The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026761	Acinetobacter baumannii strain AR_0078 chromosome, complete genome	3871930	1141560	1162477	3871930	tRNA,transposase	Vibriophage(100.0%)	21	NA	NA
AVF07039.1|1141560_1142651_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
AVF07040.1|1142723_1143260_-	ferrous iron transporter B	NA	NA	NA	NA	NA
AVF07041.1|1143705_1144056_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07042.1|1144119_1144332_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07043.1|1144378_1145368_-	biotin synthase	NA	NA	NA	NA	NA
AVF07044.1|1145467_1146556_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AVF07045.1|1146584_1148045_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AVF07046.1|1148049_1148595_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
AVF07047.1|1148824_1149418_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVF07048.1|1149414_1149960_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVF07049.1|1150031_1150856_-	OXA-51 family carbapenem-hydrolyzing class D beta-lactamase OXA-113	NA	NA	NA	NA	NA
AVF07050.1|1150934_1152024_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
AVF07051.1|1152876_1153704_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07052.1|1153746_1154625_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AVF07053.1|1154640_1155417_-	aldolase	NA	NA	NA	NA	NA
AVF07054.1|1155528_1156941_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AVF07055.1|1156977_1157661_-	ATP-binding protein	NA	NA	NA	NA	NA
AVF07056.1|1157785_1158496_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	4.1e-06
AVF07057.1|1158496_1160407_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF07058.1|1160411_1161332_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF07059.1|1161361_1162477_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
CP026761	Acinetobacter baumannii strain AR_0078 chromosome, complete genome	3871930	1547301	1555502	3871930		uncultured_Caudovirales_phage(71.43%)	10	NA	NA
AVF07381.1|1547301_1547736_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.8	1.8e-41
AVF07382.1|1547791_1548115_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	61.0	7.0e-22
AVF07383.1|1548121_1548595_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	51.3	2.1e-35
AVF07384.1|1548602_1549643_+	arsenical-resistance protein	NA	NA	NA	NA	NA
AVF07385.1|1549647_1550352_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.5	1.3e-92
AVF07386.1|1550370_1551324_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	7.8e-61
AVF07387.1|1551429_1552497_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	59.2	7.8e-94
AVF07388.1|1552790_1553609_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07389.1|1554016_1554289_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07390.1|1554278_1555502_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A222YXG1	Escherichia_phage	47.1	4.1e-22
>prophage 4
CP026761	Acinetobacter baumannii strain AR_0078 chromosome, complete genome	3871930	2034720	2044829	3871930		Acinetobacter_phage(94.12%)	21	NA	NA
AVF07781.1|2034720_2035443_-	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	88.2	1.7e-55
AVF07782.1|2035439_2035847_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
AVF07783.1|2035847_2036099_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	98.7	1.1e-38
AVF07784.1|2036100_2037060_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	93.7	1.5e-165
AVF07785.1|2037074_2037842_-	hypothetical protein	NA	NA	NA	NA	NA
AVF07786.1|2037853_2038177_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	82.2	2.6e-45
AVF07787.1|2038179_2038620_-	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	96.6	1.3e-74
AVF07788.1|2038840_2039122_-	hypothetical protein	NA	NA	NA	NA	NA
AVF07789.1|2039123_2039780_-	helix-turn-helix domain-containing protein	NA	A0A0P0IYD9	Acinetobacter_phage	63.8	3.1e-69
AVF07790.1|2039892_2040093_+	XRE family transcriptional regulator	NA	A0A0P0IKT3	Acinetobacter_phage	68.2	3.1e-20
AVF07791.1|2040101_2040458_+	transcriptional regulator	NA	J7I452	Acinetobacter_phage	97.5	2.5e-57
AVF09538.1|2040507_2040792_+	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	85.7	5.4e-34
AVF07792.1|2040788_2041085_+	hypothetical protein	NA	A0A0P0HSJ2	Acinetobacter_phage	98.0	6.8e-48
AVF07793.1|2041081_2041444_+	hypothetical protein	NA	A0A0D4DBI9	Acinetobacter_phage	98.3	5.4e-55
AVF07794.1|2041436_2042366_+	DUF1376 domain-containing protein	NA	A0A0P0I481	Acinetobacter_phage	99.4	1.1e-171
AVF07795.1|2042358_2043108_+	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	99.6	2.1e-138
AVF07796.1|2043104_2043443_+	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	56.0	6.6e-31
AVF07797.1|2043435_2043642_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07798.1|2043631_2043955_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07799.1|2043954_2044356_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.2	5.8e-66
AVF07800.1|2044352_2044829_+	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
>prophage 5
CP026761	Acinetobacter baumannii strain AR_0078 chromosome, complete genome	3871930	2048135	2079596	3871930	tail,head,terminase	Acinetobacter_phage(93.75%)	41	NA	NA
AVF07806.1|2048135_2048591_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	98.0	1.0e-82
AVF07807.1|2048652_2049087_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	100.0	3.4e-80
AVF07808.1|2049055_2049697_+	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	89.7	2.8e-115
AVF07809.1|2049755_2050271_+	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	64.2	2.6e-55
AVF07810.1|2050230_2051523_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	86.0	7.0e-214
AVF07811.1|2051562_2052903_+	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	97.1	1.2e-248
AVF07812.1|2052912_2054019_+|head	phage head morphogenesis protein	head	A0A0P0IR98	Acinetobacter_phage	89.7	3.9e-189
AVF07813.1|2054015_2054246_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07814.1|2054465_2054720_+	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	50.0	2.4e-09
AVF07815.1|2054867_2055659_+	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	77.2	7.3e-89
AVF07816.1|2055672_2056623_+	methyltransferase	NA	A0A0P0HSG2	Acinetobacter_phage	98.7	1.7e-177
AVF07817.1|2056667_2057003_+	HeH/LEM domain protein	NA	A0A0N7IRE4	Acinetobacter_phage	99.1	8.0e-53
AVF07818.1|2057006_2057387_+	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	84.1	5.3e-53
AVF07819.1|2057386_2057755_+	glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	94.3	1.8e-61
AVF07820.1|2057816_2058347_+	hypothetical protein	NA	A0A0D4DCP9	Acinetobacter_phage	100.0	3.4e-98
AVF07821.1|2058388_2058757_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	99.2	5.0e-64
AVF07822.1|2058758_2059157_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	87.1	5.4e-64
AVF07823.1|2059158_2059377_+	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	95.8	1.5e-31
AVF07824.1|2059473_2059824_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	90.6	3.7e-53
AVF07825.1|2059823_2060921_+|tail	phage tail protein	tail	A0A0N7IRE5	Acinetobacter_phage	41.2	3.2e-74
AVF07826.1|2061015_2061933_+	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	98.7	4.9e-169
AVF07827.1|2062002_2062518_+	hypothetical protein	NA	A0A0D4DBX8	Acinetobacter_phage	93.8	1.9e-74
AVF07828.1|2062445_2062775_+	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	55.0	1.2e-24
AVF07829.1|2062843_2063026_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	98.3	1.6e-28
AVF07830.1|2063121_2063526_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	90.3	1.6e-63
AVF07831.1|2063766_2064600_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07832.1|2064614_2065025_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07833.1|2065181_2065358_+	hypothetical protein	NA	A0A0R6PIB1	Moraxella_phage	59.6	8.2e-09
AVF07834.1|2065366_2065690_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AVF07835.1|2065721_2066405_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07836.1|2066476_2066803_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07837.1|2066865_2071164_+|tail	phage tail tape measure protein	tail	A0A0D4DC37	Acinetobacter_phage	76.4	0.0e+00
AVF07838.1|2071633_2072365_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07839.1|2072354_2072999_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07840.1|2073025_2073733_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07841.1|2073868_2074267_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	3.1e-72
AVF07842.1|2074266_2074773_+	DUF1833 domain-containing protein	NA	J7HXQ5	Acinetobacter_phage	98.2	3.8e-91
AVF07843.1|2074769_2075132_+	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	78.3	1.4e-50
AVF07844.1|2075124_2078550_+	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	94.3	0.0e+00
AVF07845.1|2078618_2079008_+	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	98.4	1.6e-65
AVF07846.1|2079050_2079596_+	hypothetical protein	NA	A0A0B5L5G7	Acinetobacter_phage	96.1	7.0e-99
>prophage 6
CP026761	Acinetobacter baumannii strain AR_0078 chromosome, complete genome	3871930	2160114	2194085	3871930	tRNA,transposase	Escherichia_phage(28.57%)	31	NA	NA
AVF07902.1|2160114_2160819_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVF07903.1|2160824_2161163_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07904.1|2161663_2162206_-	tunicamycin resistance protein	NA	NA	NA	NA	NA
AVF07905.1|2162218_2163079_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
AVF07906.1|2163385_2164475_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
AVF07907.1|2165787_2166547_+|transposase	IS5-like element ISKpn12 family transposase	transposase	NA	NA	NA	NA
AVF07908.1|2166615_2167167_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07909.1|2167492_2168197_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVF07910.1|2168284_2169007_-	pirin family protein	NA	NA	NA	NA	NA
AVF07911.1|2169517_2170480_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AVF07912.1|2170545_2171376_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AVF07913.1|2171399_2172950_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AVF07914.1|2173319_2173547_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07915.1|2173869_2175189_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.8	7.8e-59
AVF07916.1|2175300_2176299_+	adenosine deaminase	NA	NA	NA	NA	NA
AVF07917.1|2176341_2176899_-	cytochrome b	NA	NA	NA	NA	NA
AVF07918.1|2177138_2177528_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07919.1|2177593_2178160_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.4	2.4e-25
AVF07920.1|2178229_2178484_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
AVF07921.1|2178730_2180011_-	aspartate kinase	NA	NA	NA	NA	NA
AVF09544.1|2180076_2182713_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.6	1.8e-75
AVF07922.1|2182982_2184002_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AVF07923.1|2184174_2185263_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07924.1|2185446_2186613_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
AVF07925.1|2186677_2187997_+	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.0	4.8e-69
AVF07926.1|2188118_2188436_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07927.1|2188546_2189332_+	M48 family peptidase	NA	NA	NA	NA	NA
AVF07928.1|2189390_2190440_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AVF07929.1|2190600_2191308_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AVF07930.1|2191683_2192773_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
AVF07931.1|2192995_2194085_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
>prophage 7
CP026761	Acinetobacter baumannii strain AR_0078 chromosome, complete genome	3871930	2248381	2326373	3871930	head,plate,integrase,transposase,tRNA	Escherichia_phage(31.58%)	79	2292837:2292896	2320926:2322109
AVF07986.1|2248381_2249488_+|head	phage head morphogenesis protein	head	A0A0D4DBL9	Acinetobacter_phage	66.9	3.5e-145
AVF07987.1|2249482_2250697_-	MFS transporter	NA	NA	NA	NA	NA
AVF07988.1|2250808_2251255_+	transcriptional regulator	NA	NA	NA	NA	NA
AVF09545.1|2251403_2251670_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07989.1|2252088_2252235_+	peptidoglycan-binding protein	NA	A0A0N7IRF5	Acinetobacter_phage	91.7	3.3e-19
AVF07990.1|2252620_2253214_+	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
AVF07991.1|2253598_2254228_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07992.1|2254714_2255068_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07993.1|2255076_2255268_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07994.1|2255787_2256105_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07995.1|2256116_2256299_-	hypothetical protein	NA	NA	NA	NA	NA
AVF07996.1|2256594_2256873_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07997.1|2257141_2257600_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	46.6	2.0e-30
AVF07998.1|2257907_2258252_+	hypothetical protein	NA	NA	NA	NA	NA
AVF07999.1|2258999_2259482_+	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	86.5	3.3e-68
AVF08000.1|2259459_2260950_+	helicase	NA	I3PGT7	Xanthomonas_phage	41.4	2.8e-89
AVF08001.1|2260958_2262293_+	DUF1073 domain-containing protein	NA	M4SN90	Psychrobacter_phage	40.0	3.7e-85
AVF08002.1|2262237_2263050_+|head	phage head morphogenesis protein	head	M4T3R2	Psychrobacter_phage	42.1	2.7e-54
AVF08003.1|2263129_2263318_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AVF08004.1|2263358_2263991_+	hypothetical protein	NA	U5U717	Lactobacillus_phage	24.5	2.8e-06
AVF08005.1|2264044_2265244_+	DUF2213 domain-containing protein	NA	A0A2I7R2U8	Vibrio_phage	28.5	2.0e-21
AVF08006.1|2265262_2265733_+	hypothetical protein	NA	M4T3R5	Psychrobacter_phage	41.8	8.1e-19
AVF08007.1|2265736_2266228_+	hypothetical protein	NA	NA	NA	NA	NA
AVF08008.1|2266224_2267223_+	hypothetical protein	NA	NA	NA	NA	NA
AVF08009.1|2267283_2268270_-	right-handed parallel beta-helix repeat-containing protein	NA	U5PSS0	Bacillus_phage	31.7	5.7e-14
AVF08010.1|2268420_2268810_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	96.9	1.1e-64
AVF08011.1|2268928_2269702_+	DUF4882 domain-containing protein	NA	NA	NA	NA	NA
AVF08012.1|2270463_2271054_+	hypothetical protein	NA	NA	NA	NA	NA
AVF08013.1|2271122_2271587_-	hypothetical protein	NA	NA	NA	NA	NA
AVF08014.1|2271830_2272559_-	hypothetical protein	NA	NA	NA	NA	NA
AVF08015.1|2273952_2275374_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.8	6.6e-56
AVF08016.1|2275587_2276565_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	32.1	1.9e-38
AVF08017.1|2276568_2277108_+	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase	NA	NA	NA	NA	NA
AVF08018.1|2277145_2277694_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AVF08019.1|2277677_2278226_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
AVF08020.1|2278225_2278972_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	3.1e-20
AVF08021.1|2280709_2282851_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	24.7	2.7e-29
AVF08022.1|2282847_2284038_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVF08023.1|2284129_2284729_+	DUF1949 domain-containing protein	NA	A0A1X9I5T8	Streptococcus_phage	36.6	5.0e-21
AVF08024.1|2284721_2285333_+	chloramphenicol acetyltransferase CAT	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	55.6	1.6e-11
AVF08025.1|2285488_2286331_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	2.6e-36
AVF08026.1|2286447_2287116_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	43.3	3.3e-26
AVF08027.1|2287255_2287927_-	peptidase M15	NA	NA	NA	NA	NA
AVF08028.1|2288107_2288431_-	ferredoxin family protein	NA	NA	NA	NA	NA
AVF09546.1|2288775_2289306_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVF08029.1|2289370_2292016_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	21.4	1.3e-33
AVF08030.1|2292290_2292758_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
2292837:2292896	attL	ATCTCTGTACACGACAAATTTCACAGAACCCTTATCCTATCAGGGTTCTGCCTTCTTAAA	NA	NA	NA	NA
AVF08031.1|2292856_2293947_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
AVF09547.1|2294092_2294647_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
AVF08032.1|2294997_2295702_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVF08033.1|2295955_2296960_-|transposase	IS110 family transposase IS4321	transposase	NA	NA	NA	NA
AVF08034.1|2297038_2300011_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.0	0.0e+00
AVF08035.1|2300013_2300571_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AVF08036.1|2300608_2300932_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF08037.1|2300876_2301890_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
AVF09548.1|2302115_2302352_+	trimethoprim-resistant dihydrofolate reductase DfrB1	NA	A0A0H5ARK7	Pseudomonas_phage	68.1	1.6e-12
AVF08038.1|2302465_2303311_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA11	NA	NA	NA	NA	NA
AVF08039.1|2303427_2303775_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVF08040.1|2303768_2304608_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AVF08041.1|2304537_2304717_-	hypothetical protein	NA	NA	NA	NA	NA
AVF08042.1|2304735_2305236_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVF09549.1|2305411_2306194_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
AVF08043.1|2306183_2307695_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.5	3.8e-17
AVF08044.1|2308469_2309174_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVF08045.1|2309711_2310332_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
AVF08046.1|2310324_2311590_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	100.0	2.7e-234
AVF08047.1|2311601_2312504_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	100.0	5.3e-160
AVF08048.1|2312764_2313526_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AVF08049.1|2313546_2314407_-	class A extended-spectrum beta-lactamase SHV-5	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
AVF08050.1|2314704_2314965_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
AVF09550.1|2315051_2315687_+	hypothetical protein	NA	A0A077SLJ9	Escherichia_phage	100.0	8.5e-88
AVF08051.1|2315577_2316282_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVF08052.1|2317774_2318734_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
AVF08053.1|2318736_2319504_+	OmpA family protein	NA	NA	NA	NA	NA
AVF08054.1|2319520_2319784_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
AVF08055.1|2319874_2320964_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
AVF08056.1|2321192_2323874_+	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	30.8	1.3e-81
2320926:2322109	attR	TTTAAGAAGGCAGAACCCTGATAGGATAAGGGTTCTGTGAAATTTGTCGTGTACAGAGATCTTTTTTTCTTAAATGTTTAAGTTAAAAAGTTATGTGTACTAATTAAATGATCTTAAATGGTATTAGATTTTTTATTCAGATATAAGAAATCGAATAAATCATATTAATGATTGTAATGCTGGGTTATTTGTCGGATAAAGCTAAATTTTGGTAATATACGGGCATTATGATTTTAAGTATTAAATTATTTAAAAATATTGAGAGTAATGATGAGTAGTTTAAAAATTTTAATTACAAAACTTTCTACAGCTGCACGCACTGCTTTAGAAAAATCTGCTAATGCTTGTGTTCTTCAGCAAAACTACGAAATTGAAATTGAACATTTATTTTTAGAGTTACTTAATCAGTCTTTAGAAAACGATTTAAAAATTTTATTAAAAAAATATAAAATCTCAGCCGATGCTTTAGCAGATGATTTAAAAGAAACAATTTCTCAATTACCAAAAGGTAATACACGTACTCCAATTTTTGCTAAATCAATTGTTCGTTTATTTGAACAAGCTTGGTTATTGGCTTCAGCAGAACAAAATCCTGTCATTCGTAGTGGTCATTTACTGGTTGCATTATTAACTGCACCTGACCTCTATCAAATTGCAACGAGAGCTTCGAGTTTATTCGATCTTTTCCCGATAGACTCAATGAAACATAAGTTTCTCGAAATTTGTGAAAAAAGTGTAGAACAACAAGAAGAATCAAAAACATCTTCACAAGCAGATGAATTAGAACAAGCCGTGACTCCAACTGCAAAAACTCAAAAAACACCTGCTTTAGATCAATATACAATTAATTTAACTGAAAAAGCGAAGAATGGTGGGATTGACCCTGTTATTGGGCGTGAATATGAAATTCGTTTGATGCTCGATATTTTAATGCGTAGACGTCAGAACAACCCAATTTTAACTGGTGAGCCAGGTGTAGGTAAAACAGCTGTAGTTGAAGGGTTGGCTTTAAAAATTGCTCAAGGTTTAGTTCCTGAAGCATTAAAAAATGTTCATTTGCACGTTTTAGATATGGGGCTTTTGCAAGCTGGGGCAAGTGTTAAAGGTGAATTTGAAAACCGTTTAAAGCAAGTTATTCAAGAAGTCCAATCATCGGCTCATCCTATTATTTTATTTATTGATGA	NA	NA	NA	NA
AVF08057.1|2323897_2324992_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AVF08058.1|2325008_2326373_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
CP026761	Acinetobacter baumannii strain AR_0078 chromosome, complete genome	3871930	3208972	3217221	3871930	terminase	Escherichia_phage(40.0%)	10	NA	NA
AVF08854.1|3208972_3210103_-	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	35.2	1.3e-22
AVF08855.1|3210104_3210383_-	hypothetical protein	NA	NA	NA	NA	NA
AVF08856.1|3210397_3211936_-	sperm-activating peptide	NA	E5EYU2	Acinetobacter_phage	41.7	1.8e-06
AVF08857.1|3212011_3214003_-|terminase	terminase	terminase	A0A077SK57	Escherichia_phage	54.9	3.6e-07
AVF08858.1|3214022_3214535_-	hypothetical protein	NA	NA	NA	NA	NA
AVF08859.1|3214546_3214747_-	conjugal transfer protein TraR	NA	A0A0U4IIN4	Pseudomonas_phage	43.7	6.3e-05
AVF08860.1|3214739_3215543_-	hypothetical protein	NA	NA	NA	NA	NA
AVF08861.1|3215545_3216451_-	hypothetical protein	NA	NA	NA	NA	NA
AVF08862.1|3216523_3216751_-	hypothetical protein	NA	NA	NA	NA	NA
AVF08863.1|3216762_3217221_-	hypothetical protein	NA	A0A143FJ28	Bacillus_phage	38.5	3.0e-10
>prophage 9
CP026761	Acinetobacter baumannii strain AR_0078 chromosome, complete genome	3871930	3236061	3254141	3871930		Acinetobacter_phage(90.91%)	24	NA	NA
AVF08880.1|3236061_3236517_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	68.9	2.2e-53
AVF08881.1|3236972_3237506_-	hypothetical protein	NA	NA	NA	NA	NA
AVF08882.1|3237502_3238267_-	DNA replication protein	NA	A0A0D4DBZ2	Acinetobacter_phage	48.8	6.7e-63
AVF08883.1|3238263_3239307_-	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	52.8	4.3e-28
AVF09584.1|3239310_3239700_-	hypothetical protein	NA	A0A0P0IE39	Acinetobacter_phage	100.0	2.0e-23
AVF08884.1|3239780_3241154_-	replicative DNA helicase	NA	A0A1B1P9I0	Acinetobacter_phage	46.5	4.5e-102
AVF08885.1|3241150_3242041_-	DNA-binding protein	NA	A0A1B1P9I2	Acinetobacter_phage	92.5	7.1e-141
AVF08886.1|3242255_3242618_-	transcriptional regulator	NA	A0A0N7IRF8	Acinetobacter_phage	100.0	1.1e-58
AVF08887.1|3242628_3242829_-	transcriptional regulator	NA	A0A0P0IKT3	Acinetobacter_phage	100.0	3.5e-32
AVF09585.1|3242942_3243605_+	helix-turn-helix domain-containing protein	NA	A0A0P0IYD9	Acinetobacter_phage	100.0	2.3e-120
AVF08888.1|3243625_3243841_+	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	100.0	2.5e-31
AVF08889.1|3243973_3246241_+	response regulator	NA	J7I0U9	Acinetobacter_phage	100.0	0.0e+00
AVF08890.1|3246436_3246877_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	99.3	6.8e-76
AVF08891.1|3246879_3247203_+	hypothetical protein	NA	A0A0P0IKP4	Acinetobacter_phage	98.1	5.7e-56
AVF08892.1|3247214_3248336_+	AAA family ATPase	NA	A0A0N7IRE0	Acinetobacter_phage	99.5	1.3e-211
AVF08893.1|3248332_3249409_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	75.4	6.0e-142
AVF08894.1|3249410_3249656_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	98.8	3.3e-40
AVF08895.1|3249658_3250039_+	hypothetical protein	NA	A0A0D4DBH6	Acinetobacter_phage	91.2	1.4e-42
AVF08896.1|3250025_3250250_+	hypothetical protein	NA	I2GUB4	Acinetobacter_phage	98.6	1.2e-39
AVF08897.1|3250246_3250729_+	methyltransferase domain-containing protein	NA	A0A0N7IRF6	Acinetobacter_phage	71.7	1.3e-67
AVF08898.1|3250729_3250999_+	DNA-binding protein	NA	A0A0N7IRE8	Acinetobacter_phage	98.9	7.8e-43
AVF08899.1|3251136_3251748_+	hypothetical protein	NA	NA	NA	NA	NA
AVF08900.1|3251784_3252867_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	28.6	1.2e-30
AVF08901.1|3252878_3254141_-	DUF4102 domain-containing protein	NA	A0A0P0IKP2	Acinetobacter_phage	99.3	1.6e-247
>prophage 10
CP026761	Acinetobacter baumannii strain AR_0078 chromosome, complete genome	3871930	3336142	3386476	3871930	head,plate,tail,transposase,tRNA	Pseudomonas_phage(17.24%)	65	NA	NA
AVF08967.1|3336142_3337870_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	57.2	1.5e-187
AVF08968.1|3338038_3338548_+	cyclophilin	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	34.0	9.4e-13
AVF08969.1|3338563_3339283_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AVF08970.1|3339290_3339521_-	hypothetical protein	NA	NA	NA	NA	NA
AVF08971.1|3339659_3340313_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
AVF08972.1|3340351_3341209_-	EamA family transporter	NA	NA	NA	NA	NA
AVF08973.1|3341340_3341859_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
AVF08974.1|3341941_3342886_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AVF08975.1|3342892_3344845_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	33.1	3.0e-83
AVF09591.1|3344837_3345311_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AVF09592.1|3345460_3346339_+	pseudouridylate synthase	NA	NA	NA	NA	NA
AVF08976.1|3346450_3346759_+	type II toxin-antitoxin system antitoxin, RelB/DinJ family	NA	NA	NA	NA	NA
AVF08977.1|3346856_3347300_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVF08978.1|3347292_3347997_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
AVF08979.1|3348097_3348316_-	hypothetical protein	NA	NA	NA	NA	NA
AVF08980.1|3348569_3349022_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AVF08981.1|3349072_3349993_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVF08982.1|3350220_3350925_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
AVF08983.1|3350994_3352266_-	hypothetical protein	NA	E5EYU2	Acinetobacter_phage	40.0	1.6e-05
AVF08984.1|3352262_3352799_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
AVF08985.1|3352795_3353842_-	hypothetical protein	NA	A0A0M3LQN4	Mannheimia_phage	27.4	6.2e-27
AVF08986.1|3353845_3354208_-	hypothetical protein	NA	NA	NA	NA	NA
AVF08987.1|3354215_3354698_-|plate	baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	39.3	9.8e-12
AVF08988.1|3354694_3355750_-	hypothetical protein	NA	NA	NA	NA	NA
AVF08989.1|3355739_3356915_-	multidrug DMT transporter	NA	F6MIL2	Haemophilus_phage	21.6	3.2e-16
AVF08990.1|3356994_3359091_-	hypothetical protein	NA	A0A0M3LPB6	Mannheimia_phage	32.1	6.1e-42
AVF08991.1|3359094_3359328_-	hypothetical protein	NA	NA	NA	NA	NA
AVF08992.1|3359357_3359669_-	hypothetical protein	NA	NA	NA	NA	NA
AVF08993.1|3359671_3360049_-	hypothetical protein	NA	NA	NA	NA	NA
AVF08994.1|3360177_3360987_-|tail	phage tail protein	tail	A0A2H4JFT7	uncultured_Caudovirales_phage	26.8	3.2e-15
AVF08995.1|3360983_3363623_-	SGNH/GDSL hydrolase family protein	NA	A0A2H4J9C6	uncultured_Caudovirales_phage	33.8	1.3e-09
AVF08996.1|3363633_3363981_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVF08997.1|3363980_3364592_-	DUF1834 domain-containing protein	NA	NA	NA	NA	NA
AVF08998.1|3364588_3365020_-	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	37.3	7.4e-19
AVF08999.1|3365031_3365964_-|head	head protein	head	A0A2P9JZJ2	Alteromonadaceae_phage	55.0	2.3e-89
AVF09000.1|3365967_3366387_-	hypothetical protein	NA	NA	NA	NA	NA
AVF09001.1|3366383_3367469_-	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	32.6	3.2e-34
AVF09002.1|3367557_3368061_-	virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	31.9	7.4e-10
AVF09003.1|3368057_3369308_-|head	phage head morphogenesis protein	head	I6PBD2	Pseudomonas_phage	37.5	1.7e-71
AVF09004.1|3369307_3370927_-	DUF935 domain-containing protein	NA	A0A0M5MS00	Ralstonia_phage	40.5	6.3e-103
AVF09005.1|3371204_3371999_+	hypothetical protein	NA	NA	NA	NA	NA
AVF09006.1|3371995_3373636_-	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	47.5	1.2e-117
AVF09007.1|3373632_3374202_-	DUF3486 domain-containing protein	NA	J9SH37	Pseudomonas_phage	36.4	1.4e-17
AVF09008.1|3374217_3374511_-	hypothetical protein	NA	J9SNG3	Pseudomonas_phage	53.6	6.0e-20
AVF09009.1|3374513_3374816_-	hypothetical protein	NA	NA	NA	NA	NA
AVF09010.1|3374815_3375160_-	hypothetical protein	NA	NA	NA	NA	NA
AVF09011.1|3375156_3375657_-	hypothetical protein	NA	Q775E1	Bordetella_phage	54.0	1.1e-42
AVF09012.1|3375735_3376290_-	hypothetical protein	NA	NA	NA	NA	NA
AVF09013.1|3376286_3376991_-	hypothetical protein	NA	NA	NA	NA	NA
AVF09014.1|3377016_3377493_-	transcriptional regulator	NA	NA	NA	NA	NA
AVF09015.1|3377585_3377813_+	DNA-binding protein	NA	J9RW65	Pseudomonas_phage	44.3	1.7e-06
AVF09016.1|3378018_3378315_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVF09017.1|3378327_3379215_+	hypothetical protein	NA	Q6QID9	Burkholderia_phage	30.4	2.5e-21
AVF09018.1|3379217_3380969_+|transposase	transposase	transposase	Q5ZR04	Pseudomonas_phage	36.3	5.4e-100
AVF09019.1|3380978_3382256_+|transposase	transposase	transposase	Q6QIE1	Burkholderia_phage	47.3	2.7e-93
AVF09020.1|3382444_3382663_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AVF09021.1|3382659_3382890_+	hypothetical protein	NA	NA	NA	NA	NA
AVF09022.1|3382879_3383551_+	hypothetical protein	NA	A0A2H4JFV8	uncultured_Caudovirales_phage	48.0	9.5e-29
AVF09023.1|3383550_3384054_+	hypothetical protein	NA	A0A2K9VGT9	Faecalibacterium_phage	33.5	5.8e-15
AVF09024.1|3384248_3384536_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	61.8	2.4e-21
AVF09025.1|3384519_3384699_+	hypothetical protein	NA	NA	NA	NA	NA
AVF09026.1|3384838_3385552_+	DUF2786 domain-containing protein	NA	A0A2H4JCP9	uncultured_Caudovirales_phage	39.2	8.5e-28
AVF09027.1|3385548_3385836_+	hypothetical protein	NA	NA	NA	NA	NA
AVF09028.1|3385829_3386042_+	hypothetical protein	NA	NA	NA	NA	NA
AVF09029.1|3386038_3386476_+	regulatory protein GemA	NA	Q6QIE7	Burkholderia_phage	43.2	5.0e-23
>prophage 11
CP026761	Acinetobacter baumannii strain AR_0078 chromosome, complete genome	3871930	3635090	3649896	3871930		Acinetobacter_phage(100.0%)	10	NA	NA
AVF09247.1|3635090_3635675_+	type 1 glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	1.7e-111
AVF09601.1|3635770_3638470_-	M1 family peptidase	NA	A0A0P0IY26	Acinetobacter_phage	97.7	0.0e+00
AVF09248.1|3638548_3641281_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	97.6	0.0e+00
AVF09602.1|3641637_3642687_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	99.7	3.7e-189
AVF09249.1|3642696_3643503_+	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	99.6	1.8e-146
AVF09250.1|3643512_3644208_+	DNA mismatch repair protein MutS	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
AVF09251.1|3644218_3645202_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	99.4	1.0e-188
AVF09252.1|3645208_3647584_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	98.0	0.0e+00
AVF09253.1|3647585_3649085_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	96.0	2.6e-276
AVF09254.1|3649341_3649896_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	2.7e-98
