4697601_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
AVE75140.1|4697687_4698392_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
AVE75141.1|4698424_4699828_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP026720	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 plasmid unitig_2_pilon, complete sequence	77822	4695	56540	77822	integrase,transposase	Escherichia_phage(33.33%)	55	4986:5045	53755:54221
AVE75657.1|4695_5400_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
4986:5045	attL	CCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCG	NA	NA	NA	NA
AVE75658.1|8484_8775_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AVE75659.1|8771_9173_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AVE75660.1|9162_9519_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AVE75661.1|9773_10100_+	hypothetical protein	NA	NA	NA	NA	NA
AVE75662.1|10096_10597_+|transposase	transposase	transposase	NA	NA	NA	NA
AVE75663.1|10593_10965_+	hypothetical protein	NA	NA	NA	NA	NA
AVE75664.1|10958_11516_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
AVE75665.1|11609_11843_-	hypothetical protein	NA	NA	NA	NA	NA
AVE75666.1|12181_12370_+	hypothetical protein	NA	NA	NA	NA	NA
AVE75667.1|13740_14721_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
AVE75668.1|15175_16261_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AVE75669.1|16294_17452_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
AVE75670.1|17448_18615_-	histidinol-phosphate transaminase	NA	A0A1X7QHI1	Faustovirus	27.4	1.5e-18
AVE75671.1|18673_20356_-	urocanate hydratase	NA	NA	NA	NA	NA
AVE75672.1|20399_21950_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.1	1.9e-80
AVE75673.1|22064_22850_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.9	3.2e-36
AVE75674.1|22849_23731_-	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	29.7	6.4e-25
AVE75675.1|23742_24729_-	ABC transporter permease	NA	NA	NA	NA	NA
AVE75676.1|24967_25564_-	HutD family protein	NA	NA	NA	NA	NA
AVE75677.1|25560_26934_-	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
AVE75678.1|27175_27976_+	histidine utilization repressor	NA	NA	NA	NA	NA
AVE75679.1|28129_29392_+	imidazolonepropionase	NA	NA	NA	NA	NA
AVE75680.1|29388_30213_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
AVE75681.1|30444_31122_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AVE75682.1|31167_32136_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	95.3	2.1e-178
AVE75683.1|32448_32859_-	hypothetical protein	NA	NA	NA	NA	NA
AVE75684.1|34170_35655_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	9.1e-32
AVE75685.1|35654_35906_-	hypothetical protein	NA	NA	NA	NA	NA
AVE75686.1|36063_36495_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
AVE75687.1|36494_37766_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
AVE75688.1|37847_38825_-	chromosome partitioning protein ParB	NA	Q38420	Escherichia_phage	54.4	2.6e-88
AVE75689.1|38821_40027_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
AVE75690.1|40441_40711_+	hypothetical protein	NA	NA	NA	NA	NA
AVE75691.1|40743_40941_-	hypothetical protein	NA	NA	NA	NA	NA
AVE75692.1|41067_41934_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AVE75693.1|42701_42959_+	hypothetical protein	NA	NA	NA	NA	NA
AVE75694.1|43016_43799_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
AVE75695.1|43795_44479_-	hypothetical protein	NA	NA	NA	NA	NA
AVE75696.1|44636_44942_-	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AVE75697.1|44943_45162_-	plasmid maintenance protein CcdA	NA	NA	NA	NA	NA
AVE75698.1|45213_45441_+	hypothetical protein	NA	NA	NA	NA	NA
AVE75699.1|45756_46005_+	hypothetical protein	NA	NA	NA	NA	NA
AVE75700.1|46001_47234_+	hypothetical protein	NA	NA	NA	NA	NA
AVE75701.1|47367_47859_+	DNA-binding protein	NA	NA	NA	NA	NA
AVE75702.1|47970_48171_-	hypothetical protein	NA	NA	NA	NA	NA
AVE75730.1|48897_49194_+	hypothetical protein	NA	NA	NA	NA	NA
AVE75703.1|49083_49392_-	hypothetical protein	NA	NA	NA	NA	NA
AVE75704.1|49517_49754_+	hypothetical protein	NA	NA	NA	NA	NA
AVE75705.1|49885_50434_+	thioredoxin-like domain protein	NA	NA	NA	NA	NA
AVE75706.1|50480_50915_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
AVE75707.1|51341_51896_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
AVE75708.1|52574_53683_-|transposase	IS3-like element ISKpn20 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.1e-42
AVE75709.1|54449_55430_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
53755:54221	attR	CCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
AVE75710.1|55571_56540_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	2.9e-180
