The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019062	Rahnella sp. ERMR1:05 chromosome, complete genome	4643505	1006796	1042137	4643505	terminase,holin,integrase,tail,coat	Salmonella_phage(17.65%)	60	1003613:1003627	1034559:1034573
1003613:1003627	attL	ATGCCCACAACGCGA	NA	NA	NA	NA
AVF34235.1|1006796_1008080_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.8	8.7e-132
AVF34236.1|1008113_1008362_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	49.3	3.4e-16
AVF34237.1|1008373_1008574_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34238.1|1008577_1009126_-	hypothetical protein	NA	R9W080	Serratia_phage	37.8	7.0e-22
AVF34239.1|1009122_1009347_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34240.1|1009347_1009557_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34241.1|1009606_1009807_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34242.1|1009843_1010050_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34243.1|1010224_1010854_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34244.1|1011417_1011927_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34245.1|1011977_1012670_-	hypothetical protein	NA	R9UB03	Vibrio_phage	32.8	4.7e-23
AVF34246.1|1012743_1013211_-	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	67.2	5.0e-53
AVF34247.1|1013211_1013904_-	recombinase	NA	K7PKU3	Enterobacteria_phage	61.3	1.1e-80
AVF34248.1|1013890_1014079_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34249.1|1014075_1014279_-	hypothetical protein	NA	NA	NA	NA	NA
AVF37348.1|1014466_1015525_-	hypothetical protein	NA	A0A2H4JIB1	uncultured_Caudovirales_phage	55.4	1.7e-40
AVF34250.1|1015617_1015875_-	hypothetical protein	NA	A0A248SKZ7	Klebsiella_phage	43.5	7.1e-09
AVF34251.1|1015993_1016230_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34252.1|1016598_1016874_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34253.1|1016915_1017227_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34254.1|1017282_1017552_-	hypothetical protein	NA	A0A0S1S5R7	Klebsiella_phage	39.0	2.3e-10
AVF34255.1|1017673_1017856_-	hypothetical protein	NA	NA	NA	NA	NA
AVF37349.1|1017895_1018135_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34256.1|1018691_1018982_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34257.1|1019481_1020171_-	transcriptional regulator	NA	F1C5C2	Cronobacter_phage	66.8	4.4e-82
AVF34258.1|1020268_1020496_+	transcriptional regulator	NA	A0A2H4JEY0	uncultured_Caudovirales_phage	48.1	1.1e-10
AVF34259.1|1020612_1020909_+	hypothetical protein	NA	E5AGE8	Erwinia_phage	76.5	4.1e-37
AVF34260.1|1021087_1022020_+	replication protein	NA	NA	NA	NA	NA
AVF34261.1|1022021_1023368_+	DNA helicase	NA	A0A2I7R850	Vibrio_phage	37.6	4.9e-77
AVF34262.1|1023367_1023571_+	hypothetical protein	NA	NA	NA	NA	NA
AVF34263.1|1023567_1023777_+	hypothetical protein	NA	NA	NA	NA	NA
AVF34264.1|1023776_1024256_+	hypothetical protein	NA	A0A0M4RTV1	Salmonella_phage	55.7	5.9e-17
AVF37350.1|1024300_1024555_+	hypothetical protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	65.8	1.5e-22
AVF34265.1|1024547_1025003_+	hypothetical protein	NA	A0A220NRM1	Escherichia_phage	60.1	1.9e-44
AVF34266.1|1025002_1025548_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	68.5	4.3e-72
AVF37351.1|1025730_1025934_+	hypothetical protein	NA	A0A2H4JE12	uncultured_Caudovirales_phage	53.2	1.2e-11
AVF34267.1|1025937_1026309_+	hypothetical protein	NA	Q7Y3Y2	Yersinia_phage	43.0	6.0e-17
AVF34268.1|1026576_1026819_+	hypothetical protein	NA	NA	NA	NA	NA
AVF34269.1|1026815_1027418_+	protein NinG	NA	A0A1P8DTE0	Proteus_phage	59.0	1.3e-58
AVF34270.1|1027414_1027594_+	hypothetical protein	NA	A0A291AX71	Salmonella_phage	60.4	1.4e-08
AVF34271.1|1027721_1028336_+	hypothetical protein	NA	A0A2H4FND2	Salmonella_phage	53.0	1.4e-55
AVF34272.1|1029024_1029339_+|holin	holin	holin	E7C9S8	Salmonella_phage	58.5	2.7e-26
AVF34273.1|1029341_1029971_+	endolysin	NA	F1C5D2	Cronobacter_phage	70.0	4.3e-76
AVF34274.1|1029961_1030177_+	hypothetical protein	NA	A0A2P0PAP7	Pectobacterium_phage	34.8	1.6e-09
AVF34275.1|1030173_1030695_+	hypothetical protein	NA	A0A077KH21	Edwardsiella_phage	38.1	8.1e-20
AVF37352.1|1030742_1030964_+	hypothetical protein	NA	NA	NA	NA	NA
AVF34276.1|1031160_1031706_+	hypothetical protein	NA	A0A2H4FQV0	Salmonella_phage	61.4	4.3e-56
AVF34277.1|1031702_1031939_+	hypothetical protein	NA	NA	NA	NA	NA
AVF34278.1|1032133_1032511_+	hypothetical protein	NA	R9VYK9	Serratia_phage	58.3	2.7e-33
AVF34279.1|1032513_1033506_+|terminase	terminase small subunit	terminase	I6NV32	Burkholderia_virus	38.2	7.2e-33
AVF34280.1|1033474_1034788_+|terminase	terminase	terminase	A0A0N7IRE3	Acinetobacter_phage	72.1	1.7e-191
1034559:1034573	attR	ATGCCCACAACGCGA	NA	NA	NA	NA
AVF37353.1|1034860_1036198_+	DNA-binding protein	NA	A0A0S2SYJ5	Pseudomonas_phage	43.6	8.0e-96
AVF37354.1|1036319_1037075_+	hypothetical protein	NA	A0A0S2SY92	Pseudomonas_phage	57.4	5.8e-59
AVF34281.1|1037090_1038215_+|coat	P22 coat - protein 5 family protein	coat	W6EBZ8	Rhizobium_phage	55.1	2.7e-97
AVF34282.1|1038265_1038472_+	hypothetical protein	NA	NA	NA	NA	NA
AVF34283.1|1038471_1038864_+	hypothetical protein	NA	NA	NA	NA	NA
AVF34284.1|1038865_1039507_+	hypothetical protein	NA	NA	NA	NA	NA
AVF34285.1|1039508_1040330_+	hypothetical protein	NA	NA	NA	NA	NA
AVF34286.1|1040333_1040531_+	hypothetical protein	NA	NA	NA	NA	NA
AVF34287.1|1040592_1042137_+|tail	phage tail protein	tail	B3GAJ6	uncultured_virus	45.3	2.7e-95
>prophage 2
CP019062	Rahnella sp. ERMR1:05 chromosome, complete genome	4643505	1706992	1784775	4643505	terminase,integrase,tail,portal,head,capsid,plate	Salmonella_phage(12.2%)	86	1705938:1705954	1786770:1786784
1705938:1705954	attL	ATAACCCGGCCACCGAG	NA	NA	NA	NA
AVF34802.1|1706992_1707544_+|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	54.3	3.2e-51
1705938:1705954	attL	ATAACCCGGCCACCGAG	NA	NA	NA	NA
AVF34803.1|1707582_1708233_-	hypothetical protein	NA	NA	NA	NA	NA
AVF37391.1|1708292_1708919_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AVF37392.1|1709163_1709670_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34804.1|1709764_1710298_-	hypothetical protein	NA	NA	NA	NA	NA
AVF37393.1|1710354_1711323_-	hypothetical protein	NA	NA	NA	NA	NA
AVF37394.1|1711469_1714028_-	fimbrial assembly protein	NA	NA	NA	NA	NA
AVF34805.1|1714125_1714809_-	long polar fimbrial chaperone LpfB	NA	NA	NA	NA	NA
AVF34806.1|1714917_1715439_-	fimbrial protein	NA	NA	NA	NA	NA
AVF34807.1|1715933_1716482_-	DNA recombinase	NA	A0A2L1IV36	Escherichia_phage	50.8	6.1e-50
AVF34808.1|1717190_1717925_-	3-oxoacyl-ACP reductase	NA	J2YAV6	Acanthamoeba_polyphaga_lentillevirus	30.1	2.1e-05
AVF34809.1|1717928_1718177_-	acyl carrier protein	NA	NA	NA	NA	NA
AVF34810.1|1718230_1719043_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34811.1|1719042_1720314_-	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
AVF34812.1|1720317_1721703_-	RND transporter	NA	NA	NA	NA	NA
AVF34813.1|1721699_1723646_-	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	40.4	1.4e-35
AVF34814.1|1723638_1724829_-	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVF34815.1|1724828_1726976_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.0	7.7e-16
AVF34816.1|1727033_1727981_-	ABC transporter	NA	NA	NA	NA	NA
AVF34817.1|1727980_1728658_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AVF34818.1|1728838_1729030_-	DUF4762 domain-containing protein	NA	NA	NA	NA	NA
AVF34819.1|1729570_1730215_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
AVF34820.1|1730225_1730615_-	two-component system response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.4	1.3e-06
AVF34821.1|1730662_1731712_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	6.1e-06
AVF34822.1|1731711_1732584_-	chemotaxis protein-glutamate O-methyltransferase	NA	NA	NA	NA	NA
AVF34823.1|1732652_1734323_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.4	9.6e-14
AVF34824.1|1734451_1736146_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.2	1.5e-14
AVF34825.1|1736245_1736839_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34826.1|1737066_1738539_-	MFS transporter	NA	NA	NA	NA	NA
AVF34827.1|1738653_1739652_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVF34828.1|1741400_1741982_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	54.4	5.3e-20
1741021:1741037	attR	ATAACCCGGCCACCGAG	NA	NA	NA	NA
AVF34829.1|1742235_1742460_+	hypothetical protein	NA	NA	NA	NA	NA
1741021:1741037	attR	ATAACCCGGCCACCGAG	NA	NA	NA	NA
AVF34830.1|1742609_1742972_+	translocase	NA	U5P0S6	Shigella_phage	60.0	9.0e-34
AVF34831.1|1742968_1743886_+	glycosyltransferase	NA	F1C5B0	Cronobacter_phage	83.1	1.2e-146
AVF34832.1|1743888_1745367_+	hypothetical protein	NA	NA	NA	NA	NA
AVF37395.1|1745555_1745738_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34833.1|1745762_1746716_-	hypothetical protein	NA	A9YX14	Burkholderia_phage	50.4	8.7e-52
AVF34834.1|1746764_1747361_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVF34835.1|1747357_1748503_-|plate	phage baseplate protein	plate	A0A1E1GE19	Vibrio_phage	32.5	1.4e-08
AVF34836.1|1748505_1748940_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	45.5	3.6e-21
AVF34837.1|1748936_1749521_-|plate	baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	34.0	1.5e-09
AVF34838.1|1749517_1750579_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	33.5	4.6e-46
AVF34839.1|1750575_1751982_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34840.1|1752033_1753920_-	hypothetical protein	NA	T1SBJ1	Salmonella_phage	30.7	1.7e-22
AVF37396.1|1754040_1754310_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34841.1|1754633_1755002_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVF34842.1|1755011_1756496_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	47.2	3.3e-106
AVF34843.1|1756495_1756729_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34844.1|1756745_1757291_-	ATP-binding protein	NA	NA	NA	NA	NA
AVF34845.1|1757630_1757906_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34846.1|1757909_1758956_-|capsid	capsid protein	capsid	V5Q8G6	Xylella_phage	33.0	1.7e-48
AVF34847.1|1759053_1759455_-|head	head decoration protein	head	A0A067ZIL6	Vibrio_phage	37.6	5.7e-13
AVF34848.1|1759454_1760099_-	DNA primase	NA	NA	NA	NA	NA
AVF34849.1|1760101_1760953_-	serine peptidase	NA	A0A248XD65	Klebsiella_phage	46.2	2.0e-52
AVF34850.1|1760949_1762512_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	38.2	1.3e-97
AVF34851.1|1762583_1762847_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AVF34852.1|1762858_1764967_-|terminase	terminase	terminase	A0A2K9V3X4	Faecalibacterium_phage	35.3	6.7e-97
AVF34853.1|1764908_1765478_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34854.1|1765723_1766248_-	hypothetical protein	NA	A0A1W6DY33	Salmonella_phage	47.2	2.5e-29
AVF34855.1|1766319_1766955_-	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	31.9	1.8e-05
AVF34856.1|1767031_1767577_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34857.1|1767596_1767914_-	hypothetical protein	NA	A0A0S4L5D5	Pseudomonas_phage	64.8	2.0e-29
AVF34858.1|1767894_1768242_-	peptidase	NA	NA	NA	NA	NA
AVF34859.1|1768455_1768998_-	lysozyme	NA	Q71TF3	Escherichia_phage	68.4	4.1e-67
AVF34860.1|1769000_1769330_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34861.1|1769496_1769781_+	DUF2622 domain-containing protein	NA	NA	NA	NA	NA
AVF34862.1|1769784_1769970_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34863.1|1770815_1771826_-	endonuclease	NA	A0A291AWV9	Escherichia_phage	41.1	5.5e-73
AVF34864.1|1771822_1772518_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	57.6	6.3e-60
AVF34865.1|1772520_1772907_-	hypothetical protein	NA	A0A0P0ZD39	Stx2-converting_phage	59.5	8.1e-33
AVF34866.1|1772897_1773251_-	chromosome partitioning protein ParB	NA	S4TTI6	Salmonella_phage	61.3	1.8e-31
AVF34867.1|1773247_1773523_-	hypothetical protein	NA	A0A2I7RGW2	Vibrio_phage	43.7	4.2e-07
AVF34868.1|1773674_1775672_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	58.1	1.3e-227
AVF34869.1|1775668_1776541_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	58.6	7.3e-98
AVF34870.1|1776537_1776879_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34871.1|1776875_1777580_-	DNA replication protein	NA	I6PBN0	Cronobacter_phage	46.9	1.2e-47
AVF34872.1|1777561_1778488_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	56.0	8.6e-73
AVF34873.1|1778477_1778666_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AVF34874.1|1779397_1779607_-	cell division protein	NA	NA	NA	NA	NA
AVF34875.1|1779707_1780334_+	LexA family transcriptional repressor	NA	K7PLZ5	Enterobacterial_phage	47.2	5.5e-47
AVF34876.1|1780530_1780722_-	hypothetical protein	NA	NA	NA	NA	NA
AVF34877.1|1781199_1781571_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	67.5	2.7e-41
AVF34878.1|1781606_1782434_+	hypothetical protein	NA	U5P439	Shigella_phage	59.6	7.2e-87
AVF34879.1|1782810_1783197_+	hypothetical protein	NA	NA	NA	NA	NA
AVF34880.1|1783391_1783649_+	hypothetical protein	NA	NA	NA	NA	NA
AVF34881.1|1783629_1784775_+|integrase	integrase	integrase	Q77Z04	Phage_21	45.7	1.5e-82
1786770:1786784	attR	TTCCTGCACTTTCAG	NA	NA	NA	NA
>prophage 3
CP019062	Rahnella sp. ERMR1:05 chromosome, complete genome	4643505	1978428	2054113	4643505	tRNA,holin,integrase,protease,tail,portal,head,capsid,plate	Erwinia_phage(47.5%)	75	1997879:1997895	2062806:2062822
AVF35050.1|1978428_1980816_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AVF35051.1|1980830_1981814_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	7.6e-35
AVF35052.1|1982164_1982521_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVF35053.1|1982562_1982760_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVF35054.1|1982855_1983407_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	5.8e-16
AVF35055.1|1983410_1985339_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.5	1.8e-128
AVF35056.1|1985628_1986312_+	stress protection protein MarC	NA	NA	NA	NA	NA
AVF37407.1|1986335_1986848_-	lytic transglycosylase	NA	NA	NA	NA	NA
AVF35057.1|1987293_1988163_+	hypothetical protein	NA	NA	NA	NA	NA
AVF35058.1|1988269_1988821_-	hypothetical protein	NA	NA	NA	NA	NA
AVF35059.1|1989027_1989693_+	2-deoxyglucose-6-phosphatase	NA	NA	NA	NA	NA
AVF35060.1|1989998_1990835_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
AVF35061.1|1990911_1991673_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	5.5e-17
AVF35062.1|1991825_1992383_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	34.2	1.2e-05
AVF35063.1|1992564_1993956_+	L-cystine transporter	NA	NA	NA	NA	NA
AVF35064.1|1994033_1994825_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AVF35065.1|1995064_1996459_+	MFS transporter	NA	NA	NA	NA	NA
AVF35066.1|1996525_1997404_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
AVF35067.1|1997689_1999762_-	C-terminal processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	1.5e-85
1997879:1997895	attL	CTCTTTGTCCTCTTTAT	NA	NA	NA	NA
AVF35068.1|1999781_2000471_-	RNA chaperone ProQ	NA	Q2A0A1	Sodalis_phage	41.9	2.5e-08
AVF35069.1|2000566_2001064_-	Free methionine-R-sulfoxide reductase	NA	NA	NA	NA	NA
AVF35070.1|2001320_2002568_+	hypothetical protein	NA	NA	NA	NA	NA
AVF35071.1|2002536_2005167_+	MCE family protein	NA	NA	NA	NA	NA
AVF35072.1|2005251_2006769_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AVF35073.1|2007140_2008862_+	diguanylate cyclase	NA	NA	NA	NA	NA
AVF35074.1|2009070_2009313_+	hypothetical protein	NA	NA	NA	NA	NA
AVF35075.1|2009356_2010004_-	hypothetical protein	NA	NA	NA	NA	NA
AVF35076.1|2010098_2010491_-	RNA-binding protein	NA	NA	NA	NA	NA
AVF35077.1|2010588_2013429_-	hypothetical protein	NA	NA	NA	NA	NA
AVF35078.1|2013428_2016191_-	hypothetical protein	NA	NA	NA	NA	NA
AVF35079.1|2016706_2016964_+	hypothetical protein	NA	NA	NA	NA	NA
AVF35080.1|2017325_2018507_+	amidohydrolase	NA	NA	NA	NA	NA
AVF35081.1|2018778_2019792_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.8	2.4e-28
AVF37408.1|2020055_2020664_+	hypothetical protein	NA	NA	NA	NA	NA
AVF35082.1|2021150_2021813_-	hypothetical protein	NA	NA	NA	NA	NA
AVF35083.1|2021805_2023062_-	hypothetical protein	NA	NA	NA	NA	NA
AVF35084.1|2023178_2024045_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	43.2	6.2e-57
AVF35085.1|2024159_2024576_+	hypothetical protein	NA	NA	NA	NA	NA
AVF35086.1|2024607_2025114_+	hypothetical protein	NA	A0A218M4I4	Erwinia_phage	51.2	1.8e-40
AVF35087.1|2025116_2025287_+	hypothetical protein	NA	NA	NA	NA	NA
AVF35088.1|2025294_2025597_+	hypothetical protein	NA	NA	NA	NA	NA
AVF37409.1|2025712_2025940_+	hypothetical protein	NA	NA	NA	NA	NA
AVF35089.1|2025942_2026167_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	50.0	1.8e-13
AVF35090.1|2026246_2028496_+	replication protein	NA	A0A0F7LBQ2	Escherichia_phage	56.8	6.0e-237
AVF35091.1|2029104_2030676_+	hypothetical protein	NA	NA	NA	NA	NA
AVF35092.1|2030678_2031788_+	hypothetical protein	NA	NA	NA	NA	NA
AVF35093.1|2031804_2032821_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	80.3	3.9e-159
AVF35094.1|2032821_2034585_-	oxidoreductase	NA	F1BUR2	Erwinia_phage	85.9	2.2e-303
AVF35095.1|2034727_2035576_+	hypothetical protein	NA	Q6K1I7	Salmonella_virus	55.7	9.0e-77
AVF35096.1|2035611_2036751_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	70.3	4.1e-141
AVF35097.1|2036754_2037411_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	62.4	3.5e-68
AVF35098.1|2037507_2037978_+|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	50.3	1.4e-34
AVF35099.1|2037977_2038181_+|tail	phage tail protein	tail	F1BUQ5	Erwinia_phage	61.2	1.7e-18
AVF37410.1|2038186_2038396_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	46.4	5.2e-10
AVF35100.1|2038376_2038886_+	glycoside hydrolase	NA	A0A218M4K3	Erwinia_phage	62.7	8.4e-54
AVF35101.1|2038885_2039311_+	transcriptional regulator	NA	F1BUQ1	Erwinia_phage	46.6	1.7e-23
AVF37411.1|2039249_2039444_+|holin	holin	holin	F1BUQ0	Erwinia_phage	57.1	3.9e-12
AVF35102.1|2039406_2039874_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	66.4	1.9e-52
AVF35103.1|2039866_2040316_+	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	66.4	1.2e-43
AVF35104.1|2040372_2041377_+	hypothetical protein	NA	NA	NA	NA	NA
AVF35105.1|2041472_2042114_+|plate	baseplate assembly protein	plate	A0A0F7LBP2	Escherichia_phage	65.1	2.1e-73
AVF37412.1|2042242_2042593_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	67.2	2.0e-38
AVF35106.1|2042595_2043504_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	81.5	1.4e-131
AVF35107.1|2043496_2044105_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	74.6	6.9e-87
AVF35108.1|2045107_2045500_+	hypothetical protein	NA	A0A1B0VCD0	Salmonella_phage	41.7	3.5e-07
AVF35109.1|2045653_2046823_+|tail	phage tail protein	tail	F1BUU3	Erwinia_phage	77.9	1.5e-178
AVF35110.1|2046836_2047346_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	69.8	6.9e-64
AVF35111.1|2047404_2047686_+|tail	phage tail protein	tail	A0A0F7LDQ8	Escherichia_phage	58.9	1.7e-24
AVF35112.1|2047718_2047841_+|tail	phage tail protein	tail	Q858U8	Yersinia_virus	71.1	6.7e-10
AVF35113.1|2047833_2050272_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	68.1	1.3e-205
AVF35114.1|2050284_2050755_+|tail	phage tail protein	tail	U5N3F6	Enterobacteria_phage	59.4	7.5e-49
AVF35115.1|2050751_2051912_+	hypothetical protein	NA	A0A0M5M5V5	Salmonella_phage	67.6	5.6e-146
AVF35116.1|2052231_2052453_+	transcriptional regulator	NA	F1BUT0	Erwinia_phage	67.1	1.2e-20
AVF35117.1|2052494_2052860_-	hypothetical protein	NA	R9TR46	Vibrio_phage	53.0	7.7e-17
AVF35118.1|2053069_2054113_+|integrase	integrase	integrase	A0A0M4S6G4	Salmonella_phage	61.5	6.2e-128
2062806:2062822	attR	CTCTTTGTCCTCTTTAT	NA	NA	NA	NA
>prophage 4
CP019062	Rahnella sp. ERMR1:05 chromosome, complete genome	4643505	2754964	2826910	4643505	protease,tail,coat,tRNA	Acanthocystis_turfacea_Chlorella_virus(28.57%)	56	NA	NA
AVF35748.1|2754964_2755684_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AVF35749.1|2755903_2756998_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AVF35750.1|2756994_2757267_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AVF35751.1|2757333_2758413_+	murein transglycosylase C	NA	NA	NA	NA	NA
AVF35752.1|2758487_2760650_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
AVF35753.1|2761506_2761839_+	DNA-binding protein	NA	NA	NA	NA	NA
AVF35754.1|2761916_2763002_-	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	47.2	2.5e-79
AVF35755.1|2763146_2764301_-	glycosyl transferase family 1	NA	NA	NA	NA	NA
AVF35756.1|2765840_2767262_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.5	1.2e-54
AVF35757.1|2767473_2768031_-	hypothetical protein	NA	NA	NA	NA	NA
AVF35758.1|2768051_2768453_-	hypothetical protein	NA	NA	NA	NA	NA
AVF35759.1|2768489_2769788_-|tail	phage tail protein	tail	A0A1J0MHZ5	Klebsiella_phage	45.9	1.1e-92
AVF35760.1|2769814_2770984_-	hypothetical protein	NA	NA	NA	NA	NA
AVF35761.1|2773232_2774696_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AVF35762.1|2774754_2776926_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
AVF37441.1|2776946_2777384_-	protein tyrosine phosphatase	NA	NA	NA	NA	NA
AVF35763.1|2777380_2778520_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
AVF35764.1|2778813_2780244_-	UDP-phosphate galactose phosphotransferase	NA	NA	NA	NA	NA
AVF35765.1|2780579_2781275_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AVF35766.1|2781363_2781948_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AVF35767.1|2783121_2785830_-	carbonate dehydratase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	26.7	5.3e-70
AVF35768.1|2786106_2787207_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVF35769.1|2787208_2790274_+	MFS transporter	NA	S5VL66	Leptospira_phage	22.0	2.4e-26
AVF35770.1|2790270_2791236_+	acyltransferase	NA	NA	NA	NA	NA
AVF35771.1|2791236_2791785_-	transcriptional regulator	NA	NA	NA	NA	NA
AVF35772.1|2791883_2792552_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVF35773.1|2792548_2792872_+	branched-chain amino acid transport	NA	NA	NA	NA	NA
AVF35774.1|2792921_2794283_-	putrescine/spermidine ABC transporter	NA	NA	NA	NA	NA
AVF35775.1|2795110_2795920_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVF35776.1|2795909_2796545_-	lysine transporter LysE	NA	NA	NA	NA	NA
AVF35777.1|2796541_2797834_-	hypothetical protein	NA	NA	NA	NA	NA
AVF35778.1|2798005_2798665_+	hypothetical protein	NA	NA	NA	NA	NA
AVF35779.1|2798828_2799647_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVF35780.1|2799646_2800471_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVF35781.1|2800498_2801629_+	aminotransferase class I/II	NA	NA	NA	NA	NA
AVF35782.1|2801629_2802511_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVF35783.1|2802628_2804164_+	MFS transporter	NA	NA	NA	NA	NA
AVF35784.1|2804587_2805133_+|coat	spore coat protein U	coat	NA	NA	NA	NA
AVF35785.1|2805195_2805711_+|coat	spore coat protein U	coat	NA	NA	NA	NA
AVF35786.1|2805723_2806254_+|coat	spore coat protein U	coat	NA	NA	NA	NA
AVF35787.1|2806272_2807070_+	molecular chaperone	NA	NA	NA	NA	NA
AVF35788.1|2807086_2809642_+	fimbrial assembly protein	NA	NA	NA	NA	NA
AVF35789.1|2809625_2810591_+|coat	spore coat protein U	coat	NA	NA	NA	NA
AVF35790.1|2810662_2811142_-	cold-shock protein	NA	NA	NA	NA	NA
AVF35791.1|2811249_2811903_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A0H3Y8P5	Apricot_vein_clearing_associated_virus	34.0	2.9e-06
AVF35792.1|2811972_2812857_-	transcriptional regulator	NA	NA	NA	NA	NA
AVF35793.1|2812948_2813749_+	PEP phosphonomutase	NA	NA	NA	NA	NA
AVF35794.1|2813798_2814299_+	cell division protein ZipA	NA	NA	NA	NA	NA
AVF35795.1|2814400_2815219_+	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
AVF35796.1|2816056_2818219_+	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
AVF35797.1|2818289_2819606_+	putrescine-ornithine antiporter	NA	NA	NA	NA	NA
AVF35798.1|2819709_2821047_-	glucarate dehydratase	NA	NA	NA	NA	NA
AVF35799.1|2821075_2822416_-	glucarate dehydratase	NA	NA	NA	NA	NA
AVF35800.1|2822412_2823789_-	MFS transporter	NA	NA	NA	NA	NA
AVF35801.1|2824093_2825254_-	carbohydrate diacid regulon transcriptional regulator CdaR	NA	NA	NA	NA	NA
AVF35802.1|2825470_2826910_-|protease	serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.7	5.0e-27
>prophage 5
CP019062	Rahnella sp. ERMR1:05 chromosome, complete genome	4643505	4307672	4318928	4643505	tRNA,transposase	Bacillus_phage(42.86%)	9	NA	NA
AVF37031.1|4307672_4309037_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	25.6	3.0e-29
AVF37032.1|4309050_4310463_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	2.1e-54
AVF37033.1|4311383_4311881_+	double-stranded uracil-DNA glycosylase	NA	NA	NA	NA	NA
AVF37509.1|4311981_4312506_+	transcriptional regulator	NA	A0A1B1P776	Bacillus_phage	29.3	1.5e-10
AVF37034.1|4312559_4313345_+|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	53.3	5.1e-74
AVF37035.1|4313416_4315255_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
AVF37036.1|4315499_4317248_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.0	2.7e-75
AVF37037.1|4317383_4317599_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVF37038.1|4317914_4318928_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.8	1.7e-109
>prophage 6
CP019062	Rahnella sp. ERMR1:05 chromosome, complete genome	4643505	4393542	4488069	4643505	plate,tail,tRNA	Erwinia_phage(29.73%)	90	NA	NA
AVF37513.1|4393542_4394589_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
AVF37097.1|4394569_4395334_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	54.5	4.3e-70
AVF37098.1|4395323_4395950_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	7.5e-36
AVF37099.1|4396193_4397213_+	peptidase	NA	D7RWE0	Brochothrix_phage	35.2	2.2e-05
AVF37100.1|4397264_4398251_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	33.1	7.1e-33
AVF37514.1|4398372_4400919_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.1	2.9e-25
AVF37101.1|4401180_4402284_+	murein transglycosylase B	NA	NA	NA	NA	NA
AVF37102.1|4402447_4402936_+	hypothetical protein	NA	B5TK85	Pseudomonas_phage	48.4	6.9e-29
AVF37103.1|4403049_4404114_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.2	5.4e-111
AVF37515.1|4404319_4404886_+	recombination regulator RecX	NA	NA	NA	NA	NA
AVF37516.1|4405024_4407652_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.5	3.0e-78
AVF37104.1|4407907_4408093_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AVF37105.1|4409127_4409694_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
AVF37106.1|4409690_4410119_+	hypothetical protein	NA	NA	NA	NA	NA
AVF37107.1|4410204_4411779_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AVF37108.1|4411936_4412452_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
AVF37109.1|4412519_4413809_-	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
AVF37110.1|4413825_4414617_-	hypothetical protein	NA	NA	NA	NA	NA
AVF37111.1|4414780_4416142_+	signal recognition particle protein	NA	NA	NA	NA	NA
AVF37112.1|4416321_4416570_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AVF37113.1|4416588_4417137_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AVF37114.1|4417204_4417972_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AVF37115.1|4418026_4418374_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AVF37116.1|4418466_4418646_-	late control protein B	NA	F1BUT0	Erwinia_phage	75.5	4.9e-17
AVF37117.1|4418711_4419812_-|tail	phage tail protein	tail	Q6K1G4	Salmonella_virus	42.7	1.7e-80
AVF37118.1|4419814_4420285_-|tail	phage tail protein	tail	U5N3F6	Enterobacteria_phage	50.7	1.3e-37
AVF37119.1|4420281_4421913_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	37.4	1.4e-12
AVF37120.1|4421905_4422028_-|tail	phage tail protein	tail	O80316	Escherichia_phage	80.0	2.0e-09
AVF37121.1|4422060_4422342_-|tail	phage tail protein	tail	F1BUU0	Erwinia_phage	61.1	4.2e-23
AVF37122.1|4422400_4422910_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	68.4	4.0e-64
AVF37123.1|4422924_4424094_-|tail	phage tail protein	tail	F1BUU3	Erwinia_phage	79.2	3.9e-179
AVF37124.1|4424240_4424789_-	hypothetical protein	NA	F1BUK2	Cronobacter_phage	42.8	1.3e-31
AVF37125.1|4426173_4426701_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	70.9	9.3e-72
AVF37126.1|4426693_4427602_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	75.8	5.2e-123
AVF37127.1|4427606_4427957_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	60.3	9.3e-36
AVF37128.1|4427953_4428595_-|plate	baseplate assembly protein	plate	A0A0F7LBP2	Escherichia_phage	60.8	1.3e-67
AVF37129.1|4428676_4429141_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	42.4	5.4e-23
AVF37130.1|4429103_4429394_-	hypothetical protein	NA	F1BUQ0	Erwinia_phage	55.2	4.5e-20
AVF37131.1|4429236_4429662_-	transcriptional regulator	NA	F1BUQ1	Erwinia_phage	47.8	1.3e-07
AVF37132.1|4429658_4430171_-	glycoside hydrolase	NA	A0A218M4K3	Erwinia_phage	61.1	4.5e-55
AVF37133.1|4430151_4430373_-	hypothetical protein	NA	NA	NA	NA	NA
AVF37134.1|4430363_4430567_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	64.2	1.0e-18
AVF37135.1|4430767_4430962_-	hypothetical protein	NA	NA	NA	NA	NA
AVF37136.1|4433097_4433319_-	conjugal transfer protein TraR	NA	F1BUS2	Erwinia_phage	46.5	1.7e-11
AVF37137.1|4433318_4433594_-	hypothetical protein	NA	NA	NA	NA	NA
AVF37138.1|4433793_4434384_+	CI repressor	NA	Q6K1G0	Salmonella_virus	49.7	4.1e-52
AVF37139.1|4434681_4435758_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.3	8.8e-85
AVF37140.1|4435764_4436886_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AVF37141.1|4436958_4438113_-	chorismate mutase	NA	NA	NA	NA	NA
AVF37142.1|4438427_4438772_-	ribosomal subunit interface protein	NA	NA	NA	NA	NA
AVF37143.1|4438902_4439082_+	hypothetical protein	NA	NA	NA	NA	NA
AVF37144.1|4439084_4439819_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AVF37145.1|4439949_4440927_+	23S rRNA pseudouridine(1911/1915/1917) synthase	NA	NA	NA	NA	NA
AVF37146.1|4440926_4441664_+	hypothetical protein	NA	NA	NA	NA	NA
AVF37147.1|4441794_4444368_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.9	2.0e-127
AVF37148.1|4450242_4450590_-	hypothetical protein	NA	NA	NA	NA	NA
AVF37149.1|4450651_4452007_-	phosphatidylserine synthase	NA	NA	NA	NA	NA
AVF37150.1|4452091_4454812_-	protein acetyltransferase	NA	NA	NA	NA	NA
AVF37151.1|4454843_4455548_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AVF37152.1|4455677_4456097_-	thioredoxin TrxC	NA	A0A191VYI2	Roseobacter_phage	33.3	5.9e-13
AVF37153.1|4456340_4457444_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AVF37154.1|4457535_4459071_-	MFS transporter	NA	NA	NA	NA	NA
AVF37155.1|4459088_4460264_-	multidrug export protein EmrA	NA	NA	NA	NA	NA
AVF37156.1|4460289_4461744_-	transporter	NA	NA	NA	NA	NA
AVF37157.1|4461767_4462289_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
AVF37158.1|4462464_4462806_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
AVF37159.1|4462795_4463557_-	hypothetical protein	NA	NA	NA	NA	NA
AVF37160.1|4463731_4464916_-	MFS transporter	NA	NA	NA	NA	NA
AVF37161.1|4465063_4465939_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVF37162.1|4466000_4466996_-	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVF37163.1|4467111_4468287_-	proline/betaine ABC transporter permease ProW	NA	NA	NA	NA	NA
AVF37164.1|4468283_4469480_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.3	1.4e-27
AVF37165.1|4470070_4470784_-	response regulator	NA	NA	NA	NA	NA
AVF37166.1|4470776_4472429_-	histidine kinase	NA	NA	NA	NA	NA
AVF37167.1|4472748_4474104_+	malate permease	NA	NA	NA	NA	NA
AVF37168.1|4474292_4474853_+	glycoside hydrolase	NA	S5MM68	Bacillus_phage	41.1	1.4e-14
AVF37169.1|4474916_4475957_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
AVF37170.1|4476197_4477181_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.1	1.4e-134
AVF37171.1|4477201_4479364_-	ribonucleotide-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	52.2	1.3e-207
AVF37172.1|4479345_4479750_-	ribonucleotide reductase assembly protein NrdI	NA	NA	NA	NA	NA
AVF37173.1|4479760_4480000_-	NrdH-redoxin	NA	V5UN81	Mycobacterium_phage	51.3	2.3e-17
AVF37174.1|4480257_4480689_-	alkylhydroperoxidase	NA	NA	NA	NA	NA
AVF37175.1|4480811_4482284_+	DNA-binding protein	NA	NA	NA	NA	NA
AVF37176.1|4482412_4482709_-	hypothetical protein	NA	NA	NA	NA	NA
AVF37517.1|4483028_4484225_+	hypothetical protein	NA	NA	NA	NA	NA
AVF37177.1|4484351_4484687_+	hypothetical protein	NA	NA	NA	NA	NA
AVF37178.1|4484741_4485182_-	hypothetical protein	NA	NA	NA	NA	NA
AVF37179.1|4485341_4486286_-	6-phosphofructokinase II	NA	NA	NA	NA	NA
AVF37180.1|4486471_4487002_+	adenylate cyclase	NA	NA	NA	NA	NA
AVF37181.1|4487076_4488069_-|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
>prophage 1
CP019064	Rahnella sp. ERMR1:05 plasmid unnamed2, complete sequence	229977	1811	48940	229977	transposase,integrase	Bacillus_phage(29.41%)	43	250:302	29650:29702
250:302	attL	TGATCCCTTCCCAATATTGATGCCAGGATAAATCAGAGATCCGGGTCTGTTTG	NA	NA	NA	NA
AVF37977.1|1811_3056_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVF37978.1|4764_4929_+|transposase	transposase	transposase	A0A0U2RK18	Escherichia_phage	81.2	3.2e-15
AVF37979.1|5350_5680_+|transposase	transposase	transposase	Q1MVP4	Enterobacteria_phage	76.6	6.4e-39
AVF37980.1|5816_6560_-	oxidoreductase	NA	A0A0M4JSW6	Mollivirus	27.1	5.8e-11
AVF37981.1|6652_7207_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVF37982.1|7702_8578_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVF37983.1|8680_9616_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AVF37984.1|9612_9891_-	hypothetical protein	NA	U5P4I9	Shigella_phage	46.3	3.3e-12
AVF38153.1|10118_10643_+	transcriptional regulator	NA	A0A2I6AZV8	Macacine_betaherpesvirus	37.6	4.2e-24
AVF37985.1|10696_11482_+|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	52.9	3.3e-73
AVF37986.1|11609_11882_+	antitoxin	NA	NA	NA	NA	NA
AVF37987.1|11881_12247_+	growth inhibitor PemK	NA	NA	NA	NA	NA
AVF37988.1|12641_13577_-	hypothetical protein	NA	NA	NA	NA	NA
AVF37989.1|16144_17020_+	NmrA family transcriptional regulator	NA	NA	NA	NA	NA
AVF38154.1|17524_19078_-	hypothetical protein	NA	A0A0P0ZEB3	Stx2-converting_phage	65.7	1.0e-73
AVF37990.1|19883_20747_-|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	49.8	2.0e-71
AVF37991.1|20722_21229_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	33.3	3.2e-13
AVF37992.1|21395_22283_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVF37993.1|22400_23612_+	MFS transporter	NA	NA	NA	NA	NA
AVF38155.1|23852_24443_+	hypothetical protein	NA	NA	NA	NA	NA
AVF37994.1|24522_25263_+	oxidoreductase	NA	NA	NA	NA	NA
AVF37995.1|25416_26508_+	aldo/keto reductase	NA	NA	NA	NA	NA
AVF37996.1|26864_28634_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AVF37997.1|28746_29013_-	hypothetical protein	NA	NA	NA	NA	NA
AVF37998.1|29732_30560_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	39.2	3.9e-48
29650:29702	attR	TGATCCCTTCCCAATATTGATGCCAGGATAAATCAGAGATCCGGGTCTGTTTG	NA	NA	NA	NA
AVF37999.1|30565_30832_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF38000.1|31145_31409_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AVF38001.1|31395_31692_+	plasmid stabilization protein ParE	NA	NA	NA	NA	NA
AVF38002.1|32667_33942_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
AVF38003.1|34453_35353_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.4	2.1e-15
AVF38004.1|35567_36359_-	hypothetical protein	NA	NA	NA	NA	NA
AVF38156.1|36831_37143_-	hypothetical protein	NA	NA	NA	NA	NA
AVF38005.1|37275_38655_-	transcription factor	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	4.8e-11
AVF38006.1|39234_39897_-	hypothetical protein	NA	NA	NA	NA	NA
AVF38007.1|41731_42154_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVF38008.1|42436_42835_-	glutathione transferase	NA	Q2LI91	Bacillus_phage	34.1	2.5e-05
AVF38009.1|42986_43277_+	hypothetical protein	NA	NA	NA	NA	NA
AVF38157.1|43416_44151_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.7	2.1e-21
AVF38010.1|44264_45269_-	choloylglycine hydrolase	NA	NA	NA	NA	NA
AVF38011.1|45842_46646_-	hypothetical protein	NA	NA	NA	NA	NA
AVF38158.1|46918_47314_-|transposase	transposase	transposase	A0A0U2RK18	Escherichia_phage	91.6	7.9e-68
AVF38012.1|47340_47625_-|transposase	transposase	transposase	A0A0U2RK18	Escherichia_phage	83.5	1.8e-34
AVF38013.1|47983_48940_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	31.7	1.4e-25
