The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026743	Lactobacillus plantarum strain KC28 chromosome, complete genome	3291849	1128	35050	3291849	tail,integrase,terminase,holin,capsid,portal	Lactobacillus_phage(54.17%)	52	783:842	42280:42625
783:842	attL	TTTAGTTTGGCTTAATCATGTCTGCGTAGGCAAAAATGACATTTTGTGAATTAACCGTAT	NA	NA	NA	NA
AVE81475.1|1128_1965_+|tail	phage tail protein	tail	NA	NA	NA	NA
AVE81476.1|2031_3219_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81477.1|3193_3535_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81478.1|3552_3777_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81479.1|4202_4751_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81480.1|5118_5520_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81481.1|6657_7059_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81482.1|7074_7395_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81483.1|7384_7522_+	XkdX family protein	NA	NA	NA	NA	NA
AVE81484.1|7686_8859_+	endolysin	NA	E9LUR8	Lactobacillus_phage	89.5	1.5e-199
AVE81485.1|9141_9519_+|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	65.4	1.2e-17
AVE84440.1|9873_10137_+	hypothetical protein	NA	A9D9X7	Lactobacillus_prophage	45.2	1.8e-07
AVE81486.1|10218_10551_+	toxin MazF	NA	NA	NA	NA	NA
AVE81487.1|10996_12199_-|integrase	integrase	integrase	A0A126GGK4	Streptococcus_phage	29.2	9.0e-38
AVE81488.1|12507_13341_-	hypothetical protein	NA	NA	NA	NA	NA
AVE81489.1|13665_14097_-	hypothetical protein	NA	NA	NA	NA	NA
AVE81490.1|14089_14653_-	hypothetical protein	NA	NA	NA	NA	NA
AVE81491.1|14751_15453_-	hypothetical protein	NA	NA	NA	NA	NA
AVE81492.1|15510_15933_-	hypothetical protein	NA	NA	NA	NA	NA
AVE81493.1|15947_16451_-	XRE family transcriptional regulator	NA	S6C481	Thermus_phage	41.4	1.1e-21
AVE84441.1|16597_16852_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVE81494.1|17008_17290_-	hypothetical protein	NA	NA	NA	NA	NA
AVE81495.1|17348_17531_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81496.1|17527_17926_-	hypothetical protein	NA	A0A1P8L6H1	Staphylococcus_phage	37.6	8.7e-14
AVE81497.1|17925_18156_-	XRE family transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	36.8	8.5e-06
AVE81498.1|18298_18505_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVE81499.1|18504_18801_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81500.1|18825_19008_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81501.1|19068_19623_+	hypothetical protein	NA	O03909	Lactobacillus_phage	94.6	4.5e-93
AVE81502.1|19628_19916_+	DNA-binding protein	NA	NA	NA	NA	NA
AVE81503.1|19983_20154_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81504.1|20295_20682_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81505.1|20678_21578_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	47.7	6.0e-63
AVE81506.1|21489_22362_+	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	49.6	2.1e-73
AVE81507.1|22440_23346_+	DnaD domain protein	NA	NA	NA	NA	NA
AVE81508.1|23359_23860_+	hypothetical protein	NA	O03915	Lactobacillus_phage	87.3	4.2e-82
AVE81509.1|23856_24237_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81510.1|24229_24388_+	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	90.4	8.7e-18
AVE84442.1|24586_24931_+	hypothetical protein	NA	O03921	Lactobacillus_phage	55.3	2.9e-26
AVE81511.1|24923_25367_+	hypothetical protein	NA	A0A2P0ZLB8	Lactobacillus_phage	65.4	2.4e-52
AVE81512.1|25779_26241_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	1.1e-39
AVE81513.1|27036_27249_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81514.1|27294_27495_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	54.0	5.1e-07
AVE81515.1|27611_27926_+	hypothetical protein	NA	A0A0A8WIH8	Clostridium_phage	46.1	1.7e-17
AVE81516.1|27983_28247_+	hypothetical protein	NA	A0A1S5RCN3	Lactobacillus_phage	70.9	2.2e-29
AVE81517.1|28286_28802_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	83.6	6.1e-60
AVE81518.1|28794_30108_+|terminase	PBSX family phage terminase large subunit	terminase	D2IYW1	Enterococcus_phage	54.6	2.5e-126
AVE81519.1|30122_31859_+|portal	phage portal protein	portal	D2IZF6	Enterococcus_phage	34.4	1.6e-75
AVE81520.1|31858_32770_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81521.1|32880_33540_+	hypothetical protein	NA	A0A2H4J4U9	uncultured_Caudovirales_phage	28.2	1.7e-06
AVE81522.1|33553_33925_+	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	35.2	1.7e-08
AVE81523.1|33940_35050_+|capsid	major capsid protein E	capsid	A0A2H4J022	uncultured_Caudovirales_phage	40.1	5.3e-61
42280:42625	attR	TTTAGTTTGGCTTAATCATGTCTGCGTAGGCAAAAATGACATTTTGTGAATTAACCGTATCAAATTGACTAGTTAAACGATAGTTACAAAATCCTGCAGCTTCAGTGGCTACACAGATGTTTTCTAAATCTTTTAGCAGTTTTGCTTGAACATGGGGTTCATTTTGACCAGATGCAAAGGTTTGTATAATTCCAGTTGAATGGTAGCCTTCTGGAACCGCTCCAATAGTTTCAATTAGATTTTTCTTTGCCTCACTTTTACCAAATAGTGGCATTGTCATTACCTCACTTTATTTAATGCTTTTAGTATAATCCAACAAAATCAGAATAGAAAGGAGGAGCGTATC	NA	NA	NA	NA
>prophage 2
CP026743	Lactobacillus plantarum strain KC28 chromosome, complete genome	3291849	45049	51643	3291849	holin	Lactobacillus_phage(83.33%)	9	NA	NA
AVE81535.1|45049_47023_+	hypothetical protein	NA	A0A291I9J9	Lactobacillus_phage	43.2	4.8e-129
AVE81536.1|47038_48139_+	hypothetical protein	NA	O03968	Lactobacillus_phage	66.3	9.9e-68
AVE81537.1|48161_48563_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81538.1|48578_48899_+	hypothetical protein	NA	NA	NA	NA	NA
AVE81539.1|48898_49027_+	XkdX family protein	NA	NA	NA	NA	NA
AVE81540.1|49191_50364_+	endolysin	NA	E9LUR8	Lactobacillus_phage	89.5	1.5e-199
AVE81541.1|50364_50661_+	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	77.6	1.2e-39
AVE81542.1|50647_51025_+|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	65.4	1.2e-17
AVE84444.1|51379_51643_+	hypothetical protein	NA	A9D9X7	Lactobacillus_prophage	45.2	1.8e-07
>prophage 3
CP026743	Lactobacillus plantarum strain KC28 chromosome, complete genome	3291849	698246	708886	3291849	transposase	Lactobacillus_phage(90.0%)	10	NA	NA
AVE82094.1|698246_699485_+	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	99.7	5.7e-221
AVE82095.1|699575_700547_-	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	99.4	1.8e-182
AVE82096.1|700732_701680_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
AVE82097.1|702023_702638_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
AVE82098.1|702640_705079_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.9	0.0e+00
AVE82099.1|705166_705727_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	100.0	2.7e-101
AVE82100.1|705797_706238_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	99.3	8.0e-77
AVE82101.1|706582_707050_+	hypothetical protein	NA	A0A2P0ZL91	Lactobacillus_phage	100.0	2.7e-83
AVE82102.1|707024_707255_+	hypothetical protein	NA	A0A2P0ZL95	Lactobacillus_phage	100.0	1.4e-37
AVE82103.1|707191_708886_-|transposase	DDE transposase	transposase	A0ZS58	Staphylococcus_virus	41.3	1.8e-92
>prophage 4
CP026743	Lactobacillus plantarum strain KC28 chromosome, complete genome	3291849	923987	961914	3291849	head,tail,integrase,holin,capsid,plate,portal	Lactobacillus_phage(62.5%)	50	923186:923199	928517:928530
923186:923199	attL	TGTTAACATTTTTT	NA	NA	NA	NA
AVE82306.1|923987_925208_-|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	41.1	2.1e-82
AVE82307.1|925413_925590_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	55.2	6.3e-09
AVE82308.1|925722_925911_-	hypothetical protein	NA	E9LUS5	Lactobacillus_phage	90.3	1.2e-21
AVE82309.1|926081_926312_-	hypothetical protein	NA	NA	NA	NA	NA
AVE82310.1|926840_927272_-	hypothetical protein	NA	O03904	Lactobacillus_phage	83.6	2.8e-66
AVE82311.1|927280_927679_-	XRE family transcriptional regulator	NA	O03970	Lactobacillus_phage	97.0	3.6e-68
AVE82312.1|927846_928113_+	XRE family transcriptional regulator	NA	O03906	Lactobacillus_phage	96.6	3.0e-39
AVE82313.1|928210_928525_-	hypothetical protein	NA	NA	NA	NA	NA
AVE82314.1|928562_928799_-	XRE family transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	42.7	5.9e-10
928517:928530	attR	TGTTAACATTTTTT	NA	NA	NA	NA
AVE82315.1|928802_929138_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVE82316.1|929277_929484_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AVE82317.1|929483_929780_+	hypothetical protein	NA	NA	NA	NA	NA
AVE82318.1|929804_929987_+	hypothetical protein	NA	NA	NA	NA	NA
AVE82319.1|930051_930600_+	hypothetical protein	NA	NA	NA	NA	NA
AVE82320.1|930614_930878_+	hypothetical protein	NA	NA	NA	NA	NA
AVE82321.1|931286_931409_+	hypothetical protein	NA	NA	NA	NA	NA
AVE82322.1|931410_931920_+	hypothetical protein	NA	NA	NA	NA	NA
AVE82323.1|931926_932595_+	nucleotide-binding protein	NA	E9LUU1	Lactobacillus_phage	75.1	2.7e-92
AVE82324.1|932591_933137_+	hypothetical protein	NA	D2KRE3	Lactobacillus_phage	46.0	8.5e-28
AVE82325.1|933217_934006_+	DNA replication protein DnaD	NA	NA	NA	NA	NA
AVE82326.1|933986_934829_+	ATP-binding protein	NA	O03914	Lactobacillus_phage	99.3	4.6e-158
AVE82327.1|934961_935264_+	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	81.0	6.3e-41
AVE82328.1|935630_937394_-	hypothetical protein	NA	NA	NA	NA	NA
AVE82329.1|937776_938205_+	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	77.3	3.3e-59
AVE82330.1|938724_939207_+	hypothetical protein	NA	NA	NA	NA	NA
AVE84461.1|939418_940096_+	hypothetical protein	NA	V5URT8	Oenococcus_phage	46.2	2.2e-41
AVE82331.1|941356_943015_+|portal	phage portal protein	portal	D2IYW2	Enterococcus_phage	33.4	1.4e-65
AVE82332.1|943014_943959_+|head	phage head morphogenesis protein	head	NA	NA	NA	NA
AVE82333.1|944067_944715_+|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AVE82334.1|945812_946178_+	hypothetical protein	NA	A0A2H4IYR7	uncultured_Caudovirales_phage	38.2	6.8e-05
AVE84462.1|946182_946506_+	hypothetical protein	NA	NA	NA	NA	NA
AVE82335.1|946495_947050_+|tail	phage tail protein	tail	NA	NA	NA	NA
AVE82336.1|947050_947437_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AVE82337.1|947448_948036_+|tail	phage tail protein	tail	NA	NA	NA	NA
AVE82338.1|948053_948566_+	hypothetical protein	NA	NA	NA	NA	NA
AVE82339.1|948634_948871_+	hypothetical protein	NA	NA	NA	NA	NA
AVE82340.1|948870_952875_+	tape measure protein	NA	E9LUR1	Lactobacillus_phage	44.3	5.2e-82
AVE82341.1|952868_953606_+|tail	phage tail protein	tail	A0A1S5SA63	Streptococcus_phage	36.6	4.1e-41
AVE82342.1|953605_955456_+	endolysin	NA	A0A1X9IGI5	Lactococcus_phage	33.4	7.8e-49
AVE82343.1|955460_956453_+	SGNH/GDSL hydrolase family protein	NA	Q8LTH0	Staphylococcus_virus	41.0	4.8e-37
AVE82344.1|956467_957082_+|plate	phage baseplate upper protein	plate	A0A1J0MFQ3	Staphylococcus_phage	47.8	7.3e-44
AVE82345.1|957087_957828_+	hypothetical protein	NA	NA	NA	NA	NA
AVE82346.1|957828_958149_+	hypothetical protein	NA	NA	NA	NA	NA
AVE82347.1|958148_958325_+	XkdX family protein	NA	NA	NA	NA	NA
AVE82348.1|958302_959460_+	lysin	NA	A0A2K9V5A4	Lactobacillus_phage	67.2	8.6e-46
AVE82349.1|959459_959723_+|holin	holin	holin	E9LUR9	Lactobacillus_phage	73.6	8.5e-26
AVE82350.1|959736_960099_+|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	67.1	2.4e-18
AVE82351.1|960430_960652_-	hypothetical protein	NA	NA	NA	NA	NA
AVE82352.1|960888_961113_-	hypothetical protein	NA	NA	NA	NA	NA
AVE82353.1|961308_961914_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	28.7	3.5e-14
>prophage 5
CP026743	Lactobacillus plantarum strain KC28 chromosome, complete genome	3291849	1085758	1111499	3291849	head,tail,integrase,terminase,holin,capsid,portal	Lactobacillus_phage(83.33%)	22	1083806:1083821	1094277:1094292
1083806:1083821	attL	ACGGTCATAGTTAATA	NA	NA	NA	NA
AVE82469.1|1085758_1086613_+|integrase	integrase	integrase	NA	NA	NA	NA
AVE82470.1|1087113_1087896_+	hypothetical protein	NA	NA	NA	NA	NA
AVE82471.1|1088145_1088505_-|holin	holin	holin	A0A2P0ZLG6	Lactobacillus_phage	81.9	3.0e-29
AVE82472.1|1088514_1088784_-|holin	holin	holin	E9LUR9	Lactobacillus_phage	81.9	2.2e-29
AVE82473.1|1089802_1090162_-	hypothetical protein	NA	E9LUR7	Lactobacillus_phage	78.2	3.8e-45
AVE82474.1|1090310_1090562_-	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	95.8	1.6e-29
AVE82475.1|1090554_1093752_-	hypothetical protein	NA	A0A2P0ZL34	Lactobacillus_phage	56.8	3.7e-187
AVE82476.1|1093769_1096181_-	hypothetical protein	NA	A0A2P0ZLF8	Lactobacillus_phage	94.0	0.0e+00
1094277:1094292	attR	ACGGTCATAGTTAATA	NA	NA	NA	NA
AVE82477.1|1096247_1098020_-|tail	phage tail protein	tail	A0A2P0ZLH2	Lactobacillus_phage	92.9	8.8e-308
AVE82478.1|1098095_1103009_-	peptidase M23	NA	A0A2P0ZLG0	Lactobacillus_phage	61.8	0.0e+00
AVE82479.1|1103050_1103236_-	hypothetical protein	NA	NA	NA	NA	NA
AVE82480.1|1103280_1103655_-	hypothetical protein	NA	A0A2P0ZLH4	Lactobacillus_phage	95.2	1.9e-58
AVE82481.1|1103734_1104391_-|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	93.0	6.9e-109
AVE82482.1|1104407_1104788_-	DUF806 domain-containing protein	NA	A0A2P0ZLF4	Lactobacillus_phage	92.9	4.5e-60
AVE82483.1|1104787_1105195_-	hypothetical protein	NA	A0A2P0ZLE6	Lactobacillus_phage	94.7	5.3e-67
AVE82484.1|1105197_1105545_-|head,tail	phage head-tail adapter protein	head,tail	A0A2P0ZLF0	Lactobacillus_phage	91.3	1.5e-54
AVE84465.1|1105545_1105827_-	hypothetical protein	NA	A0A2P0ZLF2	Lactobacillus_phage	91.2	3.2e-39
AVE82485.1|1105956_1107786_-|capsid	phage major capsid protein	capsid	A0A2P0ZLF9	Lactobacillus_phage	62.5	2.5e-148
AVE84466.1|1107751_1108876_-|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	42.6	1.9e-69
AVE82486.1|1108914_1109100_-	hypothetical protein	NA	NA	NA	NA	NA
AVE82487.1|1109122_1111042_-|terminase	terminase large subunit	terminase	A0A286QRK5	Streptococcus_phage	41.1	2.7e-121
AVE82488.1|1111031_1111499_-|terminase	phage terminase small subunit P27 family	terminase	A0A2P0VG04	Streptococcus_phage	42.6	1.4e-23
>prophage 6
CP026743	Lactobacillus plantarum strain KC28 chromosome, complete genome	3291849	1624722	1673107	3291849	tail,terminase,protease,holin,capsid,portal	Lactobacillus_phage(37.5%)	61	NA	NA
AVE82949.1|1624722_1626453_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	2.6e-46
AVE82950.1|1626680_1627073_-	DUF1093 domain-containing protein	NA	NA	NA	NA	NA
AVE82951.1|1627295_1628147_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AVE82952.1|1628143_1628302_-	cytochrome D ubiquinol oxidase	NA	NA	NA	NA	NA
AVE82953.1|1628559_1629078_+	hypothetical protein	NA	NA	NA	NA	NA
AVE82954.1|1629223_1629394_-	hypothetical protein	NA	O03950	Lactobacillus_phage	63.0	2.0e-07
AVE82955.1|1629617_1629992_-|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	67.9	2.2e-19
AVE82956.1|1629978_1630275_-	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	77.6	4.4e-39
AVE84479.1|1630275_1631409_-	lysin	NA	O03950	Lactobacillus_phage	64.2	7.6e-47
AVE82957.1|1631569_1632004_-	hypothetical protein	NA	NA	NA	NA	NA
AVE82958.1|1632006_1632456_-	hypothetical protein	NA	A0A2P0ZLE0	Lactobacillus_phage	41.1	2.0e-22
AVE82959.1|1632477_1637733_-	hypothetical protein	NA	Q6SE68	Lactobacillus_prophage	59.4	3.7e-144
AVE84480.1|1637747_1638080_-	hypothetical protein	NA	V5UQS8	Oenococcus_phage	73.4	2.2e-42
AVE82960.1|1638123_1643955_-|tail	phage tail protein	tail	V5URV5	Oenococcus_phage	41.2	5.8e-231
AVE84481.1|1643970_1644234_-	hypothetical protein	NA	V9QKH3	Oenococcus_phage	65.4	2.3e-23
AVE82961.1|1644341_1644740_-	hypothetical protein	NA	V9QJA0	Oenococcus_phage	74.8	3.0e-46
AVE84482.1|1644839_1645223_-|tail	phage tail protein	tail	V5USQ9	Oenococcus_phage	58.4	1.8e-37
AVE82962.1|1645324_1645690_-	hypothetical protein	NA	V5UQS4	Oenococcus_phage	53.4	3.0e-29
AVE82963.1|1645689_1646241_-	hypothetical protein	NA	V5URV0	Oenococcus_phage	61.7	3.3e-64
AVE82964.1|1646242_1646590_-	hypothetical protein	NA	V5US85	Oenococcus_phage	62.3	3.2e-36
AVE82965.1|1646589_1646922_-	hypothetical protein	NA	V9QJ97	Oenococcus_phage	44.2	8.8e-12
AVE82966.1|1646933_1647110_-	conjugal transfer protein	NA	NA	NA	NA	NA
AVE82967.1|1647122_1648145_-|capsid	minor capsid protein E	capsid	V5US24	Oenococcus_phage	62.5	3.7e-117
AVE82968.1|1648164_1648512_-	hypothetical protein	NA	V5UTH9	Oenococcus_phage	60.0	1.2e-27
AVE82969.1|1648526_1649195_-	scaffolding protein	NA	Q6SE80	Lactobacillus_prophage	32.6	2.0e-15
AVE82970.1|1650741_1651038_-|protease	ribosomal-processing cysteine protease Prp	protease	D2J003	Enterococcus_phage	40.2	1.1e-10
AVE82971.1|1650967_1652476_-|portal	phage portal protein	portal	V5US18	Oenococcus_phage	51.6	5.3e-136
AVE82972.1|1652487_1653726_-|terminase	PBSX family phage terminase large subunit	terminase	M1PG09	Streptococcus_phage	61.2	1.0e-137
AVE82973.1|1653715_1654588_-|terminase	terminase	terminase	V5URT8	Oenococcus_phage	47.6	1.2e-52
AVE82974.1|1654628_1654874_-	DUF2829 domain-containing protein	NA	S5VZM6	Pseudomonas_phage	51.9	5.7e-16
AVE82975.1|1655086_1655293_+	CsbD family protein	NA	NA	NA	NA	NA
AVE82976.1|1655249_1655456_-	hypothetical protein	NA	NA	NA	NA	NA
AVE82977.1|1656329_1656977_+	hypothetical protein	NA	NA	NA	NA	NA
AVE82978.1|1657218_1657668_-	hypothetical protein	NA	B8R690	Lactobacillus_phage	37.7	1.4e-12
AVE82979.1|1657804_1657972_-	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	91.5	9.5e-15
AVE82980.1|1658044_1658641_-	hypothetical protein	NA	E9LUN9	Lactobacillus_phage	86.1	8.5e-98
AVE82981.1|1658740_1658935_-	hypothetical protein	NA	A0A2P0ZLB7	Lactobacillus_phage	72.4	9.1e-17
AVE82982.1|1658938_1659250_-	hypothetical protein	NA	A0A2P0ZLB4	Lactobacillus_phage	90.3	2.7e-47
AVE82983.1|1659252_1659627_-	hypothetical protein	NA	NA	NA	NA	NA
AVE82984.1|1659623_1660124_-	hypothetical protein	NA	O03915	Lactobacillus_phage	92.2	2.8e-86
AVE82985.1|1660137_1661088_-	hypothetical protein	NA	NA	NA	NA	NA
AVE82986.1|1661177_1661573_-	single-stranded DNA-binding protein	NA	D6PSU2	Lactobacillus_phage	67.2	2.5e-45
AVE82987.1|1661569_1662217_-	erf family protein	NA	D6PSU1	Lactobacillus_phage	59.0	3.0e-64
AVE82988.1|1662219_1662732_-	hypothetical protein	NA	NA	NA	NA	NA
AVE82989.1|1662724_1662856_-	hypothetical protein	NA	NA	NA	NA	NA
AVE82990.1|1662988_1663159_-	hypothetical protein	NA	NA	NA	NA	NA
AVE82991.1|1663226_1663739_-	XRE family transcriptional regulator	NA	D6PST4	Lactobacillus_phage	39.4	2.0e-23
AVE82992.1|1663806_1664112_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
AVE82993.1|1664452_1664653_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVE82994.1|1664799_1665036_+	XRE family transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	30.7	8.5e-09
AVE82995.1|1665073_1665388_+	hypothetical protein	NA	NA	NA	NA	NA
AVE84483.1|1665444_1665699_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVE82996.1|1665844_1666348_+	XRE family transcriptional regulator	NA	S6C481	Thermus_phage	42.6	1.7e-22
AVE82997.1|1666362_1666785_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	35.1	3.0e-12
AVE82998.1|1666891_1667611_+	hypothetical protein	NA	NA	NA	NA	NA
AVE82999.1|1668083_1668875_+	hypothetical protein	NA	NA	NA	NA	NA
AVE83000.1|1668884_1669139_+	hypothetical protein	NA	NA	NA	NA	NA
AVE83001.1|1669217_1669592_+	transporter	NA	A0A0P0I7G8	Lactobacillus_phage	65.8	1.9e-34
AVE83002.1|1670291_1671332_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	49.4	3.4e-86
AVE83003.1|1671336_1672386_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	35.7	2.2e-48
AVE83004.1|1672390_1673107_+	hypothetical protein	NA	A0A0R6PER3	Moraxella_phage	26.9	2.7e-05
>prophage 7
CP026743	Lactobacillus plantarum strain KC28 chromosome, complete genome	3291849	1866516	1875030	3291849		Synechococcus_phage(33.33%)	9	NA	NA
AVE83178.1|1866516_1867095_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
AVE83179.1|1867087_1868113_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	40.7	4.2e-60
AVE83180.1|1868109_1869564_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
AVE83181.1|1869548_1871768_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.3	4.5e-144
AVE83182.1|1871760_1872441_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AVE83183.1|1872440_1872695_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AVE83184.1|1872696_1873428_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
AVE83185.1|1873430_1874561_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AVE83186.1|1874544_1875030_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
>prophage 8
CP026743	Lactobacillus plantarum strain KC28 chromosome, complete genome	3291849	3049617	3097555	3291849	transposase,bacteriocin,protease	Staphylococcus_virus(33.33%)	46	NA	NA
AVE84214.1|3049617_3051351_+|transposase	DDE transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	6.3e-93
AVE84215.1|3051305_3051815_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AVE84216.1|3051845_3053042_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
AVE84217.1|3053151_3053622_+	transcriptional regulator	NA	NA	NA	NA	NA
AVE84218.1|3053640_3054096_+	hypothetical protein	NA	NA	NA	NA	NA
AVE84219.1|3054199_3054772_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
AVE84220.1|3054937_3055858_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
AVE84221.1|3055994_3056894_+	oxidoreductase	NA	NA	NA	NA	NA
AVE84222.1|3057333_3059214_+	hypothetical protein	NA	NA	NA	NA	NA
AVE84223.1|3059385_3059832_-	ribonuclease H	NA	NA	NA	NA	NA
AVE84224.1|3060069_3061596_+	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
AVE84225.1|3061596_3062568_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
AVE84226.1|3062645_3063977_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AVE84227.1|3064442_3065960_+	glycerol kinase	NA	NA	NA	NA	NA
AVE84228.1|3065974_3067804_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
AVE84229.1|3067818_3068541_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	3.2e-30
AVE84230.1|3074621_3075014_+	hypothetical protein	NA	NA	NA	NA	NA
AVE84231.1|3075229_3075550_+	hypothetical protein	NA	NA	NA	NA	NA
AVE84232.1|3076697_3076970_+	hypothetical protein	NA	NA	NA	NA	NA
AVE84233.1|3077351_3077552_+	hypothetical protein	NA	NA	NA	NA	NA
AVE84234.1|3077809_3078043_+	hypothetical protein	NA	NA	NA	NA	NA
AVE84235.1|3078171_3078591_+	hypothetical protein	NA	NA	NA	NA	NA
AVE84236.1|3078882_3079347_+	hypothetical protein	NA	NA	NA	NA	NA
AVE84237.1|3079625_3080243_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
AVE84238.1|3080246_3081401_-	MFS transporter	NA	NA	NA	NA	NA
AVE84239.1|3081404_3082196_-	HAD family hydrolase	NA	NA	NA	NA	NA
AVE84240.1|3082266_3083139_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVE84241.1|3083298_3084114_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AVE84242.1|3084639_3086016_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
AVE84243.1|3086060_3087245_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AVE84244.1|3087905_3088049_+	plantaricin NC8 alpha peptide precursor	NA	NA	NA	NA	NA
AVE84245.1|3088060_3088249_+	hypothetical protein	NA	NA	NA	NA	NA
AVE84246.1|3088694_3089024_-	hypothetical protein	NA	NA	NA	NA	NA
AVE84513.1|3089489_3090005_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AVE84247.1|3090209_3090413_+	hypothetical protein	NA	NA	NA	NA	NA
AVE84248.1|3090647_3090800_-	hypothetical protein	NA	NA	NA	NA	NA
AVE84249.1|3090824_3091493_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AVE84250.1|3091913_3092144_+	hypothetical protein	NA	NA	NA	NA	NA
AVE84251.1|3092228_3092417_+	pirin	NA	NA	NA	NA	NA
AVE84252.1|3092753_3092900_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AVE84253.1|3093090_3094419_+	histidine kinase	NA	NA	NA	NA	NA
AVE84254.1|3094419_3095163_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVE84255.1|3095281_3096025_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVE84256.1|3096329_3097103_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVE84257.1|3097201_3097360_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
AVE84258.1|3097384_3097555_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
>prophage 9
CP026743	Lactobacillus plantarum strain KC28 chromosome, complete genome	3291849	3278957	3291812	3291849	terminase	Lactobacillus_phage(73.33%)	27	NA	NA
AVE84415.1|3278957_3279461_-	XRE family transcriptional regulator	NA	S6C481	Thermus_phage	41.4	1.1e-21
AVE84517.1|3279607_3279862_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVE84416.1|3280018_3280300_-	hypothetical protein	NA	NA	NA	NA	NA
AVE84417.1|3280358_3280541_+	hypothetical protein	NA	NA	NA	NA	NA
AVE84418.1|3280537_3280936_-	hypothetical protein	NA	A0A1P8L6H1	Staphylococcus_phage	37.6	8.7e-14
AVE84419.1|3280935_3281166_-	XRE family transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	36.8	8.5e-06
AVE84420.1|3281308_3281515_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVE84421.1|3281514_3281811_+	hypothetical protein	NA	NA	NA	NA	NA
AVE84422.1|3281835_3282018_+	hypothetical protein	NA	NA	NA	NA	NA
AVE84423.1|3282078_3282633_+	hypothetical protein	NA	O03909	Lactobacillus_phage	94.6	4.5e-93
AVE84424.1|3282638_3282926_+	DNA-binding protein	NA	NA	NA	NA	NA
AVE84425.1|3282993_3283164_+	hypothetical protein	NA	NA	NA	NA	NA
AVE84426.1|3283305_3283692_+	hypothetical protein	NA	NA	NA	NA	NA
AVE84427.1|3283688_3284588_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	47.7	6.0e-63
AVE84428.1|3284499_3285372_+	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	49.6	2.1e-73
AVE84429.1|3285450_3286356_+	DnaD domain protein	NA	NA	NA	NA	NA
AVE84430.1|3286369_3286870_+	hypothetical protein	NA	O03915	Lactobacillus_phage	87.3	4.2e-82
AVE84431.1|3286866_3287247_+	hypothetical protein	NA	NA	NA	NA	NA
AVE84432.1|3287239_3287398_+	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	90.4	8.7e-18
AVE84518.1|3287596_3287941_+	hypothetical protein	NA	O03921	Lactobacillus_phage	55.3	2.9e-26
AVE84433.1|3287933_3288377_+	hypothetical protein	NA	A0A2P0ZLB8	Lactobacillus_phage	65.4	2.4e-52
AVE84434.1|3288789_3289251_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	1.1e-39
AVE84435.1|3290047_3290260_+	hypothetical protein	NA	NA	NA	NA	NA
AVE84436.1|3290305_3290506_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	54.0	5.1e-07
AVE84437.1|3290622_3290937_+	hypothetical protein	NA	A0A0A8WIH8	Clostridium_phage	46.1	1.7e-17
AVE84438.1|3290993_3291257_+	hypothetical protein	NA	A0A1S5RCN3	Lactobacillus_phage	70.9	2.2e-29
AVE84439.1|3291296_3291812_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	83.6	6.1e-60
