The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026756	Klebsiella aerogenes strain AR_0062 chromosome, complete genome	5264003	2226022	2292591	5264003	tail,protease,terminase,holin	Salmonella_phage(36.73%)	72	NA	NA
AVE99137.1|2226022_2227489_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	8.8e-88
AVE99138.1|2227558_2229136_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
AVE99139.1|2229328_2230579_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	81.4	2.2e-196
AVE99140.1|2230595_2230904_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	53.9	1.6e-23
AVE99141.1|2230903_2231206_-	hypothetical protein	NA	NA	NA	NA	NA
AVE99142.1|2231202_2231793_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.8	4.0e-108
AVE99143.1|2231785_2232082_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	69.7	5.2e-32
AVE99144.1|2232191_2232440_-	AlpA family phage regulatory protein	NA	A0A193GYW1	Enterobacter_phage	85.4	8.5e-36
AVE99145.1|2232490_2233372_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	86.3	1.3e-139
AVE99146.1|2233368_2234190_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	93.4	7.5e-153
AVF01940.1|2234401_2234701_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	49.5	6.1e-20
AVE99147.1|2235003_2235591_-	helix-turn-helix domain-containing protein	NA	G9L6A6	Escherichia_phage	61.0	6.3e-61
AVE99148.1|2235745_2235976_+	hypothetical protein	NA	A0A193GYK6	Enterobacter_phage	90.8	3.0e-35
AVE99149.1|2236124_2236334_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	81.2	8.0e-27
AVE99150.1|2236333_2237101_+	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	88.6	7.0e-137
AVE99151.1|2237097_2237883_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	89.3	1.4e-137
AVE99152.1|2238002_2238347_+	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	86.0	2.4e-52
AVE99153.1|2239221_2239641_+	hypothetical protein	NA	NA	NA	NA	NA
AVE99154.1|2239773_2240289_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	75.8	3.8e-70
AVE99155.1|2240820_2241159_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	87.3	4.1e-49
AVF01941.1|2241234_2241564_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	60.7	1.0e-28
AVE99156.1|2241621_2242206_+|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	84.5	1.2e-85
AVE99157.1|2242202_2243672_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	94.1	2.0e-281
AVE99158.1|2243707_2243983_-	hypothetical protein	NA	NA	NA	NA	NA
AVE99159.1|2244641_2244848_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	2.6e-06
AVE99160.1|2244862_2246542_+|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	81.2	2.4e-262
AVE99161.1|2246538_2246835_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	72.4	8.6e-35
AVE99162.1|2246840_2247110_+	hypothetical protein	NA	V5KSC6	Escherichia_phage	83.8	3.1e-23
AVE99163.1|2247120_2247819_+	peptidase	NA	G9L6C4	Escherichia_phage	86.2	4.8e-76
AVE99164.1|2247833_2248820_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	93.6	5.2e-177
AVE99165.1|2248873_2249329_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	84.1	5.7e-62
AVE99166.1|2249339_2249687_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	68.7	4.1e-36
AVE99167.1|2249737_2250061_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	7.0e-46
AVE99168.1|2250060_2250666_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	78.0	8.1e-88
AVE99169.1|2250665_2253143_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.6	0.0e+00
AVE99170.1|2253142_2253607_+	hypothetical protein	NA	T1SA73	Salmonella_phage	81.8	9.6e-73
AVE99171.1|2253606_2254149_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	66.1	5.3e-54
AVE99172.1|2254160_2256695_+	hypothetical protein	NA	Q858G0	Salmonella_phage	82.3	0.0e+00
AVE99173.1|2256694_2258260_+	hypothetical protein	NA	Q858F9	Salmonella_phage	69.1	1.6e-220
AVE99174.1|2258259_2261025_+	hypothetical protein	NA	Q858F8	Salmonella_phage	94.8	0.0e+00
AVE99175.1|2261161_2261551_+	hypothetical protein	NA	NA	NA	NA	NA
AVF01942.1|2261589_2262066_-	hypothetical protein	NA	G9L6E0	Escherichia_phage	71.0	9.6e-60
AVE99176.1|2262112_2262292_-	hypothetical protein	NA	NA	NA	NA	NA
AVE99177.1|2262481_2263153_-	BRO-like protein	NA	A0A193GYJ9	Enterobacter_phage	62.2	3.7e-73
AVE99178.1|2263466_2263727_-	hypothetical protein	NA	T1SA06	Salmonella_phage	82.4	1.9e-33
AVE99179.1|2263920_2266308_+|tail	phage tail protein	tail	R9TMK5	Aeromonas_phage	37.8	7.6e-89
AVE99180.1|2266311_2266572_+	hypothetical protein	NA	L0ARW5	Klebsiella_phage	56.6	6.2e-21
AVE99181.1|2266661_2267066_+	hypothetical protein	NA	T1SA79	Salmonella_phage	83.6	3.2e-56
AVE99182.1|2267052_2267358_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	6.0e-39
AVE99183.1|2267347_2267977_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	84.7	4.8e-99
AVE99184.1|2267973_2268474_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	5.9e-60
AVE99185.1|2268708_2268942_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AVE99186.1|2268972_2269305_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AVE99187.1|2269339_2270548_-	MFS transporter	NA	NA	NA	NA	NA
AVE99188.1|2270646_2271540_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVE99189.1|2271543_2271753_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	76.7	4.2e-20
AVE99190.1|2272105_2274337_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AVE99191.1|2274385_2275912_-	exopolyphosphatase	NA	NA	NA	NA	NA
AVE99192.1|2275915_2277976_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
AVF01943.1|2278153_2279812_+	hypothetical protein	NA	NA	NA	NA	NA
AVE99193.1|2279817_2280915_-	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
AVE99194.1|2280889_2282341_-	MFS transporter	NA	NA	NA	NA	NA
AVE99195.1|2282761_2284102_+	glycoside hydrolase family 28 protein	NA	NA	NA	NA	NA
AVE99196.1|2284155_2284797_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.8	1.9e-31
AVE99197.1|2284793_2285831_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	1.1e-71
AVE99198.1|2285938_2286058_+	hypothetical protein	NA	NA	NA	NA	NA
AVE99199.1|2286080_2287511_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AVE99200.1|2287707_2288334_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AVE99201.1|2288430_2289717_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	8.3e-66
AVE99202.1|2289815_2290517_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
AVE99203.1|2290758_2291118_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
AVE99204.1|2291127_2292591_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
>prophage 2
CP026756	Klebsiella aerogenes strain AR_0062 chromosome, complete genome	5264003	3150743	3209633	5264003	tail,terminase,holin,coat	Klebsiella_phage(17.24%)	75	NA	NA
AVE99929.1|3150743_3151553_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.0	6.1e-14
AVE99930.1|3151554_3152547_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	26.1	1.6e-08
AVE99931.1|3152546_3153437_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
AVE99932.1|3153613_3154801_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	52.7	1.6e-119
AVE99933.1|3154697_3155012_-	hypothetical protein	NA	K7PM28	Enterobacteria_phage	52.4	4.1e-11
AVF01983.1|3155021_3155261_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	71.4	1.9e-24
AVE99934.1|3155268_3155577_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	1.9e-24
AVF01984.1|3155573_3156248_-	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	46.3	1.1e-48
AVE99935.1|3156291_3157380_-	enterohemolysin	NA	H6WRX0	Salmonella_phage	56.8	3.3e-108
AVE99936.1|3157391_3160532_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	54.4	7.0e-276
AVE99937.1|3160671_3160830_-	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	59.6	2.9e-13
AVE99938.1|3160838_3161030_-	DUF1482 family protein	NA	NA	NA	NA	NA
AVF01985.1|3161091_3161235_-	hypothetical protein	NA	NA	NA	NA	NA
AVE99939.1|3161515_3161728_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	74.2	4.3e-20
AVE99940.1|3161756_3162200_-	hypothetical protein	NA	NA	NA	NA	NA
AVE99941.1|3162189_3162423_-	hypothetical protein	NA	NA	NA	NA	NA
AVE99942.1|3163115_3163502_-	XRE family transcriptional regulator	NA	K7PM35	Enterobacteria_phage	74.0	3.7e-46
AVE99943.1|3163606_3163840_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	61.6	2.1e-20
AVE99944.1|3163842_3164379_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	70.9	2.5e-64
AVE99945.1|3164730_3165645_+	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	62.5	3.0e-94
AVE99946.1|3165641_3166385_+	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	54.4	1.3e-63
AVE99947.1|3166377_3166713_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	46.8	1.1e-12
AVE99948.1|3166705_3167491_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	5.3e-63
AVE99949.1|3167487_3167691_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	84.8	3.8e-26
AVE99950.1|3167683_3167935_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	49.3	1.8e-09
AVE99951.1|3167934_3168192_+	hypothetical protein	NA	NA	NA	NA	NA
AVE99952.1|3168188_3170168_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.7	8.0e-201
AVE99953.1|3170320_3170764_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVE99954.1|3171243_3171477_+	hypothetical protein	NA	A0A0M4R5D9	Salmonella_phage	54.5	1.3e-17
AVE99955.1|3171512_3172109_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	77.0	6.8e-87
AVE99956.1|3172113_3172314_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	75.8	5.5e-25
AVE99957.1|3172894_3173035_+	YlcG family protein	NA	NA	NA	NA	NA
AVE99958.1|3173031_3173853_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	72.9	6.4e-112
AVE99959.1|3174349_3174661_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	68.0	5.7e-29
AVE99960.1|3174657_3175200_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	71.9	5.1e-73
AVE99961.1|3175196_3175544_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	72.2	2.0e-35
AVE99962.1|3175540_3175816_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	51.1	6.4e-16
AVE99963.1|3175805_3175955_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	82.6	3.8e-15
AVE99964.1|3176219_3176477_+	hypothetical protein	NA	NA	NA	NA	NA
AVE99965.1|3176871_3177123_-	hypothetical protein	NA	NA	NA	NA	NA
AVE99966.1|3177552_3177753_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	61.9	1.0e-15
AVF01986.1|3177875_3178211_+	TonB family protein	NA	NA	NA	NA	NA
AVE99967.1|3178359_3178605_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	86.4	1.0e-28
AVE99968.1|3178673_3179678_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	44.2	2.0e-35
AVE99969.1|3179655_3180960_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	60.3	2.2e-146
AVE99970.1|3180964_3182389_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	71.7	2.0e-193
AVE99971.1|3182372_3183485_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	53.3	9.9e-108
AVE99972.1|3183591_3184356_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	59.4	1.1e-76
AVE99973.1|3184443_3185580_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	76.5	2.8e-158
AVE99974.1|3185625_3185838_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	53.7	4.5e-09
AVE99975.1|3185841_3186252_+	protein singed	NA	A0A0H5AUF0	Pseudomonas_phage	38.2	6.6e-09
AVE99976.1|3186253_3186487_+	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	51.5	3.6e-12
AVE99977.1|3186473_3186857_+	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	41.3	6.6e-19
AVE99978.1|3186858_3187410_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.3	2.3e-28
AVE99979.1|3187406_3187799_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AVE99980.1|3187822_3188995_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.9	6.5e-25
AVE99981.1|3189049_3189532_+	hypothetical protein	NA	NA	NA	NA	NA
AVE99982.2|3189669_3189867_+	hypothetical protein	NA	NA	NA	NA	NA
AVE99983.1|3189933_3190617_+	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	41.9	3.2e-40
AVE99984.1|3190976_3193925_+|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	36.9	9.7e-102
AVE99985.1|3193924_3194398_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.1	3.1e-58
AVE99986.1|3194384_3194867_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	73.1	2.3e-61
AVE99987.1|3194876_3195257_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	81.0	1.0e-59
AVF01987.1|3195742_3198289_+	kinase	NA	A0A286S259	Klebsiella_phage	69.9	0.0e+00
AVE99988.1|3200466_3201042_+	hypothetical protein	NA	A0A286S1R5	Klebsiella_phage	44.3	4.3e-30
AVE99989.1|3201173_3201956_+	HNH endonuclease	NA	NA	NA	NA	NA
AVE99990.1|3202034_3202250_-	hypothetical protein	NA	NA	NA	NA	NA
AVE99991.1|3202474_3202765_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	41.2	1.9e-10
AVE99992.1|3202764_3204030_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	81.0	5.1e-201
AVE99993.1|3204136_3204562_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	1.7e-52
AVE99994.1|3204574_3205864_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.4	3.8e-167
AVE99995.1|3205908_3206229_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	43.8	7.7e-21
AVE99996.1|3206314_3207013_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.9	1.7e-89
AVE99997.1|3207364_3208537_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AVE99998.1|3208955_3209633_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	3.1e-80
>prophage 3
CP026756	Klebsiella aerogenes strain AR_0062 chromosome, complete genome	5264003	4856939	4907804	5264003	head,transposase,holin,tail,tRNA,integrase	Cronobacter_phage(24.07%)	68	4856752:4856798	4904904:4904950
4856752:4856798	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AVF01489.1|4856939_4857266_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.9	1.8e-25
AVF02045.1|4857265_4857505_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	60.8	1.1e-19
AVF02046.1|4857679_4858933_+|tail	phage tail protein	tail	A0A1J0MHZ5	Klebsiella_phage	45.3	1.8e-89
AVF01490.1|4859015_4860032_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AVF01491.1|4861501_4861762_-	hypothetical protein	NA	A0A1J0MFY2	Serratia_phage	46.6	1.8e-12
AVF01492.1|4861766_4863860_-	hypothetical protein	NA	A0A1J0MG53	Serratia_phage	52.3	1.6e-162
AVF01493.1|4863917_4866395_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	91.6	0.0e+00
AVF01494.1|4866381_4866798_-	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	86.0	4.9e-68
AVF01495.1|4866760_4867231_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	89.7	2.5e-76
AVF01496.1|4867230_4867728_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	88.5	3.3e-87
AVF01497.1|4867727_4870658_-|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	43.0	3.0e-143
AVF01498.1|4870715_4871165_-	hypothetical protein	NA	NA	NA	NA	NA
AVF01499.1|4871225_4871909_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	50.5	2.1e-52
AVF01500.1|4871967_4872711_-	Ig domain-containing protein	NA	F1C5E5	Cronobacter_phage	81.9	2.4e-73
AVF01501.1|4872771_4873155_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	63.8	5.2e-40
AVF01502.1|4873151_4873616_-	HK97 gp10 family phage protein	NA	A0A2P1MXA4	Escherichia_phage	44.2	3.8e-29
AVF01503.1|4873618_4873969_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	66.1	1.2e-38
AVF01504.1|4873968_4874142_-	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	58.9	2.9e-14
AVF01505.1|4874138_4874543_-	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	74.6	9.6e-53
AVF01506.1|4874603_4874888_-	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	73.2	9.5e-31
AVF01507.1|4874898_4876002_-	hypothetical protein	NA	G0ZND9	Cronobacter_phage	73.8	6.7e-157
AVF01508.1|4876015_4876474_-	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	77.9	3.0e-58
AVF01509.1|4876486_4877752_-	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	91.0	5.4e-219
AVF01510.1|4877754_4878681_-|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	92.5	2.6e-162
AVF01511.1|4878640_4879990_-	DUF1073 domain-containing protein	NA	Q5G8Y4	Enterobacteria_phage	78.6	2.7e-208
AVF01512.1|4880058_4880475_-	hypothetical protein	NA	NA	NA	NA	NA
AVF01513.1|4880544_4882023_-	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	87.0	2.9e-256
AVF01514.1|4882009_4882489_-	DUF2280 domain-containing protein	NA	F1C5D6	Cronobacter_phage	59.7	1.0e-48
AVF02047.1|4882519_4883158_-	hypothetical protein	NA	I6S676	Salmonella_phage	88.7	2.9e-112
AVF01515.1|4883160_4883361_-	hypothetical protein	NA	NA	NA	NA	NA
AVF01516.1|4883351_4883552_-	hypothetical protein	NA	NA	NA	NA	NA
AVF01517.1|4883558_4883750_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	80.7	1.5e-19
AVF01518.1|4883706_4883979_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	39.3	6.3e-08
AVF01519.1|4883975_4884518_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	74.7	6.4e-76
AVF01520.1|4884514_4884793_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	40.5	2.6e-09
AVF01521.1|4884789_4885188_-	hypothetical protein	NA	NA	NA	NA	NA
AVF01522.1|4885494_4886307_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	62.6	1.2e-94
AVF01523.1|4886303_4886444_-	YlcG family protein	NA	NA	NA	NA	NA
AVF01524.1|4886440_4886665_-	protein ninY	NA	Q76H69	Enterobacteria_phage	60.8	1.3e-22
AVF01525.1|4886661_4887243_-	recombination protein NinG	NA	G0ZNC4	Cronobacter_phage	48.5	6.0e-40
AVF01526.1|4887245_4887446_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	75.8	5.5e-25
AVF01527.1|4887450_4888050_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	76.9	6.1e-88
AVF01528.1|4888460_4888694_-	DinI family protein	NA	H6WRY5	Salmonella_phage	67.5	2.4e-24
AVF01529.1|4888837_4889095_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	71.2	9.8e-27
AVF01530.1|4889130_4891092_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	56.0	4.8e-206
AVF01531.1|4891088_4891346_-	hypothetical protein	NA	NA	NA	NA	NA
AVF01532.1|4891348_4891693_-	hypothetical protein	NA	NA	NA	NA	NA
AVF01533.1|4891689_4892037_-	hypothetical protein	NA	NA	NA	NA	NA
AVF01534.1|4892881_4893085_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	81.8	1.2e-24
AVF01535.1|4893081_4893450_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	45.6	1.5e-12
AVF01536.1|4893442_4894186_-	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	54.8	1.3e-63
AVF01537.1|4894182_4895103_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	62.0	1.4e-94
AVF01538.1|4895454_4895991_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	70.9	1.9e-64
AVF01539.1|4895993_4896224_-	hypothetical protein	NA	H6WRX5	Salmonella_phage	45.3	2.7e-12
AVF01540.1|4896334_4896748_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AVF01541.1|4896933_4897077_+	hypothetical protein	NA	NA	NA	NA	NA
AVF01542.1|4897138_4897330_+	DUF1482 family protein	NA	NA	NA	NA	NA
AVF01543.1|4897338_4897497_+	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	57.7	3.2e-12
AVF01544.1|4897636_4900819_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	55.1	5.3e-279
AVF01545.1|4900831_4901920_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	57.6	3.6e-110
AVF01546.1|4901954_4902308_+	hypothetical protein	NA	NA	NA	NA	NA
AVF01547.1|4902300_4902912_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	74.5	5.9e-38
AVF01548.1|4902908_4903217_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	7.1e-24
AVF02048.1|4903224_4903467_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	71.4	2.5e-24
AVF01549.1|4903726_4904890_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	86.3	1.9e-202
AVF01550.1|4905301_4906168_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.3	5.0e-30
4904904:4904950	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AVF01551.1|4906169_4906382_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AVF01552.1|4906418_4907804_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	4.6e-46
>prophage 1
CP026760	Klebsiella aerogenes strain AR_0062 plasmid unnamed4	67494	732	63900	67494	head,capsid,tail,terminase,portal	Klebsiella_phage(87.5%)	69	NA	NA
AVF02201.1|732_1467_+	hypothetical protein	NA	A0A0P0IKE4	Klebsiella_phage	47.9	2.6e-19
AVF02202.1|1408_1723_+	hypothetical protein	NA	A0A0P0IKE4	Klebsiella_phage	48.1	5.1e-09
AVF02203.1|1641_2037_+	hypothetical protein	NA	Q6UAW1	Klebsiella_phage	32.8	5.4e-08
AVF02204.1|2036_3152_+	hypothetical protein	NA	A0A0P0IKE4	Klebsiella_phage	40.8	1.2e-36
AVF02205.1|3105_3522_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	42.6	6.5e-20
AVF02206.1|4022_4631_+	hypothetical protein	NA	A0A1X7QGJ8	Escherichia_phage	38.2	1.5e-33
AVF02207.1|4639_5776_+|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	36.9	5.1e-35
AVF02208.1|5848_6826_-	ParB/RepB/Spo0J family plasmid partition protein	NA	Q6UAV8	Klebsiella_phage	95.3	3.6e-170
AVF02209.1|6828_7992_-	plasmid-partitioning protein SopA	NA	Q6UAV7	Klebsiella_phage	99.7	4.5e-228
AVF02210.1|9026_10190_+	plasmid-partitioning protein SopA	NA	Q6UAV7	Klebsiella_phage	99.7	4.5e-228
AVF02211.1|10192_11170_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q6UAV8	Klebsiella_phage	95.3	3.6e-170
AVF02212.1|11242_12379_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	36.9	5.1e-35
AVF02213.1|12387_12996_-	hypothetical protein	NA	A0A1X7QGJ8	Escherichia_phage	38.2	1.5e-33
AVF02214.1|13496_22817_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	44.3	0.0e+00
AVF02215.1|22883_23477_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	74.6	1.8e-76
AVF02216.1|23530_23878_-	hypothetical protein	NA	NA	NA	NA	NA
AVF02217.1|23910_24621_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	93.6	9.7e-141
AVF02218.1|24622_25378_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	87.6	5.9e-136
AVF02219.1|25374_25713_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	95.5	3.6e-61
AVF02269.1|25712_29060_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	91.7	0.0e+00
AVF02270.1|29059_29278_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	97.2	3.4e-36
AVF02220.1|29298_29667_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	91.8	1.6e-54
AVF02221.1|29730_30198_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	96.8	9.7e-81
AVF02222.1|30232_30634_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	99.2	7.5e-66
AVF02223.1|30630_31020_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	96.9	3.3e-66
AVF02224.1|31000_31339_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	97.3	6.4e-58
AVF02225.1|31335_31653_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	90.8	2.0e-45
AVF02226.1|31633_32092_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	89.5	3.2e-44
AVF02227.1|32158_33445_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	99.3	4.2e-235
AVF02228.1|33520_34441_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	81.4	6.5e-137
AVF02229.1|34478_35744_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	95.7	2.4e-235
AVF02230.1|35743_35923_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	88.1	4.7e-20
AVF02231.1|35916_37626_-|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	95.1	0.0e+00
AVF02232.1|37660_38095_-|terminase	P27 family phage terminase small subunit	terminase	Q6UAY1	Klebsiella_phage	89.6	1.6e-69
AVF02233.1|38226_38427_-	hypothetical protein	NA	Q6UAR8	Klebsiella_phage	84.8	1.4e-12
AVF02234.1|38453_38636_-	hypothetical protein	NA	NA	NA	NA	NA
AVF02235.1|39347_39779_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	53.2	2.4e-33
AVF02236.1|39775_40090_-	hypothetical protein	NA	Q6UAS1	Klebsiella_phage	42.2	3.1e-06
AVF02237.1|40086_40449_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	93.3	5.4e-63
AVF02238.1|40448_41174_-	hypothetical protein	NA	Q6UAS3	Klebsiella_phage	78.0	2.7e-98
AVF02239.1|42067_42538_-	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	79.5	4.2e-60
AVF02240.1|42554_43046_-	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	89.0	2.7e-81
AVF02241.1|43042_43354_-	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	91.1	2.0e-45
AVF02242.1|43412_44474_-	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	93.2	4.2e-172
AVF02243.1|44744_44972_-	winged helix-turn-helix domain-containing protein	NA	Q6UAT1	Klebsiella_phage	82.7	5.4e-29
AVF02271.1|44981_45203_-	hypothetical protein	NA	O64358	Escherichia_phage	84.9	4.3e-31
AVF02244.1|45372_45681_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	94.2	3.0e-46
AVF02245.1|45680_45968_+	XRE family transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	94.7	4.9e-43
AVF02246.1|46014_46218_-	hypothetical protein	NA	Q6UAT5	Klebsiella_phage	76.6	5.9e-19
AVF02247.1|46321_46549_-	hypothetical protein	NA	Q6UAT6	Klebsiella_phage	77.5	7.6e-23
AVF02248.1|46569_46896_-	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	94.4	4.3e-51
AVF02249.1|46888_47140_-	hypothetical protein	NA	A0A1B1W253	Salmonella_phage	37.7	4.2e-06
AVF02250.1|48038_48332_-	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	6.5e-43
AVF02251.1|48331_49012_-	DNA cytosine methyltransferase	NA	Q6UAU0	Klebsiella_phage	94.7	6.0e-132
AVF02252.1|49012_49345_-	hypothetical protein	NA	Q6UAU1	Klebsiella_phage	85.5	4.6e-45
AVF02253.1|49472_50081_-	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	88.1	2.3e-98
AVF02254.1|50266_50512_-	hypothetical protein	NA	A0A2I6TCB2	Escherichia_phage	72.8	3.9e-33
AVF02255.1|50492_51230_-	phage antitermination protein	NA	Q6UAU4	Klebsiella_phage	94.7	8.5e-132
AVF02256.1|51219_51432_-	hypothetical protein	NA	Q6UAU5	Klebsiella_phage	94.3	2.1e-30
AVF02257.1|51512_52121_+	XRE family transcriptional regulator	NA	Q6UAU6	Klebsiella_phage	97.0	6.4e-109
AVF02258.1|52371_56376_+	origin of replication binding family protein	NA	A0A2I6TD01	Escherichia_phage	81.9	0.0e+00
AVF02259.1|56368_56665_+	hypothetical protein	NA	NA	NA	NA	NA
AVF02260.1|56661_57012_+	hypothetical protein	NA	O64343	Escherichia_phage	77.6	1.3e-50
AYN07491.1|57021_57222_+	hypothetical protein	NA	NA	NA	NA	NA
AVF02261.1|57618_57783_+	host cell division inhibitor Icd-like protein	NA	Q6UAV3	Klebsiella_phage	96.3	2.8e-19
AVF02262.1|57779_58010_+	hypothetical protein	NA	NA	NA	NA	NA
AVF02263.1|58006_58786_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	89.2	1.9e-126
AVF02264.1|58840_60763_-	protelomerase	NA	Q6UAV6	Klebsiella_phage	90.0	2.3e-309
AVF02265.1|63120_63900_-	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	89.2	1.9e-126
