The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	321523	384780	4288947	bacteriocin,transposase	uncultured_Caudovirales_phage(20.0%)	52	NA	NA
AVF20306.1|321523_321823_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AVF20307.1|321918_322365_-	Thiol-disulfide oxidoreductase YkuV	NA	NA	NA	NA	NA
AVF20308.1|322379_322883_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20309.1|322852_324334_-|bacteriocin	putative bacteriocin-skfA transport system permease protein SkfF	bacteriocin	NA	NA	NA	NA
AVF20310.1|324326_325049_-	SkfA peptide export ATP-binding protein SkfE	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	1.9e-19
AVF20311.1|325061_326555_-	abortive infection protein	NA	NA	NA	NA	NA
AVF20312.1|326568_327783_-|bacteriocin	Antilisterial bacteriocin subtilosin biosynthesis protein AlbA	bacteriocin	NA	NA	NA	NA
AVF20313.1|327856_328042_-	Sporulation-killing factor SkfA	NA	NA	NA	NA	NA
AVF20314.1|328416_328821_+	D-mannose binding lectin	NA	NA	NA	NA	NA
AVF20315.1|329606_329933_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AVF20316.1|330071_330362_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20317.1|331001_333041_-	methyl-accepting chemotaxis protein signaling domain protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	43.3	1.4e-11
AVF20318.1|333160_333871_-	putative membrane protein	NA	NA	NA	NA	NA
AVF20319.1|334298_334511_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20320.1|334719_335154_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF20321.1|335150_338318_+	putative membrane protein YdgH	NA	NA	NA	NA	NA
AVF20322.1|338516_339104_+	peptide deformylase 2	NA	E3SLL2	Synechococcus_phage	36.8	1.2e-11
AVF20323.1|339158_340127_+	peptide methionine sulfoxide reductase MsrA/MsrB	NA	NA	NA	NA	NA
AVF20324.1|340452_341022_+	sodium/hydrogen exchanger family protein	NA	NA	NA	NA	NA
AVF20325.1|340831_341293_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF20326.1|341479_342700_+	major facilitator superfamily MFS_1 protein	NA	NA	NA	NA	NA
AVF20327.1|343073_343502_+	transcriptional regulator, BadM/Rrf2 family	NA	NA	NA	NA	NA
AVF20328.1|343733_344459_+	transcriptional regulator, GntR family	NA	NA	NA	NA	NA
AVF20329.1|344643_345141_+	N-acetylgalactosamine-specific phosphotransferase enzyme IIB component 2	NA	NA	NA	NA	NA
AVF20330.1|345159_345927_+	putative N-acetylgalactosamine permease IIC component 2	NA	NA	NA	NA	NA
AVF20331.1|345916_346789_+	N-acetylgalactosamine permease IID component AgaD	NA	NA	NA	NA	NA
AVF20332.1|346806_347229_+	PTS system mannose-specific component IIAB-like protein	NA	NA	NA	NA	NA
AVF20333.1|347293_350989_-	amino acid adenylation protein	NA	A0A2K9KZV5	Tupanvirus	30.8	2.3e-76
AVF20334.1|351073_352831_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.7	3.1e-15
AVF20335.1|354081_355716_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AVF20336.1|356191_357421_-	acetyltransferase	NA	NA	NA	NA	NA
AVF20337.1|357865_358933_-	thiamine biosynthesis lipoprotein ApbE	NA	NA	NA	NA	NA
AVF20338.1|359232_359523_+	putative membrane protein	NA	NA	NA	NA	NA
AVF20339.1|359599_360160_+	heptaprenyl diphosphate synthase related protein	NA	NA	NA	NA	NA
AVF20340.1|360195_361029_+	energy-coupling factor transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	1.4e-21
AVF20341.1|361004_361871_+	energy-coupling factor transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.9	4.2e-13
AVF20342.1|361887_362691_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AVF20343.1|364781_366056_+	aminotransferase class-III	NA	A0A1V0SKB7	Klosneuvirus	27.2	3.4e-27
AVF20344.1|366069_367509_+	3-octaprenyl-4hydroxybenzoate decarboxylase	NA	NA	NA	NA	NA
AVF20345.1|367480_368365_+	4-hydroxybenzoate polyprenyltransferase	NA	NA	NA	NA	NA
AVF20346.1|368712_369042_-	Two-component sensor histidine kinase YkoG-like protein	NA	NA	NA	NA	NA
AVF20347.1|369051_369357_-	heavy metal sensor kinase	NA	NA	NA	NA	NA
AVF20348.1|369353_369902_-	Two-component response regulator YkoH-like protein	NA	NA	NA	NA	NA
AVF20349.1|371944_372169_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20350.1|372463_373801_+	Clostridium P-47 protein	NA	NA	NA	NA	NA
AVF20351.1|376720_377404_+	toxin-like protein	NA	NA	NA	NA	NA
AVF20352.1|379767_380991_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVF20353.1|381126_382050_+	lethal factor domain protein	NA	NA	NA	NA	NA
AVF20354.1|382145_382583_+	toxin-like protein	NA	NA	NA	NA	NA
AVF20355.1|382911_383349_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20356.1|383229_383529_-|transposase	transposase	transposase	A0A218MNI5	uncultured_virus	51.6	4.5e-23
AVF20357.1|384012_384780_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	391769	439727	4288947	tRNA,transposase,bacteriocin	Paenibacillus_phage(23.53%)	52	NA	NA
AVF20364.1|391769_392522_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	6.4e-135
AVF20365.1|393432_393936_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20366.1|393952_395935_-	peptidoglycan-N-acetylmuramate O-acetyltransferase	NA	B5WZU0	Pseudomonas_phage	32.2	3.8e-41
AVF20367.1|396415_396790_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	97.6	1.2e-65
AVF20368.1|396920_397175_+|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	95.3	4.5e-40
AVF20369.1|397726_399673_-	ABC transporter, permease protein	NA	NA	NA	NA	NA
AVF20370.1|399659_400430_-	ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	8.0e-32
AVF20371.1|401196_402570_-	thermophilic serine proteinase	NA	NA	NA	NA	NA
AVF20372.1|402808_403081_-|transposase	transposase	transposase	U5P429	Shigella_phage	47.0	7.7e-14
AVF20373.1|403468_403756_-|transposase	transposase IS3/IS911 family protein	transposase	A0A1P8CWP5	Bacillus_phage	37.8	3.1e-05
AVF20374.1|404427_405084_+	Isonitrile hydratase	NA	NA	NA	NA	NA
AVF20375.1|405818_406082_+|transposase	transposase IS3/IS911	transposase	NA	NA	NA	NA
AVF20376.1|406048_406951_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A1B1P773	Bacillus_phage	42.3	1.5e-45
AVF20377.1|407329_407659_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20378.1|407787_407907_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20379.1|407986_408124_+|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
AVF20380.1|408140_408290_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF20381.1|408820_410530_-|tRNA	arginine--tRNA ligase ArgS	tRNA	A0A2I2L3K1	Orpheovirus	32.3	3.1e-76
AVF20382.1|411072_411744_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.8	1.5e-66
AVF20383.1|411740_412226_+	queuosine biosynthesis protein QueD	NA	J9PV91	Bacillus_phage	68.2	7.7e-57
AVF20384.1|412218_412956_+	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	41.8	4.2e-54
AVF20385.1|413009_413501_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	63.1	1.2e-49
AVF20386.1|413909_414713_+	Methyltransferase domain protein	NA	NA	NA	NA	NA
AVF20387.1|414837_416280_+	putative dipeptidase YtjP	NA	NA	NA	NA	NA
AVF20388.1|416535_416937_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
AVF20389.1|417042_418464_-	Na(+)/H(+) antiporter NhaC	NA	NA	NA	NA	NA
AVF20390.1|418699_419248_+	RNA polymerase sigma factor SigW-like protein	NA	NA	NA	NA	NA
AVF20391.1|419231_419852_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20392.1|420658_420763_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20393.1|420856_421369_+	Double zinc ribbon	NA	NA	NA	NA	NA
AVF20394.1|421780_422413_+	regulatory protein TenI	NA	NA	NA	NA	NA
AVF20395.1|422396_423101_+	FAD-dependent glycine oxidase-like protein	NA	NA	NA	NA	NA
AVF20396.1|423157_423361_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AVF20397.1|423401_424163_+	thiazole synthase ThiG	NA	NA	NA	NA	NA
AVF20398.1|424159_425086_+	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ThiD	NA	NA	NA	NA	NA
AVF20399.1|425057_425756_+	regulatory protein TenI	NA	NA	NA	NA	NA
AVF20400.1|425784_427596_+	Phosphomethylpyrimidine synthase	NA	NA	NA	NA	NA
AVF20401.1|427683_428364_+	Putative undecaprenyl-diphosphatase YbjG	NA	NA	NA	NA	NA
AVF20402.1|429295_429910_-	ATP-binding protein CirD	NA	A0A2H4PQG7	Staphylococcus_phage	30.3	4.8e-11
AVF20403.1|429930_430386_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20404.1|430400_431522_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20405.1|431529_431829_-|bacteriocin	putative bacteriocin	bacteriocin	NA	NA	NA	NA
AVF20406.1|431983_432166_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20407.1|432277_432406_+	putative transposon DNA-invertase Bin3	NA	NA	NA	NA	NA
AVF20408.1|432434_432845_+	resolvase	NA	A0A0F7LA37	Escherichia_phage	36.2	2.7e-10
AVF20409.1|433635_433803_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AVF20410.1|433831_433933_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20411.1|434167_434545_+|bacteriocin	putative bacteriocin	bacteriocin	NA	NA	NA	NA
AVF20412.1|435403_436099_+	ABC transporter	NA	G9BWD6	Planktothrix_phage	33.3	7.8e-18
AVF20413.1|436095_436452_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20414.1|436798_438772_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20415.1|439151_439727_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	49.7	3.9e-39
>prophage 3
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	450185	494540	4288947	transposase,holin,lysis	Paenibacillus_phage(40.0%)	48	NA	NA
AVF20425.1|450185_450404_+|transposase	transposase, IS605 family	transposase	NA	NA	NA	NA
AVF20426.1|451508_452414_+	ABC transporter, ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	4.7e-23
AVF20427.1|452406_453675_+	putative membrane protein	NA	NA	NA	NA	NA
AVF20428.1|454009_455647_+	L-2,4-diaminobutyrate decarboxylase	NA	NA	NA	NA	NA
AVF20429.1|455871_456669_-	multidrug resistance protein	NA	NA	NA	NA	NA
AVF20430.1|456669_457155_+	type I phosphodiesterase/nucleotide pyrophosphatase	NA	NA	NA	NA	NA
AVF20431.1|457397_459758_+	Helicase IV	NA	A0A1E1ETV1	Acanthamoeba_castellanii_mimivirus	25.9	1.7e-08
AVF20432.1|459806_460985_-	cystathionine beta-lyase PatB	NA	NA	NA	NA	NA
AVF20433.1|461167_461974_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
AVF20434.1|462421_463255_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20435.1|463382_464621_+	3-oxoacyl-[acyl-carrier-protein] synthase 2	NA	NA	NA	NA	NA
AVF20436.1|465103_465673_+	putative maltose O-acetyltransferase Maa	NA	NA	NA	NA	NA
AVF20437.1|465942_466368_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF20438.1|466374_466521_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20439.1|466527_467751_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVF20440.1|467815_467941_+	LexA repressor-like protein	NA	NA	NA	NA	NA
AVF20441.1|467943_468312_+	Acetyltransferase (GNAT) family protein	NA	NA	NA	NA	NA
AVF20442.1|468457_468685_-	Sulfurtransferase TusA	NA	NA	NA	NA	NA
AVF20443.1|468674_469886_-	putative inner membrane protein	NA	NA	NA	NA	NA
AVF20444.1|470527_471121_+	RNA polymerase sigma factor SigO	NA	NA	NA	NA	NA
AVF20445.1|471186_471438_+	Sigma-O factor regulatory protein RsoA	NA	NA	NA	NA	NA
AVF20446.1|472056_472461_+|holin,lysis	toxin secretion/phage lysis holin	holin,lysis	A0A0N7GFE6	Paenibacillus_phage	55.3	5.1e-30
AVF20447.1|472817_473243_+	putative toxin-antitoxin system, toxin component	NA	NA	NA	NA	NA
AVF20448.1|473244_473616_+	transcriptional regulator, ArsR family	NA	NA	NA	NA	NA
AVF20449.1|473876_474194_+	methylated-DNA-protein- cysteinemethyltransferase	NA	NA	NA	NA	NA
AVF20450.1|474344_474569_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20451.1|474583_474754_-	putative DNA-binding protein	NA	NA	NA	NA	NA
AVF20452.1|475150_475636_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20453.1|476046_476529_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20454.1|477106_477352_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20455.1|477436_478477_+	putative oxidoreductase YvaA	NA	NA	NA	NA	NA
AVF20456.1|478754_479816_+	glyceraldehyde-3-phosphate dehydrogenase 2	NA	NA	NA	NA	NA
AVF20457.1|479939_480530_+	transcriptional regulator, TetR family	NA	NA	NA	NA	NA
AVF20458.1|480595_481813_+	major facilitator superfamily MFS_1 protein	NA	NA	NA	NA	NA
AVF20459.1|482070_483054_+	Homoserine kinase	NA	NA	NA	NA	NA
AVF20460.1|483385_484288_+	carboxylate/amino acid/amine transporter	NA	NA	NA	NA	NA
AVF20461.1|484284_485076_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20462.1|485475_486207_+	glyoxalase family protein	NA	NA	NA	NA	NA
AVF20463.1|486257_486740_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20464.1|486813_487335_-	putative cell-wall hydrolase	NA	NA	NA	NA	NA
AVF20465.1|487492_488872_-	sensor histidine kinase YkoH	NA	A0A1V0SGX0	Hokovirus	32.4	5.7e-20
AVF20466.1|488861_489563_-	response regulator ArlR	NA	W8CYM9	Bacillus_phage	36.1	7.3e-32
AVF20467.1|489764_490517_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	1.9e-134
AVF20468.1|490654_491338_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	97.8	1.8e-120
AVF20469.1|491430_492024_-	undecaprenyl-diphosphatase BcrC	NA	NA	NA	NA	NA
AVF20470.1|492272_492980_+	ABC-type transporter ATP-binding protein EcsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	2.2e-15
AVF20471.1|493025_493214_+	ABC transporter-like protein	NA	NA	NA	NA	NA
AVF20472.1|493526_494540_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	30.6	1.3e-18
>prophage 4
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	521391	557919	4288947	transposase,holin	Streptococcus_phage(33.33%)	31	NA	NA
AVF20504.1|521391_522552_+|holin	glycine betaine/carnitine/choline transport ATP-binding protein OpuCA	holin	G3M9Y6	Bacillus_virus	33.6	9.0e-27
AVF20505.1|522548_523205_+|holin	choline transport system permease protein OpuBB	holin	NA	NA	NA	NA
AVF20506.1|523221_524115_+|holin	choline-binding protein	holin	NA	NA	NA	NA
AVF20507.1|524158_524788_+|holin	glycine betaine/carnitine/choline transport system permease protein OpuCD	holin	NA	NA	NA	NA
AVF20508.1|525068_525497_+	Acetyltransferase YpeA	NA	NA	NA	NA	NA
AVF20509.1|525777_526365_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20510.1|526393_527563_+	putative iron-sulfur cluster binding protein	NA	NA	NA	NA	NA
AVF20511.1|527633_528668_+	metal dependent phosphohydrolase	NA	NA	NA	NA	NA
AVF20512.1|528768_528978_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20513.1|529333_529924_+	GTP cyclohydrolase 1	NA	E7DN69	Pneumococcus_phage	54.4	5.5e-49
AVF20514.1|530144_531425_-	putative superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	42.8	8.1e-37
AVF20515.1|531498_532530_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20516.1|532867_533611_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20517.1|533718_534690_+	CDF family cation diffusion facilitator	NA	NA	NA	NA	NA
AVF20518.1|534849_537549_-	aconitate hydratase Acn	NA	NA	NA	NA	NA
AVF20519.1|537891_538911_+	two-component response regulator	NA	NA	NA	NA	NA
AVF20520.1|538933_540055_+	D-alanine--D-alanine ligase Ddl	NA	NA	NA	NA	NA
AVF20521.1|540178_540367_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20522.1|540567_541596_+	UV DNA damage endonuclease UvsE	NA	A0A2I2L3D9	Orpheovirus	27.5	7.7e-22
AVF20523.1|541784_542555_+	enoyl-[acyl-carrier-protein] reductase [NADH] FabI	NA	NA	NA	NA	NA
AVF20524.1|542688_542982_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20525.1|543489_544344_+	inositol-1-monophosphatase SuhB	NA	NA	NA	NA	NA
AVF20526.1|544426_544864_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
AVF20527.1|545024_546029_+	biotin synthase BioB	NA	NA	NA	NA	NA
AVF20528.1|546104_550631_-	glutamate synthase [NADPH] large chain GltA	NA	NA	NA	NA	NA
AVF20529.1|551156_552470_-	glutamate-1-semialdehyde 2,1-aminomutase 1	NA	NA	NA	NA	NA
AVF20530.1|552561_553587_-	transcriptional regulator LytR	NA	NA	NA	NA	NA
AVF20531.1|554136_554607_+	peroxiredoxin-like protein	NA	NA	NA	NA	NA
AVF20532.1|554898_556254_+	putative polysaccharide deacetylase YheN	NA	NA	NA	NA	NA
AVF20533.1|556391_557018_+|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	53.8	6.1e-54
AVF20534.1|557244_557919_+|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	43.8	3.0e-35
>prophage 5
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	616544	711104	4288947	integrase,coat,transposase,lysis,protease,holin	Staphylococcus_phage(25.0%)	87	619681:619695	628543:628557
AVF20576.1|616544_616988_+|transposase	transposase-like protein	transposase	NA	NA	NA	NA
AVF20577.1|617044_617227_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20578.1|617396_619391_-	methyl-accepting chemotaxis protein TlpB	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.8	7.0e-11
AVF20579.1|619575_619812_+	hypothetical protein	NA	NA	NA	NA	NA
619681:619695	attL	CTTAGAGAAAGTAGC	NA	NA	NA	NA
AVF20580.1|619994_620279_-|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
AVF20581.1|620575_620848_+	transcriptional regulator, LuxR family	NA	NA	NA	NA	NA
AVF20582.1|620844_621855_+|protease	intracellular serine protease	protease	A0A2H4PQH1	Staphylococcus_phage	28.6	9.9e-22
AVF20583.1|621870_622569_+	ABC transporter-like protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	3.1e-14
AVF20584.1|622574_623729_+	ABC transporter-like protein	NA	NA	NA	NA	NA
AVF20585.1|623829_624051_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20586.1|627504_627780_+|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	61.5	3.1e-18
AVF20587.1|628022_628532_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20588.1|629342_630800_+	Type I restriction enzyme EcoKI M protein	NA	A0A1W6JNK1	Staphylococcus_phage	26.9	3.2e-21
628543:628557	attR	CTTAGAGAAAGTAGC	NA	NA	NA	NA
AVF20589.1|630789_631950_+	EcoKI restriction-modification system protein HsdS	NA	NA	NA	NA	NA
AVF20590.1|631960_635311_+	type I restriction enzyme EcoKI subunit R	NA	Q5YA94	Bacillus_phage	23.2	2.0e-18
AVF20591.1|635964_637269_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20592.1|637253_638714_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20593.1|638706_639468_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20594.1|639474_642693_+	putative ABC transporter ATP-binding protein YbbL	NA	NA	NA	NA	NA
AVF20595.1|643884_644370_+	taurine catabolism dioxygenase TauD/TfdA	NA	NA	NA	NA	NA
AVF20596.1|644478_645441_+	ATP-binding transport protein NatA	NA	A0A2R8FG22	Brazilian_cedratvirus	24.0	3.1e-17
AVF20597.1|645424_646225_+	putative ABC transporter, permease protein	NA	NA	NA	NA	NA
AVF20598.1|646229_647027_+	putative ABC transporter, permease protein	NA	NA	NA	NA	NA
AVF20599.1|647754_649638_+	chaperone protein HtpG	NA	A0A1V0SAD6	Catovirus	34.4	3.6e-94
AVF20600.1|651517_652465_+	export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.4	1.5e-24
AVF20601.1|652641_653586_+	ABC transporter-like protein	NA	NA	NA	NA	NA
AVF20602.1|653801_654221_+	thioesterase superfamily protein	NA	NA	NA	NA	NA
AVF20603.1|654217_655168_+	malonyl-CoA-[acyl-carrier-protein] transacylase	NA	NA	NA	NA	NA
AVF20604.1|655160_655907_+	3-oxoacyl-[acyl-carrier-protein] reductase FabG	NA	W8CYX9	Bacillus_phage	46.1	4.9e-10
AVF20605.1|656029_656317_+	acyl carrier protein	NA	NA	NA	NA	NA
AVF20606.1|656323_656812_+	(3R)-hydroxymyristoyl-[acyl-carrier-protein] dehydratase FabZ	NA	NA	NA	NA	NA
AVF20607.1|656808_659607_+	putative acetyltransferase	NA	NA	NA	NA	NA
AVF20608.1|659635_660193_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF20609.1|660210_660720_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF20610.1|660932_661373_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20611.1|662987_663167_-	dTDP-glucose 4,6-dehydratase	NA	NA	NA	NA	NA
AVF20612.1|663163_663886_-|coat	spore coat polysaccharide biosynthesis protein SpsI	coat	H9NC64	Sphingomonas_phage	41.0	7.8e-45
AVF20613.1|664866_665757_+	3D domain protein	NA	A0A024B055	Bacillus_phage	43.6	3.7e-12
AVF20614.1|666060_667071_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
AVF20615.1|667507_668383_+	putative endopeptidase LytE	NA	D2KRB9	Lactobacillus_phage	33.0	2.6e-10
AVF20616.1|668699_669098_+|holin,lysis	toxin secretion/phage lysis holin	holin,lysis	A0A0N7GFE6	Paenibacillus_phage	43.5	1.1e-21
AVF20617.1|669200_669722_-	putative oxidoreductase YusZ	NA	NA	NA	NA	NA
AVF20618.1|670149_670848_+	pirin domain protein	NA	NA	NA	NA	NA
AVF20619.1|670934_672104_-	N-acetylglucosamine-6-phosphate deacetylase NagA	NA	NA	NA	NA	NA
AVF20620.1|672100_672829_-	glucosamine-6-phosphate deaminase NagB	NA	NA	NA	NA	NA
AVF20621.1|672832_673690_-	transcriptional regulator, RpiR family	NA	NA	NA	NA	NA
AVF20622.1|673876_674545_+	pyrophosphatase PpaX	NA	NA	NA	NA	NA
AVF20623.1|674593_675799_+	putative membrane protein	NA	NA	NA	NA	NA
AVF20624.1|675817_677782_+	soluble pyridine nucleotide transhydrogenase	NA	NA	NA	NA	NA
AVF20625.1|677991_679491_-	Inner membrane protein YqiK	NA	A0A2I2L4B2	Orpheovirus	27.2	1.6e-07
AVF20626.1|679531_680053_-	membrane integrity-associated integral inner membrane protein	NA	NA	NA	NA	NA
AVF20627.1|680174_681083_-	putative phosphatase	NA	NA	NA	NA	NA
AVF20628.1|681231_681927_+	glycosyltransferase, group 2 family protein	NA	A8CG95	Salmonella_phage	28.0	1.4e-06
AVF20629.1|681942_682332_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20630.1|682335_682707_+	4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnE	NA	NA	NA	NA	NA
AVF20631.1|682747_683974_+	putative membrane protein	NA	NA	NA	NA	NA
AVF20632.1|683996_685433_-|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
AVF20633.1|685438_686557_-|coat	spore coat associated-like protein	coat	NA	NA	NA	NA
AVF20634.1|686556_687927_-|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
AVF20635.1|687939_689139_-|coat	endospore coat-associated protein YheC	coat	NA	NA	NA	NA
AVF20636.1|689147_690521_-|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
AVF20637.1|690650_691817_+	putative membrane protein	NA	NA	NA	NA	NA
AVF20638.1|691865_692225_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20639.1|692408_693404_+	oxidoreductase-like protein	NA	NA	NA	NA	NA
AVF20640.1|693639_693810_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20641.1|693809_694478_-	ABC-transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	4.4e-10
AVF20642.1|694470_694785_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20643.1|695262_695502_+	Sorbitol-6-phosphate 2-dehydrogenase	NA	NA	NA	NA	NA
AVF20644.1|695523_695652_+	putative transaldolase Tal	NA	NA	NA	NA	NA
AVF20645.1|695614_695782_-|transposase	transposase, IS605 family	transposase	A0A288TXV8	Enterococcus_phage	57.7	8.6e-08
AVF20646.1|695886_697698_-	oligopeptide-binding protein OppA	NA	NA	NA	NA	NA
AVF20647.1|697904_698147_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20648.1|698274_698553_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20649.1|698707_700045_+	inosine-5'-monophosphate dehydrogenase GuaB	NA	NA	NA	NA	NA
AVF20650.1|700028_700442_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20651.1|700510_700663_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20652.1|700882_701065_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20653.1|701163_703485_+	ATPase/histidine kinase/DNA gyrase B/HSP90 domain protein	NA	NA	NA	NA	NA
AVF20654.1|703481_704111_+	response regulator receiver domain protein	NA	NA	NA	NA	NA
AVF20655.1|704132_705107_+	isoprenyl transferase-like protein	NA	NA	NA	NA	NA
AVF20656.1|705249_705456_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20657.1|705421_705964_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20658.1|706317_706665_+	putative DNA-binding protein	NA	NA	NA	NA	NA
AVF20659.1|708130_709177_+	gamma-D-glutamate-meso-diaminopimelate muropeptidase-like protein	NA	A0A1W6DXV0	Rhodococcus_phage	39.1	2.3e-13
AVF20660.1|709625_710204_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20661.1|710200_710533_-	Sporulation membrane protein YtrH	NA	NA	NA	NA	NA
AVF20662.1|710756_711104_+|transposase	putative transposase	transposase	D9J0Y9	Brochothrix_phage	64.8	1.4e-31
>prophage 6
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	794000	842201	4288947	coat,capsid,tRNA,lysis,transposase,tail,holin	Brevibacillus_phage(43.75%)	61	NA	NA
AVF20746.1|794000_795335_+	phage protein	NA	A0A0A7S087	Clostridium_phage	46.4	7.5e-110
AVF20747.1|795336_795798_+	putative phage protein	NA	A0A0A7RVP1	Clostridium_phage	60.3	2.8e-48
AVF20748.1|795817_796240_+	phage protein	NA	X5JAB6	Clostridium_phage	41.8	5.8e-24
AVF20749.1|796611_798657_+|tail	putative tail length tape measure protein	tail	A0A0K2CP22	Brevibacillus_phage	40.5	2.5e-128
AVF20750.1|798656_799298_+	putative phage cell wall hydrolase	NA	S5MUH0	Brevibacillus_phage	46.3	2.7e-49
AVF20751.1|799302_800271_+	putative phage cell wall hydrolase	NA	S5MNC9	Brevibacillus_phage	59.5	3.4e-112
AVF20752.1|800270_800558_+	hypothetical protein	NA	S5M5M4	Brevibacillus_phage	36.8	7.4e-15
AVF20753.1|800560_800983_+	phage protein	NA	A0A0A7RTU4	Clostridium_phage	47.8	3.3e-27
AVF20754.1|800960_802037_+|capsid	phage capsid assembly-like protein	capsid	S5MUH6	Brevibacillus_phage	50.3	9.0e-98
AVF20755.1|802029_802611_+	putative phage protein	NA	S5MA71	Brevibacillus_phage	42.3	7.9e-32
AVF20756.1|802607_802886_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20757.1|802889_804989_+	phage structural protein	NA	NA	NA	NA	NA
AVF20758.1|805001_805394_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20759.1|805386_805548_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20760.1|805586_805997_+|holin,lysis	toxin secretion/phage lysis holin	holin,lysis	A0A0N7GFE6	Paenibacillus_phage	50.4	2.3e-30
AVF20761.1|805993_806767_+	N-acetylmuramoyl-L-alanine amidase	NA	D6QWN1	uncultured_phage	62.3	4.0e-55
AVF20762.1|806984_808277_-	putative bifunctional chitinase/lysozyme precursor	NA	NA	NA	NA	NA
AVF20763.1|808938_809286_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20764.1|809336_809681_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20765.1|809865_810069_+|coat	spore coat-like protein	coat	NA	NA	NA	NA
AVF20766.1|810087_810207_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20767.1|811272_812412_+	aldehyde-alcohol dehydrogenase AdhE	NA	NA	NA	NA	NA
AVF20768.1|812721_812949_+	putative propanediol utilization protein	NA	NA	NA	NA	NA
AVF20769.1|812960_813392_+	putative ethanolamine/propanediol utilization protein	NA	NA	NA	NA	NA
AVF20770.1|813627_814200_+	response regulator-like protein	NA	NA	NA	NA	NA
AVF20771.1|814192_815617_+	putative sensor histidine kinase	NA	NA	NA	NA	NA
AVF20772.1|815757_817188_+	reactivating factor for ethanolamine ammonia lyase	NA	NA	NA	NA	NA
AVF20773.1|817217_818582_+	ethanolamine ammonia-lyase heavy chain EutB	NA	NA	NA	NA	NA
AVF20774.1|818603_819554_+	ethanolamine ammonia-lyase light chain EutC	NA	NA	NA	NA	NA
AVF20775.1|819572_820226_+	ethanolamine utilization protein EutL	NA	NA	NA	NA	NA
AVF20776.1|820237_820978_+	propanediol utilization protein PduA	NA	NA	NA	NA	NA
AVF20777.1|821128_822592_+	aldehyde-alcohol dehydrogenase AdhE	NA	NA	NA	NA	NA
AVF20778.1|822641_822929_+	propanediol utilization protein PduA	NA	NA	NA	NA	NA
AVF20779.1|823073_823901_+	ethanolamine utilization cobalamin adenosyltransferase EutT	NA	NA	NA	NA	NA
AVF20780.1|823912_824551_+	phosphate propanoyltransferase PduL	NA	NA	NA	NA	NA
AVF20781.1|824569_825253_+	putative ethanolamine utilization protein	NA	NA	NA	NA	NA
AVF20782.1|825265_825538_+	ethanolamine utilization protein EutN	NA	NA	NA	NA	NA
AVF20783.1|825530_826076_+	ethanolamine utilization protein	NA	NA	NA	NA	NA
AVF20784.1|826095_827211_+	ethanolamine utilization protein EutH	NA	NA	NA	NA	NA
AVF20785.1|827213_827324_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20786.1|827548_828388_+	methyltransferase type 11	NA	NA	NA	NA	NA
AVF20787.1|828515_828680_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20788.1|828727_828889_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20789.1|829824_830019_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF20790.1|830041_830254_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20791.1|830352_830814_+	putative DNA-binding protein	NA	A0A0K2CP77	Brevibacillus_phage	30.5	2.0e-22
AVF20792.1|830810_830942_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20793.1|831747_832050_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20794.1|832066_832591_+	putative integral membrane protein	NA	NA	NA	NA	NA
AVF20795.1|832673_833087_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20796.1|833358_833661_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20797.1|834046_834484_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20798.1|834758_835397_+	transcriptional regulatory protein	NA	NA	NA	NA	NA
AVF20799.1|835396_835579_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20800.1|835685_836747_+	selenide, water dikinase	NA	NA	NA	NA	NA
AVF20801.1|836801_837854_+|tRNA	tRNA 2-selenouridine synthase SelU	tRNA	NA	NA	NA	NA
AVF20802.1|838114_838585_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20803.1|838647_839025_+	Gas vesicle protein	NA	NA	NA	NA	NA
AVF20804.1|839798_840371_-	putative ribosomal-protein-alanine acetyltransferase YjcK	NA	D0R097	Streptococcus_phage	28.3	1.1e-06
AVF20805.1|840539_841223_+|transposase	transposase	transposase	A0A1P8DJG9	Virus_Rctr71	30.9	9.3e-16
AVF20806.1|841679_842201_+|transposase	putative transposase	transposase	A0A0H3UZC2	Geobacillus_virus	40.0	4.3e-21
>prophage 7
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	935062	967212	4288947	transposase	Clostridium_botulinum_C_phage(20.0%)	40	NA	NA
AVF20903.1|935062_935644_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AVF20904.1|935735_936380_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20905.1|936725_937052_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20906.1|937178_937487_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20907.1|937879_938113_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20908.1|938184_938853_+	Adenosylcobinamide amidohydrolase	NA	NA	NA	NA	NA
AVF20909.1|939785_939944_-	Ribosomal RNA large subunit methyltransferase Cfr	NA	NA	NA	NA	NA
AVF20910.1|940053_940164_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20911.1|940361_940757_+|transposase	transposase IS200-family protein	transposase	Q332K6	Clostridium_botulinum_C_phage	62.8	7.0e-40
AVF20912.1|940761_941775_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	30.6	1.3e-18
AVF20913.1|941930_943409_-	ATP-binding cassette efflux transporter-like protein	NA	A0A2K9L0W2	Tupanvirus	25.4	5.0e-30
AVF20914.1|944659_944881_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20915.1|944932_945052_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20916.1|945048_945270_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20917.1|945914_947210_-	two-component sensor kinase	NA	NA	NA	NA	NA
AVF20918.1|947216_947954_-	Two-component response regulator LytS-like protein	NA	NA	NA	NA	NA
AVF20919.1|948169_948727_+	Membrane protein putatively involved in post-translational modification of the autoinducing quorum-sensing peptide	NA	NA	NA	NA	NA
AVF20920.1|948797_948938_+	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
AVF20921.1|948962_949160_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20922.1|949279_950677_+	radical SAM domain protein	NA	NA	NA	NA	NA
AVF20923.1|950683_951907_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVF20924.1|951971_952841_+	arginine deiminase ArcA	NA	NA	NA	NA	NA
AVF20925.1|952858_953857_+	ornithine carbamoyltransferase, catabolic	NA	NA	NA	NA	NA
AVF20926.1|953953_955369_+	arginine/ornithine antiporter ArcD	NA	NA	NA	NA	NA
AVF20927.1|955385_956339_+	carbamate kinase ArcC	NA	NA	NA	NA	NA
AVF20928.1|956377_957064_+	cAMP-binding protein	NA	NA	NA	NA	NA
AVF20929.1|957119_957617_-	cAMP-binding protein	NA	NA	NA	NA	NA
AVF20930.1|958110_958278_+	L-gulono-1,4-lactone dehydrogenase	NA	NA	NA	NA	NA
AVF20931.1|958351_958777_-	putative ribosomal protein	NA	NA	NA	NA	NA
AVF20932.1|958905_959769_-	copper amine oxidase-like protein	NA	NA	NA	NA	NA
AVF20933.1|960110_961142_-	putative membrane protein	NA	NA	NA	NA	NA
AVF20934.1|961374_961809_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20935.1|961914_962238_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20936.1|962841_963012_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20937.1|963032_963299_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20938.1|963757_965227_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20939.1|965198_965552_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20940.1|965541_966204_+	ATP-binding protein CirD	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	1.4e-13
AVF20941.1|966301_966637_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF20942.1|966654_967212_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	972505	1029367	4288947	tRNA,transposase,coat	Apis_mellifera_filamentous_virus(20.0%)	52	NA	NA
AVF20947.1|972505_973063_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF20948.1|973080_973590_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF20949.1|973752_975216_+	GlcNAc-binding protein A	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.2	7.3e-26
AVF20950.1|975383_975842_+	transcriptional regulator, XRE family	NA	NA	NA	NA	NA
AVF20951.1|975915_976218_+	transcriptional regulator, XRE family	NA	NA	NA	NA	NA
AVF20952.1|976280_977156_-	ferri-bacillibactin esterase BesA	NA	NA	NA	NA	NA
AVF20953.1|977303_978521_-	cytochrome P450	NA	NA	NA	NA	NA
AVF20954.1|979004_980885_+	ATP-dependent OLD family endonuclease	NA	NA	NA	NA	NA
AVF20955.1|980971_981292_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20956.1|981661_981901_+	type I restriction enzyme EcoKI subunit R-like protein	NA	NA	NA	NA	NA
AVF20957.1|981897_982461_+	type I restriction enzyme EcoKI subunit R-like protein	NA	NA	NA	NA	NA
AVF20958.1|982457_983690_+	type-1 restriction enzyme StySJI specificity protein HsdS	NA	NA	NA	NA	NA
AVF20959.1|984421_984802_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20960.1|984791_986999_+	putative DNA helicase	NA	NA	NA	NA	NA
AVF20961.1|987032_987260_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20962.1|987275_987488_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF20963.1|987664_988105_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF20964.1|988560_989235_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20965.1|989376_989664_+|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
AVF20966.1|990940_991297_+	hypothetical protein	NA	Q38196	Clostridium_botulinum_phage	35.5	2.7e-06
AVF20967.1|991212_991461_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20968.1|991432_991687_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20969.1|992794_994876_+	Thioredoxin-related protein	NA	NA	NA	NA	NA
AVF20970.1|995030_996071_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20971.1|996447_997395_+	Sulfite exporter TauE/SafE	NA	NA	NA	NA	NA
AVF20972.1|997457_998150_-	putative membrane protein	NA	NA	NA	NA	NA
AVF20973.1|998146_998506_-	LrgA family protein	NA	NA	NA	NA	NA
AVF20974.1|998833_1000036_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
AVF20975.1|1000241_1001567_+	inosine-5'-monophosphate dehydrogenase GuaB	NA	NA	NA	NA	NA
AVF20976.1|1001852_1002014_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20977.1|1002073_1003366_+	isocitrate lyase AceA	NA	NA	NA	NA	NA
AVF20978.1|1003395_1004994_+	malate synthase Mls	NA	NA	NA	NA	NA
AVF20979.1|1005129_1008255_+	putative N-acetyltransferase YvbK	NA	NA	NA	NA	NA
AVF20980.1|1008287_1008719_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20981.1|1011410_1011689_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20982.1|1011688_1012120_-	hypothetical protein	NA	NA	NA	NA	NA
AVF20983.1|1012247_1012802_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20984.1|1012798_1013389_-	putative carbonic anhydrase YtiB	NA	NA	NA	NA	NA
AVF20985.1|1013411_1013747_-	HesB/YadR/YfhF-family protein	NA	NA	NA	NA	NA
AVF20986.1|1013853_1015374_+	Zn-dependent carboxypeptidase	NA	NA	NA	NA	NA
AVF20987.1|1015963_1017052_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AVF20988.1|1017364_1017865_+	ABC transporter-like protein	NA	NA	NA	NA	NA
AVF20989.1|1018032_1018275_+	ABC transporter, ATP-binding protein	NA	NA	NA	NA	NA
AVF20990.1|1018275_1018827_+	glycine betaine transport ATP-binding protein OpuAA	NA	G3M9Y6	Bacillus_virus	39.6	2.3e-20
AVF20991.1|1018816_1019107_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20992.1|1019546_1020509_+	putative lipoprotein	NA	NA	NA	NA	NA
AVF20993.1|1020606_1021176_+|coat	spore coat protein E	coat	NA	NA	NA	NA
AVF20994.1|1021277_1022633_+	hypothetical protein	NA	NA	NA	NA	NA
AVF20995.1|1022756_1025438_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	22.2	5.8e-29
AVF20996.1|1025468_1027517_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.2	6.0e-66
AVF20997.1|1027586_1028417_+	methyltransferase-like protein	NA	NA	NA	NA	NA
AVF20998.1|1028404_1029367_+|tRNA	tRNA dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 9
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	1041456	1090516	4288947	tRNA,integrase,transposase,coat	Paenibacillus_phage(45.45%)	46	1048649:1048666	1079236:1079253
AVF21010.1|1041456_1041588_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF21011.1|1041791_1042607_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	1.1e-58
AVF21012.1|1042716_1043547_-|integrase	integrase catalytic region	integrase	Q6H9S6	Enterobacteria_phage	26.1	1.0e-16
AVF21013.1|1043990_1044365_+	toxin-like protein	NA	NA	NA	NA	NA
AVF21014.1|1044325_1044679_+	toxin-like protein	NA	NA	NA	NA	NA
AVF21015.1|1045186_1048543_+	toxin-like protein	NA	A0A1V0E026	Clostridioides_phage	37.6	1.4e-88
1048649:1048666	attL	AAAGAAATAGCTCCCCAA	NA	NA	NA	NA
AVF21016.1|1048763_1049207_-|transposase	transposase-like protein	transposase	NA	NA	NA	NA
AVF21017.1|1049624_1049951_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF21018.1|1050019_1050259_-|integrase	phage integrase-like protein	integrase	A0A0S2SXP1	Bacillus_phage	71.8	5.5e-24
AVF21019.1|1050518_1050869_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21020.1|1050708_1051041_-	hypothetical protein	NA	NA	NA	NA	NA
AVF21021.1|1051030_1051492_-|transposase	putative transposase for insertion sequence element IS3 family protein	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	40.7	4.2e-20
AVF21022.1|1051535_1051946_-	hypothetical protein	NA	NA	NA	NA	NA
AVF21023.1|1052861_1054085_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVF21024.1|1054940_1056032_+	membrane transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF21025.1|1056129_1056363_+	hypothetical protein	NA	A0A0K2CYV5	Paenibacillus_phage	46.6	2.2e-09
AVF21026.1|1056859_1057126_+	hypothetical protein	NA	A0A2I7SCW2	Paenibacillus_phage	72.7	1.9e-28
AVF21027.1|1057271_1057889_-	LexA repressor	NA	A0A1B2APZ1	Phage_Wrath	63.8	6.5e-16
AVF21028.1|1058034_1058412_+	Cell division suppressor protein YneA	NA	NA	NA	NA	NA
AVF21029.1|1058593_1058779_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21030.1|1058805_1059600_+	phosphatase-like protein	NA	NA	NA	NA	NA
AVF21031.1|1059705_1060248_-	acireductone dioxygenase MtnD	NA	NA	NA	NA	NA
AVF21032.1|1060524_1063965_+	methionine synthase MetH	NA	A0A140XBC7	Dickeya_phage	46.7	5.1e-09
AVF21033.1|1064139_1065096_+	ribonuclease Z	NA	NA	NA	NA	NA
AVF21034.1|1065134_1065248_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21035.1|1065219_1065594_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	96.8	4.6e-65
AVF21036.1|1066594_1067362_-|transposase	transposase	transposase	A0A2I7SC07	Paenibacillus_phage	61.5	5.7e-62
AVF21037.1|1067389_1068613_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVF21038.1|1068605_1068956_-	hypothetical protein	NA	A0A2I7SC07	Paenibacillus_phage	61.2	2.9e-13
AVF21039.1|1069719_1069905_-	hypothetical protein	NA	A0A0C5AJ71	Bacteriophage	65.2	6.0e-10
AVF21040.1|1070587_1070821_+	hypothetical protein	NA	A0A0C5AFE4	Paenibacillus_phage	75.3	1.6e-20
AVF21041.1|1071176_1073840_+	ATP-dependent helicase	NA	NA	NA	NA	NA
AVF21042.1|1074094_1075162_+	putative phage DNA-binding protein	NA	A0A0A7RTT7	Clostridium_phage	33.9	2.2e-48
AVF21043.1|1075410_1075893_+	putative phage protein	NA	A0A0N9SGM1	Paenibacillus_phage	41.3	1.4e-26
AVF21044.1|1076094_1076646_-	hypothetical protein	NA	NA	NA	NA	NA
AVF21045.1|1077455_1078205_-	putative phage-associated protein	NA	A0A0C5ABL3	Bacteriophage	67.5	5.1e-92
AVF21046.1|1078207_1078969_-	hypothetical protein	NA	A0A0C5AN10	Bacteriophage	68.7	2.9e-82
AVF21047.1|1079718_1081281_+	bacillolysin	NA	NA	NA	NA	NA
1079236:1079253	attR	AAAGAAATAGCTCCCCAA	NA	NA	NA	NA
AVF21048.1|1081692_1082916_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVF21049.1|1083366_1083681_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21050.1|1084275_1084914_+	ribonuclease H	NA	NA	NA	NA	NA
AVF21051.1|1085126_1086545_+	cobyrinic acid A,C-diamide synthase	NA	NA	NA	NA	NA
AVF21052.1|1086923_1087910_+|tRNA	tryptophan--tRNA ligase TrpS	tRNA	NA	NA	NA	NA
AVF21053.1|1088287_1088512_+	small, acid-soluble spore protein A	NA	A0A1P8CX76	Bacillus_phage	47.8	5.6e-10
AVF21054.1|1088648_1089632_-	membrane-bound metal-dependent hydrolase	NA	NA	NA	NA	NA
AVF21055.1|1090036_1090516_-|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
>prophage 10
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	1168081	1303001	4288947	terminase,integrase,portal,coat,capsid,transposase,tail,protease,head	Paenibacillus_phage(80.2%)	160	1191973:1191988	1269431:1270819
AVF21135.1|1168081_1168591_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF21136.1|1168608_1169166_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF21137.1|1169270_1169870_+	S-layer domain-containing protein	NA	NA	NA	NA	NA
AVF21138.1|1170142_1171063_+	endo-1,4-D-glucanase	NA	NA	NA	NA	NA
AVF21139.1|1171164_1172457_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AVF21140.1|1172775_1174215_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
AVF21141.1|1174218_1175013_+	MSM operon regulatory protein-like protein	NA	NA	NA	NA	NA
AVF21142.1|1175078_1175558_+	protein YtsP	NA	NA	NA	NA	NA
AVF21143.1|1175660_1176344_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	97.8	2.2e-121
AVF21144.1|1176481_1177234_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	1.9e-134
AVF21145.1|1177554_1178154_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF21146.1|1178183_1178696_-	efflux transporter-like protein	NA	NA	NA	NA	NA
AVF21147.1|1178707_1179490_-	phosphatidylserine decarboxylase proenzyme Psd	NA	NA	NA	NA	NA
AVF21148.1|1179829_1180996_-	alcohol dehydrogenase GbsB	NA	NA	NA	NA	NA
AVF21149.1|1181138_1181477_+	putative L,D-transpeptidase YkuD	NA	NA	NA	NA	NA
AVF21150.1|1181598_1185012_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21151.1|1185188_1189433_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21152.1|1189687_1190410_+|coat	spore coat polysaccharide biosynthesis protein SpsI	coat	G3MA50	Bacillus_virus	40.9	3.2e-46
AVF21153.1|1190406_1191597_+	putative spore maturation protein	NA	NA	NA	NA	NA
AVF21154.1|1191571_1192708_+	putative spore maturation protein	NA	NA	NA	NA	NA
1191973:1191988	attL	TTACTATACTGATGTT	NA	NA	NA	NA
AVF21155.1|1192707_1193079_+	hypothetical protein	NA	NA	NA	NA	NA
1191973:1191988	attL	TTACTATACTGATGTT	NA	NA	NA	NA
AVF21156.1|1193259_1194813_+	extracellular matrix biosynthesis-like protein	NA	NA	NA	NA	NA
AVF21157.1|1194809_1195904_+	UDP-N-acetylglucosamine 2-epimerase WecB	NA	A0A2P1ELS7	Moumouvirus	44.4	1.9e-87
AVF21158.1|1195893_1196880_+	polysaccharide biosynthesis protein CapD	NA	A0A1V0SAI8	Catovirus	33.7	4.2e-41
AVF21159.1|1196876_1197707_+	putative reductase	NA	NA	NA	NA	NA
AVF21160.1|1197703_1198609_+	UDP-2-acetamido-2,6-dideoxy-hexulose 4-reductase	NA	A0A291LAD7	Escherichia_phage	25.7	1.2e-15
AVF21161.1|1198616_1199336_+	glycosyltransferase-like protein	NA	K7Z8A5	Megavirus	23.6	1.2e-10
AVF21162.1|1199417_1200338_-	NAD dependent epimerase/dehydratase family protein WcaG	NA	E3T4Y8	Cafeteria_roenbergensis_virus	31.2	7.4e-32
AVF21163.1|1200491_1201283_+	glycosyltransferase, group 2 family protein	NA	NA	NA	NA	NA
AVF21164.1|1201287_1202304_+	glycosyl transferase family 2	NA	NA	NA	NA	NA
AVF21165.1|1202290_1203127_+	glycosyltransferase-like protein	NA	NA	NA	NA	NA
AVF21166.1|1203210_1204077_-	3-oxoacyl-[acyl-carrier-protein] synthase 3 protein 2	NA	NA	NA	NA	NA
AVF21167.1|1204492_1205194_+	dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit	NA	NA	NA	NA	NA
AVF21168.1|1205174_1206107_+	dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit	NA	NA	NA	NA	NA
AVF21169.1|1206084_1207557_+	putative permease	NA	NA	NA	NA	NA
AVF21170.1|1207697_1207922_+	spore germination protein GerE	NA	A0A290GJH9	Caldibacillus_phage	70.5	3.7e-14
AVF21171.1|1209765_1210404_-	channel protein, hemolysin III family	NA	NA	NA	NA	NA
AVF21172.1|1211067_1211346_-	DNA-binding protein HU 1	NA	M4SRV7	Rhodobacter_phage	38.3	7.2e-07
AVF21173.1|1211446_1211653_-	cold shock-like protein CspLB	NA	Q9AZD3	Lactococcus_phage	64.6	4.6e-19
AVF21174.1|1212062_1212968_-|integrase	phage integrase family protein	integrase	A0A0A7AR08	Bacillus_phage	55.5	3.5e-87
AVF21175.1|1213322_1213682_-	putative phage DNA-binding protein	NA	NA	NA	NA	NA
AVF21176.1|1213746_1214970_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVF21177.1|1214976_1216488_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
AVF21178.1|1218763_1218982_+	hypothetical protein	NA	NA	NA	NA	NA
1217600:1217615	attR	TTACTATACTGATGTT	NA	NA	NA	NA
AVF21179.1|1219498_1219942_+|transposase	transposase-like protein	transposase	NA	NA	NA	NA
1217600:1217615	attR	TTACTATACTGATGTT	NA	NA	NA	NA
AVF21180.1|1220680_1221904_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVF21181.1|1222153_1223101_-	L-lactate dehydrogenase P	NA	NA	NA	NA	NA
AVF21182.1|1223602_1224337_+	methyltransferase domain protein	NA	NA	NA	NA	NA
AVF21183.1|1224346_1225330_+	beta-lactamase domain protein	NA	NA	NA	NA	NA
AVF21184.1|1225581_1226823_-|integrase	phage integrase-like protein	integrase	A0A0K2CZ62	Paenibacillus_phage	100.0	5.9e-242
AVF21185.1|1226877_1227357_-	hypothetical protein	NA	A0A0K2CZC9	Paenibacillus_phage	100.0	4.4e-89
AVF21186.1|1227362_1228049_-	helix-turn-helix family protein	NA	A0A0K2CZS1	Paenibacillus_phage	99.6	2.7e-124
AVF21187.1|1228156_1228393_+	anaerobic benzoate catabolism transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	100.0	7.4e-37
AVF21188.1|1228618_1229443_+	hypothetical protein	NA	A0A0K2CZE3	Paenibacillus_phage	100.0	4.6e-150
AVF21189.1|1229462_1229852_+	hypothetical protein	NA	A0A0K2CZ66	Paenibacillus_phage	100.0	1.2e-68
AVF21190.1|1229848_1230613_+	phage regulatory protein, Rha family	NA	A0A0K2CZD5	Paenibacillus_phage	100.0	7.5e-131
AVF21191.1|1230609_1230903_+	Helix-turn-helix domain protein	NA	A0A0K2CZS5	Paenibacillus_phage	100.0	4.4e-47
AVF21192.1|1230918_1231557_+	hypothetical protein	NA	A0A0K2CZL5	Paenibacillus_phage	100.0	1.3e-128
AVF21193.1|1231579_1231795_+	hypothetical protein	NA	A0A0K2CZE8	Paenibacillus_phage	100.0	1.6e-30
AVF21194.1|1231791_1231923_+	hypothetical protein	NA	A0A0K2CZ71	Paenibacillus_phage	100.0	5.7e-15
AVF21195.1|1231919_1232177_+	hypothetical protein	NA	A0A0K2CZE0	Paenibacillus_phage	100.0	8.3e-42
AVF21196.1|1232133_1232328_+	hypothetical protein	NA	A0A0K2CZS8	Paenibacillus_phage	100.0	6.9e-33
AVF21197.1|1232311_1232584_+	hypothetical protein	NA	A0A0K2CZL9	Paenibacillus_phage	100.0	2.2e-45
AVF21198.1|1232606_1232825_+	hypothetical protein	NA	A0A0K2CZF4	Paenibacillus_phage	100.0	7.0e-34
AVF21199.1|1232859_1233093_+	hypothetical protein	NA	A0A0K2CZ76	Paenibacillus_phage	100.0	2.8e-36
AVF21200.1|1233085_1233274_+	hypothetical protein	NA	A0A0K2CZE4	Paenibacillus_phage	100.0	5.3e-30
AVF21201.1|1233289_1233679_+	hypothetical protein	NA	A0A0K2CZT2	Paenibacillus_phage	100.0	3.0e-67
AVF21202.1|1233684_1233924_+	hypothetical protein	NA	A0A0K2CZM3	Paenibacillus_phage	100.0	8.2e-36
AVF21203.1|1233938_1234097_+	hypothetical protein	NA	A0A0K2CZG0	Paenibacillus_phage	100.0	5.1e-18
AVF21204.1|1234175_1234295_+	hypothetical protein	NA	A0A0K2CZ81	Paenibacillus_phage	100.0	2.9e-18
AVF21205.1|1234379_1234595_+	hypothetical protein	NA	A0A0K2CZE9	Paenibacillus_phage	98.6	2.7e-30
AVF21206.1|1234601_1235300_+	C-5 cytosine-specific DNA methylase	NA	A0A0K2CZT5	Paenibacillus_phage	100.0	8.1e-124
AVF21207.1|1235308_1235530_+	hypothetical protein	NA	A0A0K2CZM7	Paenibacillus_phage	100.0	3.8e-35
AVF21208.1|1235548_1235899_+	hypothetical protein	NA	A0A0K2CZG5	Paenibacillus_phage	100.0	1.6e-48
AVF21209.1|1235895_1236180_+	transition state regulatory protein AbrB	NA	A0A0K2CZ86	Paenibacillus_phage	100.0	2.0e-49
AVF21210.1|1236212_1236584_+	hypothetical protein	NA	A0A0K2CZF3	Paenibacillus_phage	100.0	5.7e-60
AVF21211.1|1236620_1237331_+	hypothetical protein	NA	A0A0K2CZT8	Paenibacillus_phage	100.0	3.6e-127
AVF21212.1|1237396_1238707_+	putative ATP-binding protein involved in virulence	NA	A0A0K2CZN2	Paenibacillus_phage	100.0	2.1e-181
AVF21213.1|1238709_1239786_+	hypothetical protein	NA	A0A0K2CZH1	Paenibacillus_phage	100.0	5.1e-210
AVF21214.1|1239810_1240317_+	hypothetical protein	NA	A0A0K2CZ91	Paenibacillus_phage	100.0	1.8e-93
AVF21215.1|1240326_1241907_+	UvrABC system protein B	NA	A0A0K2CZF8	Paenibacillus_phage	100.0	4.7e-305
AVF21216.1|1242066_1244373_+	Regulatory protein RepA	NA	A0A0K2CZ75	Paenibacillus_phage	100.0	0.0e+00
AVF21217.1|1244584_1244938_+	hypothetical protein	NA	A0A0K2CZH7	Paenibacillus_phage	100.0	2.1e-64
AVF21218.1|1244927_1245323_+	Holliday junction resolvase	NA	A0A0K2CZ96	Paenibacillus_phage	100.0	2.0e-71
AVF21219.1|1245326_1245548_+	hypothetical protein	NA	A0A0K2CZG3	Paenibacillus_phage	100.0	9.9e-36
AVF21220.1|1245549_1246650_+	RNA polymerase sigma-F factor SigF	NA	A0A0K2CZU8	Paenibacillus_phage	100.0	6.6e-213
AVF21221.1|1246683_1246878_+	hypothetical protein	NA	A0A0K2CZP1	Paenibacillus_phage	100.0	3.2e-30
AVF21222.1|1246874_1247303_+	phage transcriptional regulator, RinA family	NA	A0A0K2CZI2	Paenibacillus_phage	100.0	1.9e-75
AVF21223.1|1247434_1247638_+	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	100.0	4.0e-31
AVF21224.1|1247701_1247926_+	YcfA-like protein	NA	A0A0K2CZG8	Paenibacillus_phage	100.0	1.0e-35
AVF21225.1|1247915_1248326_+	hypothetical protein	NA	A0A0K2CZV4	Paenibacillus_phage	100.0	2.9e-73
AVF21226.1|1248374_1248647_+	hypothetical protein	NA	A0A0K2CZP5	Paenibacillus_phage	100.0	5.9e-46
AVF21227.1|1248880_1249231_+	hypothetical protein	NA	A0A0K2CZA6	Paenibacillus_phage	100.0	9.5e-65
AVF21228.1|1249242_1249587_+	HNH endonuclease	NA	A0A0K2CZA0	Paenibacillus_phage	100.0	4.3e-62
AVF21229.1|1249690_1250005_+|terminase	putative phage terminase, small subunit, P27 family	terminase	A0A0K2CZ94	Paenibacillus_phage	100.0	1.6e-50
AVF21230.1|1249982_1251710_+|terminase	Phage terminase-like protein, large subunit	terminase	A0A0K2CZH9	Paenibacillus_phage	100.0	0.0e+00
AVF21231.1|1251724_1252960_+|portal	phage portal protein, HK97 family	portal	A0A0K2CZB0	Paenibacillus_phage	99.8	3.5e-239
AVF21232.1|1252910_1253666_+|protease	ATP-dependent Clp protease proteolytic subunit ClpP	protease	A0A0K2CZ28	Paenibacillus_phage	100.0	4.6e-133
AVF21233.1|1253662_1254805_+|capsid	phage major capsid protein, HK97 family	capsid	A0A0K2CZ99	Paenibacillus_phage	100.0	3.5e-209
AVF21234.1|1254930_1255194_+	putative phage protein (possible DNA packaging)	NA	A0A0K2CZI4	Paenibacillus_phage	100.0	4.2e-41
AVF21235.1|1255190_1255511_+|head,tail	putative phage head-tail adaptor	head,tail	A0A0K2CZB5	Paenibacillus_phage	100.0	3.0e-57
AVF21236.1|1255507_1255900_+	phage protein, HK97 gp10 family	NA	A0A0K2CZ33	Paenibacillus_phage	100.0	4.3e-66
AVF21237.1|1255896_1256226_+	hypothetical protein	NA	A0A0K2CZA4	Paenibacillus_phage	100.0	4.4e-56
AVF21238.1|1256261_1256858_+|tail	phage major tail protein, phi13 family	tail	A0A0K2CZP8	Paenibacillus_phage	100.0	3.9e-111
AVF21239.1|1256929_1257301_+	hypothetical protein	NA	A0A0K2CZI8	Paenibacillus_phage	100.0	2.9e-64
AVF21240.1|1257534_1261239_+|tail	phage tail tape measure protein, TP901 family, core region	tail	A0A0K2CZ38	Paenibacillus_phage	100.0	0.0e+00
AVF21241.1|1261239_1262106_+	Phage-related protein	NA	A0A0K2CZA8	Paenibacillus_phage	100.0	4.0e-165
AVF21242.1|1262108_1263227_+	hypothetical protein	NA	A0A0K2CZQ1	Paenibacillus_phage	100.0	2.0e-212
AVF21243.1|1263232_1264306_+	phage structural protein	NA	A0A0K2CZJ3	Paenibacillus_phage	99.7	7.1e-212
AVF21244.1|1264315_1264657_+	hypothetical protein	NA	A0A0K2CZC5	Paenibacillus_phage	100.0	9.9e-59
AVF21245.1|1264653_1264815_+	hypothetical protein	NA	A0A0K2CZ44	Paenibacillus_phage	100.0	8.8e-26
AVF21246.1|1264795_1265026_+	hypothetical protein	NA	A0A0K2CZB4	Paenibacillus_phage	100.0	2.0e-34
AVF21247.1|1265022_1265694_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0K2CZQ6	Paenibacillus_phage	100.0	8.3e-134
AVF21248.1|1265705_1266170_+	hypothetical protein	NA	A0A0K2CZJ8	Paenibacillus_phage	100.0	4.5e-86
AVF21249.1|1266189_1266429_+	hypothetical protein	NA	A0A0K2CZD0	Paenibacillus_phage	100.0	1.0e-33
AVF21250.1|1266572_1266752_+	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	98.3	7.1e-24
AVF21251.1|1266834_1267107_-	hypothetical protein	NA	A0A0K2CZB9	Paenibacillus_phage	100.0	4.3e-49
AVF21252.1|1267120_1267393_-	hypothetical protein	NA	A0A0K2CZR1	Paenibacillus_phage	100.0	3.3e-41
AVF21253.1|1267471_1267645_-	hypothetical protein	NA	A0A0K2CZV9	Paenibacillus_phage	100.0	5.6e-26
AVF21254.1|1267622_1267841_-	hypothetical protein	NA	A0A0K2CZK3	Paenibacillus_phage	100.0	6.8e-37
AVF21255.1|1267878_1268082_-	hypothetical protein	NA	A0A0K2CZD3	Paenibacillus_phage	100.0	2.9e-34
AVF21256.1|1268146_1269370_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVF21257.1|1269651_1269804_+	Arc-like DNA binding domain protein	NA	A0A0K2CZC4	Paenibacillus_phage	100.0	5.8e-19
AVF21258.1|1270372_1270852_-	hypothetical protein	NA	A0A0K2CZD8	Paenibacillus_phage	100.0	2.6e-81
AVF21259.1|1271231_1271813_+	transcriptional regulator, TetR family	NA	NA	NA	NA	NA
AVF21260.1|1271880_1272222_+	small multidrug resistance protein	NA	NA	NA	NA	NA
AVF21261.1|1272221_1272536_+	putative membrane protein	NA	NA	NA	NA	NA
AVF21262.1|1273261_1274245_+	phage structural protein	NA	A0A0C5AEQ0	Bacteriophage	75.9	7.1e-49
AVF21263.1|1274244_1274403_+	hypothetical protein	NA	A0A2H4J054	uncultured_Caudovirales_phage	58.7	7.4e-09
AVF21264.1|1274790_1275468_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0K2CYE7	Paenibacillus_phage	95.1	4.8e-129
AVF21265.1|1275477_1275708_+	hypothetical protein	NA	R9W000	Paenibacillus_phage	96.7	5.0e-06
AVF21266.1|1275813_1275927_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21267.1|1275993_1276170_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21268.1|1276192_1276702_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF21269.1|1276719_1277277_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF21270.1|1277426_1277966_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21271.1|1278192_1279032_+	putative lethal factor domain protein	NA	NA	NA	NA	NA
AVF21272.1|1279045_1279318_+	ribonuclease inhibitor-like protein	NA	NA	NA	NA	NA
AVF21273.1|1279689_1280166_-	hypothetical protein	NA	A0A0C5AER4	Bacteriophage	69.3	3.3e-36
AVF21274.1|1280911_1281094_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21275.1|1281324_1282134_-	putative membrane protein	NA	NA	NA	NA	NA
AVF21276.1|1282245_1282761_-	phosphatidylglycerophosphatase A-like protein	NA	G3MBC5	Bacillus_virus	53.6	8.5e-38
AVF21277.1|1282997_1284029_+	spore germination protein GerM	NA	NA	NA	NA	NA
AVF21278.1|1284364_1285120_+	ribonuclease PH	NA	NA	NA	NA	NA
AVF21279.1|1285106_1285739_+	Non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
AVF21280.1|1285806_1287651_-	asparagine ligase	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	24.7	9.9e-28
AVF21281.1|1287747_1288293_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21282.1|1288458_1288935_+	Bacterial membrane flanked domain protein	NA	NA	NA	NA	NA
AVF21283.1|1288927_1290442_+	Bacterial membrane flanked domain protein	NA	NA	NA	NA	NA
AVF21284.1|1290496_1290610_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21285.1|1290623_1290740_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21286.1|1290836_1292057_+	PGA biosynthesis protein CapA	NA	A0A2H4J5Z6	uncultured_Caudovirales_phage	33.9	4.8e-55
AVF21287.1|1292187_1293090_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21288.1|1293268_1294570_+	trigger factor Tig	NA	NA	NA	NA	NA
AVF21289.1|1294734_1295325_+|protease	ATP-dependent Clp protease proteolytic subunit ClpP	protease	A0A223W000	Agrobacterium_phage	56.1	1.2e-56
AVF21290.1|1295340_1296600_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.0	4.5e-149
AVF21291.1|1296704_1297826_+	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase IspG	NA	NA	NA	NA	NA
AVF21292.1|1297876_1298575_-	N-acetylmuramoyl-L-alanine amidase-like protein	NA	NA	NA	NA	NA
AVF21293.1|1298799_1300518_+|protease	Lon protease 2	protease	A0A0R6PGP8	Moraxella_phage	25.1	3.6e-16
AVF21294.1|1300667_1303001_+|protease	Lon protease Lon	protease	A0A0R6PGP8	Moraxella_phage	41.5	4.3e-169
>prophage 11
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	1360120	1428442	4288947	tRNA,transposase,protease	uncultured_Mediterranean_phage(18.75%)	59	NA	NA
AVF21353.1|1360120_1361215_+|tRNA	S-adenosylmethionine:tRNA ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AVF21354.1|1361220_1362357_+|tRNA	queuine tRNA-ribosyltransferase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.4	5.2e-88
AVF21355.1|1362375_1362690_+	preprotein translocase subunit YajC-like protein	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	39.8	1.1e-08
AVF21356.1|1362942_1363332_-	putative membrane protein	NA	NA	NA	NA	NA
AVF21357.1|1363529_1364216_+	putative membrane protein	NA	NA	NA	NA	NA
AVF21358.1|1364263_1365829_-	stage V sporulation protein B	NA	NA	NA	NA	NA
AVF21359.1|1365988_1366321_+	post-transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF21360.1|1366430_1367663_+	protein translocase subunit SecDF	NA	NA	NA	NA	NA
AVF21361.1|1367652_1368633_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	30.9	3.1e-20
AVF21362.1|1368708_1369665_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
AVF21363.1|1369688_1372130_+	Single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.6	1.4e-98
AVF21364.1|1372126_1372639_+	adenine phosphoribosyltransferase Apt	NA	A0A1V0SKE5	Klosneuvirus	47.6	1.2e-31
AVF21365.1|1372705_1373971_-	uracil permease UraA	NA	Q9KX94	Enterobacteria_phage	41.0	1.2e-72
AVF21366.1|1374202_1376389_+	GTP pyrophosphokinase RelA	NA	J9Q7H7	Salmonella_phage	40.1	7.6e-11
AVF21367.1|1376421_1376874_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase Dtd	tRNA	NA	NA	NA	NA
AVF21368.1|1377017_1377194_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21369.1|1377317_1378850_+	oxygen-independent coproporphyrinogen-III oxidase 2	NA	NA	NA	NA	NA
AVF21370.1|1378891_1380841_+	dihydrolipoamide dehydrogenase	NA	NA	NA	NA	NA
AVF21371.1|1380899_1382258_-	putative multidrug resistance protein NorM	NA	NA	NA	NA	NA
AVF21372.1|1382781_1383087_+	transcriptional regulator, HxlR family	NA	NA	NA	NA	NA
AVF21373.1|1383522_1384797_+|tRNA	histidine--tRNA ligase HisS	tRNA	NA	NA	NA	NA
AVF21374.1|1384811_1386599_+|tRNA	aspartate--tRNA ligase AspS	tRNA	A0A2I2L4Y8	Orpheovirus	29.3	2.7e-14
AVF21375.1|1386684_1387431_+	sulfur carrier protein ThiS adenylyltransferase ThiF	NA	NA	NA	NA	NA
AVF21376.1|1387732_1389037_+	putative AAA domain-containing protein YrvN	NA	G3MBE0	Bacillus_virus	47.1	6.4e-98
AVF21377.1|1389190_1390285_-|tRNA	tRNA-specific 2-thiouridylase MnmA	tRNA	NA	NA	NA	NA
AVF21378.1|1390537_1390957_+	HTH-type transcriptional regulator CymR	NA	NA	NA	NA	NA
AVF21379.1|1390973_1392122_+	cysteine desulfurase IscS	NA	Q2XUY6	environmental_halophage	30.0	2.2e-33
AVF21380.1|1392181_1392697_+	PRC-barrel domain protein	NA	NA	NA	NA	NA
AVF21381.1|1392780_1392975_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21382.1|1393165_1393645_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF21383.1|1393671_1394802_+	putative membrane protein	NA	NA	NA	NA	NA
AVF21384.1|1395155_1397780_+|tRNA	alanine--tRNA ligase AlaS	tRNA	A0A1V0SK38	Klosneuvirus	35.7	1.5e-66
AVF21385.1|1397877_1398141_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21386.1|1398161_1398572_+	putative holliday junction resolvase	NA	NA	NA	NA	NA
AVF21387.1|1398583_1398892_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21388.1|1398888_1399185_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21389.1|1399252_1400320_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
AVF21390.1|1400350_1401283_+|protease	putative protease YrrN	protease	NA	NA	NA	NA
AVF21391.1|1401338_1402640_+|protease	putative protease YrrO	protease	Q6DW11	Phage_TP	28.7	7.4e-38
AVF21392.1|1402853_1405001_+	methyl-accepting chemotaxis protein McpC	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	1.8e-09
AVF21393.1|1405138_1407007_+	penicillin-binding protein	NA	NA	NA	NA	NA
AVF21394.1|1407096_1407903_+	octanoyl-[GcvH]:protein N-octanoyltransferase LipL	NA	NA	NA	NA	NA
AVF21395.1|1408321_1408831_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF21396.1|1409148_1409955_+	DSBA-like thioredoxin domain protein	NA	NA	NA	NA	NA
AVF21397.1|1410090_1410222_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21398.1|1410559_1413652_+	phosphohydrolase	NA	A0A126FC74	Lonomia_obliqua_multiple_nucleopolyhedrovirus	27.5	1.0e-37
AVF21399.1|1413694_1414918_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVF21400.1|1415214_1415688_+	Viral enhancin protein	NA	NA	NA	NA	NA
AVF21401.1|1416333_1417062_-	Endo-1,4-beta-xylanase Z precursor	NA	NA	NA	NA	NA
AVF21402.1|1417295_1418360_+	pyruvate dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
AVF21403.1|1418409_1419390_+	pyruvate dehydrogenase E1 component subunit beta	NA	NA	NA	NA	NA
AVF21404.1|1419457_1420756_+	pyruvate dehydrogenase E2 dihydrolipoamide acyltransferase component	NA	NA	NA	NA	NA
AVF21405.1|1420760_1422176_+	dihydrolipoyl dehydrogenase PdhD	NA	NA	NA	NA	NA
AVF21406.1|1422420_1423161_+	glycerophosphodiester phosphodiesterase-like protein	NA	NA	NA	NA	NA
AVF21407.1|1423186_1424164_+	glycerate dehydrogenase HprA	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	33.3	2.9e-26
AVF21408.1|1424150_1425056_-	phospholipid kinase-like protein	NA	NA	NA	NA	NA
AVF21409.1|1425419_1425752_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21410.1|1427531_1427867_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF21411.1|1427884_1428442_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	1500721	1546359	4288947	terminase,integrase,capsid,portal,tail,protease	Paenibacillus_phage(41.82%)	75	1494361:1494375	1521967:1521981
1494361:1494375	attL	ATATTGATCCTCATA	NA	NA	NA	NA
AVF21485.1|1500721_1501954_-|integrase	phage integrase-like protein	integrase	A0A0K2CZ62	Paenibacillus_phage	75.1	4.8e-180
AVF21486.1|1502021_1502747_-	transcriptional regulator-like protein	NA	Q786F1	Bacillus_phage	42.2	1.5e-11
AVF21487.1|1503021_1503126_+	putative phage protein	NA	NA	NA	NA	NA
AVF21488.1|1503370_1504195_+	putative antirepressor, phage associated	NA	A0A0C5AFE7	Paenibacillus_phage	94.7	1.1e-130
AVF21489.1|1504403_1504664_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21490.1|1504640_1504898_-	hypothetical protein	NA	NA	NA	NA	NA
AVF21491.1|1504997_1505375_+	hypothetical protein	NA	R9VW30	Paenibacillus_phage	89.6	3.8e-59
AVF21492.1|1505371_1505593_+	hypothetical protein	NA	R9W0P6	Paenibacillus_phage	90.4	1.6e-30
AVF21493.1|1505730_1505964_+	transition state regulatory protein AbrB	NA	S5MA41	Brevibacillus_phage	49.3	5.8e-18
AVF21494.1|1505993_1506158_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21495.1|1506186_1506942_+	putative prophage antirepressor	NA	A0A0C5AEJ9	Bacteriophage	76.5	1.5e-107
AVF21496.1|1506938_1507247_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21497.1|1507282_1507471_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21498.1|1507467_1508151_+	putative phage anti-repressor	NA	A0A2I7SCV5	Paenibacillus_phage	73.8	1.6e-55
AVF21499.1|1508147_1508354_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21500.1|1508316_1508508_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21501.1|1508544_1508808_+	hypothetical protein	NA	A0A0K2CZE9	Paenibacillus_phage	56.3	2.2e-13
AVF21502.1|1508815_1509247_+	hypothetical protein	NA	A0A0K2CYQ7	Paenibacillus_phage	53.7	1.9e-06
AVF21503.1|1509243_1509822_+	putative sporulation protein YyaC	NA	G3M9W0	Bacillus_virus	41.2	1.2e-24
AVF21504.1|1509891_1511520_+	hypothetical protein	NA	R9TQJ2	Paenibacillus_phage	76.2	5.5e-224
AVF21505.1|1511523_1512348_+	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	62.8	1.9e-87
AVF21506.1|1512328_1513141_+	phage related protein	NA	R9TMF6	Paenibacillus_phage	68.5	2.0e-110
AVF21507.1|1513156_1513489_+	hypothetical protein	NA	A0A0K2CY25	Paenibacillus_phage	98.2	5.3e-57
AVF21508.1|1513537_1514425_+	Replication initiation and membrane attachment	NA	A0A0K2CY85	Paenibacillus_phage	100.0	8.1e-153
AVF21509.1|1514387_1514951_+	phage-related protein	NA	A0A0K2CYY7	Paenibacillus_phage	98.7	1.3e-84
AVF21510.1|1515138_1515249_+	hypothetical protein	NA	A0A0K2CYR7	Paenibacillus_phage	91.7	3.5e-10
AVF21511.1|1515255_1515465_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	86.8	5.0e-29
AVF21512.1|1515466_1515841_+	endodeoxyribonuclease RUS	NA	A0A0K2CYQ8	Paenibacillus_phage	66.9	2.6e-44
AVF21513.1|1515847_1515955_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21514.1|1516031_1516397_+	hypothetical protein	NA	A0A0K2CZ58	Paenibacillus_phage	86.0	1.5e-57
AVF21515.1|1516411_1516933_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21516.1|1516929_1517673_+	adenine-specific DNA methylase-like protein	NA	A0A0E3IAX4	Synechococcus_phage	52.8	3.0e-68
AVF21517.1|1517766_1518075_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21518.1|1518537_1518708_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21519.1|1518676_1519228_+	positive control sigma-like factor	NA	A0A0K2CNQ1	Brevibacillus_phage	59.6	1.4e-46
AVF21520.1|1519349_1519553_+	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	89.6	2.9e-26
AVF21521.1|1519607_1519790_+	hypothetical protein	NA	A0A0K2CZI7	Paenibacillus_phage	60.3	1.6e-10
AVF21522.1|1519824_1519992_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21523.1|1520050_1520791_+|terminase	phage-related terminase-like protein small subunit	terminase	A0A2H4J4R0	uncultured_Caudovirales_phage	47.5	1.4e-44
AVF21524.1|1520783_1522055_+|terminase	phage-related terminase-like protein large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	65.7	9.5e-163
1521967:1521981	attR	ATATTGATCCTCATA	NA	NA	NA	NA
AVF21525.1|1522070_1523534_+|portal	phage portal protein, SPP1 family	portal	A0A0K2CNK4	Brevibacillus_phage	59.3	8.1e-166
AVF21526.1|1523530_1524550_+	NAD(+)--arginine ADP-ribosyltransferase EFV	NA	S5MTV5	Brevibacillus_phage	57.6	1.3e-109
AVF21527.1|1524587_1525211_+	Phage minor structural protein GP20	NA	A0A0K2CP96	Brevibacillus_phage	59.8	1.0e-61
AVF21528.1|1525225_1525582_+	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	73.3	1.8e-42
AVF21529.1|1525597_1526644_+|capsid	putative major capsid protein	capsid	A0A0K2CP76	Brevibacillus_phage	87.2	5.4e-172
AVF21530.1|1526655_1526889_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21531.1|1526869_1527244_+	hypothetical protein	NA	S5MP25	Brevibacillus_phage	55.8	2.1e-30
AVF21532.1|1527245_1527605_+	hypothetical protein	NA	S5M673	Brevibacillus_phage	54.7	6.4e-32
AVF21533.1|1527604_1528015_+	phage protein	NA	A0A0A7RTT0	Clostridium_phage	56.6	1.8e-38
AVF21534.1|1528011_1528422_+	hypothetical protein	NA	S5MUN8	Brevibacillus_phage	46.8	7.8e-26
AVF21535.1|1528414_1528597_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21536.1|1528597_1529929_+	phage protein	NA	A0A0A7RTT5	Clostridium_phage	48.4	4.2e-113
AVF21537.1|1529930_1530128_+	putative phage protein	NA	S5MA61	Brevibacillus_phage	61.0	5.6e-06
AVF21538.1|1530124_1530394_+	putative phage protein	NA	A0A0K2CNG3	Brevibacillus_phage	63.6	3.5e-27
AVF21539.1|1530420_1530846_+	phage protein	NA	X5JAB6	Clostridium_phage	44.8	1.6e-26
AVF21540.1|1530845_1531016_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21541.1|1531069_1533178_+|tail	putative tail length tape measure protein	tail	A0A0K2CP22	Brevibacillus_phage	42.5	2.1e-143
AVF21542.1|1533174_1533813_+	putative phage cell wall hydrolase	NA	S5MUH0	Brevibacillus_phage	49.1	6.4e-51
AVF21543.1|1533817_1534801_+	putative phage cell wall hydrolase	NA	S5MNC9	Brevibacillus_phage	56.2	9.7e-107
AVF21544.1|1534800_1535043_+	hypothetical protein	NA	A0A0A8WJ65	Clostridium_phage	42.7	1.4e-11
AVF21545.1|1535045_1535456_+	phage protein	NA	A0A0A7RTU4	Clostridium_phage	45.5	2.7e-26
AVF21546.1|1535448_1536525_+|capsid	phage capsid assembly-like protein	capsid	A0A0K2CP27	Brevibacillus_phage	51.8	6.0e-102
AVF21547.1|1536517_1537099_+	putative phage protein	NA	S5MA71	Brevibacillus_phage	45.9	4.8e-37
AVF21548.1|1537095_1537374_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21549.1|1537377_1538781_+	phage structural protein	NA	S5MNY5	Brevibacillus_phage	37.5	5.4e-10
AVF21550.1|1538793_1539189_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21551.1|1539181_1539340_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21552.1|1539374_1539614_+	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	98.7	1.1e-35
AVF21553.1|1539610_1540291_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0C5AEW3	Paenibacillus_phage	95.1	2.1e-129
AVF21554.1|1540297_1540762_+	hypothetical protein	NA	A0A0K2CZJ8	Paenibacillus_phage	71.4	6.9e-63
AVF21555.1|1540779_1541058_+	hypothetical protein	NA	R9VWV2	Paenibacillus_phage	80.6	4.2e-39
AVF21556.1|1541070_1541313_+	hypothetical protein	NA	A0A0K2CZD0	Paenibacillus_phage	97.4	4.3e-32
AVF21557.1|1541625_1542738_+	AAA ATPase	NA	A0A1S5V1G7	Saudi_moumouvirus	28.8	1.5e-15
AVF21558.1|1542757_1545037_+|protease	type VII secretion-associated serine protease mycosin	protease	NA	NA	NA	NA
AVF21559.1|1545291_1546359_+	putative phage DNA-binding protein	NA	A0A0A7RTT7	Clostridium_phage	33.9	2.2e-48
>prophage 13
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	1718911	1730708	4288947	transposase	Paenibacillus_phage(66.67%)	19	NA	NA
AVF21715.1|1718911_1719328_-	Metallopeptidase ImmA	NA	A0A2P1JU12	Anoxybacillus_phage	37.0	4.6e-18
AVF21716.1|1719359_1719770_-	helix-turn-helix family protein	NA	F8J1E0	Lactobacillus_phage	38.8	6.6e-09
AVF21717.1|1720302_1720812_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF21718.1|1720829_1721387_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF21719.1|1721941_1722442_+	hypothetical protein	NA	R9VWV6	Paenibacillus_phage	31.7	7.1e-05
AVF21720.1|1722778_1723327_+	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	81.4	1.3e-73
AVF21721.1|1723663_1723876_-	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	77.3	7.1e-23
AVF21722.1|1723879_1724149_-	hypothetical protein	NA	A0A2I7SC25	Paenibacillus_phage	97.7	7.6e-38
AVF21723.1|1724145_1724337_-	hypothetical protein	NA	A0A2I7SC20	Paenibacillus_phage	98.4	1.6e-29
AVF21724.1|1724833_1725055_+	putative transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	44.4	3.8e-11
AVF21725.1|1725791_1725905_-	hypothetical protein	NA	NA	NA	NA	NA
AVF21726.1|1725940_1726585_-	hypothetical protein	NA	NA	NA	NA	NA
AVF21727.1|1726847_1726967_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21728.1|1727013_1727133_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21729.1|1727209_1727413_-	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	88.1	5.0e-26
AVF21730.1|1727602_1727992_-	hypothetical protein	NA	A0A0K2CZD8	Paenibacillus_phage	49.3	6.5e-06
AVF21731.1|1728141_1728474_+	hypothetical protein	NA	A0A2I7SCG0	Paenibacillus_phage	90.5	8.5e-31
AVF21732.1|1729098_1729227_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21733.1|1729334_1730708_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7SC76	Paenibacillus_phage	88.5	3.7e-27
>prophage 14
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	1768139	1775584	4288947	transposase	Paenibacillus_phage(87.5%)	11	NA	NA
AVF21780.1|1768139_1769351_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.0	1.8e-224
AVF21781.1|1769396_1769876_+	Epsilon-toxin type B precursor	NA	NA	NA	NA	NA
AVF21782.1|1770443_1770713_-	hypothetical protein	NA	A0A2I7SC25	Paenibacillus_phage	97.7	7.6e-38
AVF21783.1|1770709_1770901_-	hypothetical protein	NA	A0A2I7SC20	Paenibacillus_phage	98.4	1.6e-29
AVF21784.1|1771355_1771571_+	putative transcriptional regulator	NA	A0A2I7SC05	Paenibacillus_phage	98.6	4.5e-33
AVF21785.1|1772032_1772491_-	hypothetical protein	NA	A0A0C5AER4	Bacteriophage	39.6	7.1e-20
AVF21786.1|1772718_1773429_+	hypothetical protein	NA	A0A0K2CYM6	Paenibacillus_phage	39.9	7.9e-34
AVF21787.1|1773379_1773901_+	putative accessory genes regulator protein	NA	A0A0K2CZ30	Paenibacillus_phage	40.5	6.2e-20
AVF21788.1|1773942_1774452_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF21789.1|1774469_1775027_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF21790.1|1775197_1775584_+	LytTr DNA-binding domain protein	NA	A0A0K2CYP4	Paenibacillus_phage	50.0	3.6e-25
>prophage 15
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	1784371	1842342	4288947	capsid,portal,transposase,lysis,tail,holin	Paenibacillus_phage(95.95%)	84	NA	NA
AVF21800.1|1784371_1785025_-	helix-turn-helix family protein	NA	A0A2I7SCV6	Paenibacillus_phage	66.0	1.7e-70
AVF21801.1|1785193_1785406_+	helix-turn-helix family protein	NA	A0A1X9I583	Streptococcus_phage	61.7	1.1e-12
AVF21802.1|1785452_1785743_+	DNA binding domain, excisionase family	NA	A0A2I7SC15	Paenibacillus_phage	81.1	5.3e-37
AVF21803.1|1785964_1786066_-	hypothetical protein	NA	NA	NA	NA	NA
AVF21804.1|1786191_1786818_+	hypothetical protein	NA	A0A0K2CZL5	Paenibacillus_phage	72.6	1.9e-87
AVF21805.1|1786839_1787016_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21806.1|1787012_1787180_+	hypothetical protein	NA	A0A0N9SIN5	Paenibacillus_phage	90.6	8.3e-19
AVF21807.1|1787184_1787586_+	hypothetical protein	NA	A0A0N7GFE9	Paenibacillus_phage	63.5	9.3e-32
AVF21808.1|1787824_1788196_+	hypothetical protein	NA	A0A0N9SJV6	Paenibacillus_phage	39.8	1.2e-17
AVF21809.1|1788253_1788631_+	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	70.9	4.3e-39
AVF21810.1|1788590_1788983_+	hypothetical protein	NA	A0A0N9SSX1	Paenibacillus_phage	90.8	6.7e-59
AVF21811.1|1788999_1789842_+	hypothetical protein	NA	A0A0N9RZE9	Paenibacillus_phage	62.0	8.4e-83
AVF21812.1|1789854_1789977_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21813.1|1789979_1790507_+	hypothetical protein	NA	A0A0N9SJU7	Paenibacillus_phage	83.4	3.3e-77
AVF21814.1|1790517_1790784_+	hypothetical protein	NA	A0A0N9RRC8	Paenibacillus_phage	95.5	2.7e-43
AVF21815.1|1790791_1791562_+	putative DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	95.3	6.6e-143
AVF21816.1|1791558_1792935_+	replicative DNA helicase	NA	A0A0N9SIP5	Paenibacillus_phage	96.9	1.1e-254
AVF21817.1|1792947_1793898_+	DNA primase	NA	A0A0N9S7Y2	Paenibacillus_phage	88.9	4.9e-164
AVF21818.1|1793950_1794514_+	hypothetical protein	NA	A0A0N9SGJ9	Paenibacillus_phage	96.8	2.2e-87
AVF21819.1|1794576_1795101_+	hypothetical protein	NA	A0A0N9RTM1	Paenibacillus_phage	69.5	7.1e-56
AVF21820.1|1795194_1795932_+	hypothetical protein	NA	A0A0N9SJW5	Paenibacillus_phage	95.5	8.2e-135
AVF21821.1|1796104_1796320_+	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	80.6	1.0e-24
AVF21822.1|1796316_1796436_+	hypothetical protein	NA	A0A0N7GFF1	Paenibacillus_phage	74.4	1.8e-07
AVF21823.1|1796464_1796878_+	hypothetical protein	NA	A0A0N9RZF9	Paenibacillus_phage	96.4	6.6e-73
AVF21824.1|1796865_1797072_+	hypothetical protein	NA	A0A0N9SJW4	Paenibacillus_phage	78.3	1.3e-24
AVF21825.1|1797083_1797893_+	hypothetical protein	NA	A0A0N9SIQ5	Paenibacillus_phage	76.9	6.5e-109
AVF21826.1|1799691_1800024_+	hypothetical protein	NA	A0A0N9SGL0	Paenibacillus_phage	86.4	6.7e-52
AVF21827.1|1800013_1801180_+	DNA-directed DNA polymerase	NA	A0A0N9RTM8	Paenibacillus_phage	91.2	2.3e-208
AVF21828.1|1801180_1801378_+	hypothetical protein	NA	A0A0N7GFF2	Paenibacillus_phage	100.0	6.6e-31
AVF21829.1|1801374_1801989_+	DNA polymerase III PolC-like protein	NA	A0A0N9SJX9	Paenibacillus_phage	95.1	4.1e-103
AVF21830.1|1802021_1802993_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	94.1	1.0e-156
AVF21831.1|1803270_1803501_+	crossover junction endodeoxyribonuclease	NA	A0A0N9ST03	Paenibacillus_phage	100.0	1.6e-36
AVF21832.1|1803497_1803671_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21833.1|1803738_1804077_+	deoxyuridine 5'-triphosphate nucleotidohydrolase Dut	NA	A0A0N9SJY5	Paenibacillus_phage	100.0	2.7e-56
AVF21834.1|1804106_1804268_+	hypothetical protein	NA	A0A0N9RRE2	Paenibacillus_phage	100.0	1.0e-26
AVF21835.1|1804318_1804540_+	hypothetical protein	NA	A0A0N9SIR4	Paenibacillus_phage	100.0	8.4e-35
AVF21836.1|1804554_1804944_+	SprT-like family protein	NA	A0A0N7GFF3	Paenibacillus_phage	100.0	3.1e-72
AVF21837.1|1804945_1805263_+	Antitoxin MazE	NA	A0A0N9S804	Paenibacillus_phage	100.0	1.3e-57
AVF21838.1|1805256_1805721_+	putative prophage protein	NA	A0A0N9SGM1	Paenibacillus_phage	100.0	1.3e-88
AVF21839.1|1805724_1806600_+	hypothetical protein	NA	A0A0N9RTN7	Paenibacillus_phage	100.0	2.0e-167
AVF21840.1|1806583_1807144_+	deoxynucleoside monophosphate kinase	NA	A0A0N9SJZ0	Paenibacillus_phage	100.0	1.8e-105
AVF21841.1|1807100_1807484_-	hypothetical protein	NA	A0A0N9SHP7	Paenibacillus_phage	99.2	3.9e-72
AVF21842.1|1807610_1808777_+	Modification methylase TaqI	NA	A0A0N9ST12	Paenibacillus_phage	100.0	1.5e-234
AVF21843.1|1808790_1810068_+	modification methylase	NA	A0A1P8CX25	Bacillus_phage	39.7	1.5e-75
AVF21844.1|1810055_1810463_+	hypothetical protein	NA	A0A0N9RZI0	Paenibacillus_phage	84.4	8.5e-57
AVF21845.1|1810452_1810905_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	75.3	1.4e-60
AVF21846.1|1812101_1812494_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21847.1|1812790_1814014_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVF21848.1|1814194_1814413_+	hypothetical protein	NA	A0A0N9SGN2	Paenibacillus_phage	94.4	6.8e-29
AVF21849.1|1814402_1814570_+	hypothetical protein	NA	A0A0N9RTP7	Paenibacillus_phage	76.4	6.6e-16
AVF21850.1|1814571_1814991_+	putative phage-associated protein	NA	A0A0N9SJZ8	Paenibacillus_phage	95.7	3.9e-73
AVF21851.1|1814980_1815370_+	hypothetical protein	NA	A0A0N7GFF5	Paenibacillus_phage	100.0	1.5e-66
AVF21852.1|1816261_1816513_+	hypothetical protein	NA	NA	NA	NA	NA
AVF21853.1|1816505_1816685_+	hypothetical protein	NA	A0A0N9SSS1	Paenibacillus_phage	91.5	1.3e-17
AVF21854.1|1818575_1820087_+|portal	phage portal protein, SPP1 family	portal	A0A0N7GFE4	Paenibacillus_phage	93.9	4.9e-251
AVF21855.1|1820083_1820947_+	putative phage protein	NA	A0A0N9SJR1	Paenibacillus_phage	83.6	3.8e-131
AVF21856.1|1821034_1821688_+	Phage minor structural protein GP20	NA	A0A0N9SIL0	Paenibacillus_phage	81.0	4.1e-61
AVF21857.1|1821743_1822679_+|capsid	major capsid protein	capsid	A0A0N9S7T7	Paenibacillus_phage	79.4	2.7e-143
AVF21858.1|1822693_1823077_+	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	94.5	2.2e-62
AVF21859.1|1823077_1823410_+	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	99.1	4.1e-57
AVF21860.1|1823406_1823832_+	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	90.8	2.9e-68
AVF21861.1|1823828_1824203_+	hypothetical protein	NA	A0A0N7GFE5	Paenibacillus_phage	95.2	1.6e-62
AVF21862.1|1824215_1824785_+	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	70.5	3.7e-66
AVF21863.1|1824851_1825109_+	hypothetical protein	NA	A0A0K2CZ43	Paenibacillus_phage	51.9	8.1e-13
AVF21864.1|1825111_1825489_+	hypothetical protein	NA	A0A0N9SST2	Paenibacillus_phage	92.8	6.6e-56
AVF21865.1|1825461_1825839_+	hypothetical protein	NA	A0A0N9RZB8	Paenibacillus_phage	72.0	5.3e-21
AVF21866.1|1825866_1826466_+|tail	putative phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	97.0	1.3e-82
AVF21867.1|1826466_1828761_+|tail	putative phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	45.6	1.3e-149
AVF21868.1|1828762_1830220_+|tail	phage tail component	tail	A0A0N9RRA9	Paenibacillus_phage	96.3	5.8e-281
AVF21869.1|1830222_1832544_+	phage minor structural protein	NA	A0A0N9SIL8	Paenibacillus_phage	97.5	0.0e+00
AVF21870.1|1832540_1832978_+	phage-related protein	NA	A0A0N9S7V6	Paenibacillus_phage	98.6	8.8e-76
AVF21871.1|1832965_1833382_+|holin,lysis	toxin secretion/phage lysis holin	holin,lysis	A0A0N7GFE6	Paenibacillus_phage	100.0	1.8e-70
AVF21872.1|1833374_1833629_+	sporulation-specific N-acetylmuramoyl-L-alanine amidase CwlC	NA	A0A0N9SGH1	Paenibacillus_phage	100.0	5.3e-41
AVF21873.1|1833702_1834179_+	sporulation-specific N-acetylmuramoyl-L-alanine amidase CwlC	NA	A0A0N9SGH1	Paenibacillus_phage	98.7	9.8e-89
AVF21874.1|1834401_1834677_-	hypothetical protein	NA	A0A0K2CZR1	Paenibacillus_phage	60.9	1.2e-19
AVF21875.1|1834695_1835709_-	hypothetical protein	NA	NA	NA	NA	NA
AVF21876.1|1835848_1836094_+	putative transcriptional regulator	NA	NA	NA	NA	NA
AVF21877.1|1836134_1836506_-	hypothetical protein	NA	A0A2I7SCF4	Paenibacillus_phage	79.5	3.5e-49
AVF21878.1|1836509_1836860_-	phage protein	NA	A0A2I7SCF2	Paenibacillus_phage	84.5	2.5e-49
AVF21879.1|1836906_1837332_-	hypothetical protein	NA	NA	NA	NA	NA
AVF21880.1|1837505_1838132_-	hypothetical protein	NA	A0A0N9SJT2	Paenibacillus_phage	59.5	2.0e-36
AVF21881.1|1838205_1838592_-	hypothetical protein	NA	A0A0N9SIM5	Paenibacillus_phage	96.1	1.0e-64
AVF21882.1|1838903_1840646_+	type VI secretion system FHA domain protein	NA	NA	NA	NA	NA
AVF21883.1|1840785_1842342_+	ABC efflux transporter-like protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	4.4e-53
>prophage 16
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	1970356	2020835	4288947	integrase,coat,tRNA,transposase,protease,bacteriocin	Paenibacillus_phage(42.86%)	53	1999045:1999059	2025655:2025669
AVF22015.1|1970356_1971646_-|tRNA	seryl-tRNA ligase SerS	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	31.5	4.8e-53
AVF22016.1|1972583_1974026_+	lysine-specific permease LysP	NA	NA	NA	NA	NA
AVF22017.1|1974364_1974631_+|coat	inner spore coat-like protein	coat	NA	NA	NA	NA
AVF22018.1|1975018_1975642_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22019.1|1975750_1975969_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22020.1|1976533_1976650_+	short chain dehydrogenase	NA	NA	NA	NA	NA
AVF22021.1|1976778_1977675_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AVF22022.1|1977834_1979040_+	efflux transporter-like protein	NA	A0A2H4PQR6	Staphylococcus_phage	45.1	3.1e-99
AVF22023.1|1979111_1979783_-	Yip1 domain protein	NA	NA	NA	NA	NA
AVF22024.1|1979799_1980108_-	integral membrane protein	NA	NA	NA	NA	NA
AVF22025.1|1980310_1980517_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22026.1|1980517_1981270_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.8	3.9e-23
AVF22027.1|1981257_1982946_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22028.1|1983070_1983286_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
AVF22029.1|1983710_1984145_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF22030.1|1984218_1984866_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22031.1|1985021_1985285_+	uridylate kinase-like protein	NA	NA	NA	NA	NA
AVF22032.1|1985226_1985394_+	Uridylate kinase	NA	NA	NA	NA	NA
AVF22033.1|1985508_1986246_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22034.1|1986531_1987821_+	Hemolysin C	NA	NA	NA	NA	NA
AVF22035.1|1988253_1989156_+	phenazine biosynthesis protein PhzF	NA	NA	NA	NA	NA
AVF22036.1|1989336_1989939_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22037.1|1990023_1990476_+	putative disulfide bond formation protein	NA	NA	NA	NA	NA
AVF22038.1|1990606_1991293_+	putative disulfide bond formation protein	NA	NA	NA	NA	NA
AVF22039.1|1991381_1992215_+	HAD-superfamily hydrolase	NA	NA	NA	NA	NA
AVF22040.1|1992423_1992858_+	acetyltransferase, GNAT family	NA	NA	NA	NA	NA
AVF22041.1|1993453_1994134_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AVF22042.1|1994232_1995264_-	HTH-type transcriptional regulator MalR	NA	NA	NA	NA	NA
AVF22043.1|1995663_1996947_+	maltose/maltodextrin-binding protein MalX	NA	NA	NA	NA	NA
AVF22044.1|1998268_1999114_+	putative arabinogalactan oligomer transport system permease protein GanQ	NA	NA	NA	NA	NA
1999045:1999059	attL	TACGCTGCTCTTTAT	NA	NA	NA	NA
AVF22045.1|1999179_1999596_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22046.1|1999780_2000275_+	spermine/spermidine acetyltransferase	NA	NA	NA	NA	NA
AVF22047.1|2000341_2001415_+	putative nitronate monooxygenase	NA	NA	NA	NA	NA
AVF22048.1|2001646_2002936_+	hydroxylamine reductase Hcp	NA	NA	NA	NA	NA
AVF22049.1|2003053_2003980_-	UDP-N-acetylenolpyruvoylglucosamine reductase MurB	NA	NA	NA	NA	NA
AVF22050.1|2004192_2004417_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22051.1|2004905_2005268_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22052.1|2005304_2006780_-	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
AVF22053.1|2006970_2007924_+	D-alanyl-D-alanine carboxypeptidase DacB	NA	A0A1P8VVG5	Erythrobacter_phage	30.6	9.7e-11
AVF22054.1|2008002_2008176_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22055.1|2008287_2009166_-	D-tagatose-1,6-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
AVF22056.1|2009223_2010657_-	PTS system fructose-specific EIIABC component FruA	NA	NA	NA	NA	NA
AVF22057.1|2010656_2011586_-	1-phosphofructokinase FruK	NA	NA	NA	NA	NA
AVF22058.1|2011756_2012539_+	phosphosugar-binding transcriptional regulator	NA	NA	NA	NA	NA
AVF22059.1|2012621_2013179_+	MutX-like protein	NA	NA	NA	NA	NA
AVF22060.1|2013173_2013578_-	small multidrug efflux transporter-like protein	NA	NA	NA	NA	NA
AVF22061.1|2013570_2013903_-	small multidrug efflux transporter-like protein	NA	NA	NA	NA	NA
AVF22062.1|2013908_2014448_-	transcriptional regulator, TetR family	NA	NA	NA	NA	NA
AVF22063.1|2015485_2016244_-|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
AVF22064.1|2016975_2017668_-|integrase	putative integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	57.3	4.1e-59
AVF22065.1|2017722_2018247_-	helix-turn-helix protein	NA	A0A0K2CZC9	Paenibacillus_phage	79.1	1.9e-45
AVF22066.1|2018386_2018560_-	helix-turn-helix domain protein	NA	A0A0K2CZS1	Paenibacillus_phage	91.3	2.9e-14
AVF22067.1|2018759_2020835_+|protease	minor extracellular protease Epr	protease	NA	NA	NA	NA
2025655:2025669	attR	TACGCTGCTCTTTAT	NA	NA	NA	NA
>prophage 17
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	2192155	2301300	4288947	integrase,transposase,coat,protease	Salmonella_phage(18.18%)	94	2221533:2221571	2225865:2225903
AVF22190.1|2192155_2192914_+|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
AVF22191.1|2192935_2193835_+	phosphoenolpyruvate phosphomutase BcpB	NA	NA	NA	NA	NA
AVF22192.1|2193831_2194977_+	phosphonopyruvate decarboxylase BcpC	NA	NA	NA	NA	NA
AVF22193.1|2194991_2196137_+	putative cysteine desulfurase Csd	NA	NA	NA	NA	NA
AVF22194.1|2196117_2196861_+|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
AVF22195.1|2197071_2198268_+	acetylornithine aminotransferase ArgD	NA	A0A1V0SKB7	Klosneuvirus	27.6	1.2e-26
AVF22196.1|2198399_2199281_+	agmatinase SpeB	NA	A0A1V0SJM8	Klosneuvirus	35.7	2.0e-26
AVF22197.1|2199667_2200378_+	iron-regulated protein D	NA	NA	NA	NA	NA
AVF22198.1|2200436_2201771_+	iron-regulated protein D	NA	NA	NA	NA	NA
AVF22199.1|2201843_2202752_+	iron compound ABC transporter, iron compound-binding protein	NA	NA	NA	NA	NA
AVF22200.1|2202787_2203771_+	iron compound ABC transporter, permease protein	NA	NA	NA	NA	NA
AVF22201.1|2203760_2204510_+	iron compound ABC transporter, ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.1	8.7e-15
AVF22202.1|2204553_2205327_+	sortase, SrtB family	NA	NA	NA	NA	NA
AVF22203.1|2205411_2205729_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AVF22204.1|2205795_2205954_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22205.1|2206266_2207385_+	citrate synthase 2	NA	NA	NA	NA	NA
AVF22206.1|2207410_2208826_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AVF22207.1|2208863_2209781_+	phosphonopyruvate hydrolase PphA	NA	NA	NA	NA	NA
AVF22208.1|2210192_2210732_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22209.1|2210835_2211420_-	Aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AVF22210.1|2211488_2211728_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22211.1|2211885_2212128_-	resolvase	NA	NA	NA	NA	NA
AVF22212.1|2213195_2213795_-	transcriptional regulator, Acidobacterial, PadR-family	NA	NA	NA	NA	NA
AVF22213.1|2213909_2214410_+	Phenolic acid decarboxylase PadC	NA	NA	NA	NA	NA
AVF22214.1|2214791_2215181_+	resolvase	NA	A0A1B0V7I5	Salmonella_phage	79.2	8.4e-46
AVF22215.1|2215183_2215687_+|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.9	9.2e-45
AVF22216.1|2215738_2218159_+|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	66.5	0.0e+00
AVF22217.1|2218331_2218631_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22218.1|2218590_2219070_+	putative cell-wall hydrolase	NA	NA	NA	NA	NA
AVF22219.1|2219493_2219838_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22220.1|2220005_2221502_+	type II restriction m6 adenine DNA methyltransferase, Alw26I/Eco31I/Esp3I family	NA	A0A2L1IV91	Escherichia_phage	54.4	3.4e-143
AVF22221.1|2221494_2221611_+	hypothetical protein	NA	NA	NA	NA	NA
2221533:2221571	attL	GGGGTATCGCCAACCAAATGACATAAAACCCACGCTAAG	NA	NA	NA	NA
AVF22222.1|2221674_2224590_-|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	40.9	3.5e-205
AVF22223.1|2224868_2225567_+|integrase	phage integrase family protein	integrase	A0A1B1P7C7	Bacillus_phage	43.2	1.7e-44
AVF22224.1|2225596_2225764_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22225.1|2226119_2226818_+	hypothetical protein	NA	A0A0P0ZG22	Escherichia_phage	75.0	7.1e-104
2225865:2225903	attR	CTTAGCGTGGGTTTTATGTCATTTGGTTGGCGATACCCC	NA	NA	NA	NA
AVF22226.1|2227025_2227952_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22227.1|2228469_2229000_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF22228.1|2228996_2229509_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF22229.1|2231167_2232067_-	transcriptional regulator, LysR family	NA	A0A2P0ZL89	Lactobacillus_phage	25.4	2.1e-07
AVF22230.1|2232167_2232593_+	putative transcriptional regulator	NA	NA	NA	NA	NA
AVF22231.1|2233685_2234885_+	putative malonyl CoA-acyl carrier protein transacylase	NA	NA	NA	NA	NA
AVF22232.1|2234915_2246219_+	putative non-ribosomal peptide ligase/ polyketide synthase hybrid	NA	A0A2K9KZV5	Tupanvirus	26.8	3.5e-107
AVF22233.1|2246323_2247007_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	97.8	1.5e-119
AVF22234.1|2247144_2247897_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	1.9e-134
AVF22235.1|2248121_2250731_+	putative phosphoenolpyruvate synthase Pps	NA	A0A1V0SGR7	Hokovirus	35.3	1.2e-42
AVF22236.1|2250926_2251235_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22237.1|2251730_2252705_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22238.1|2252748_2253399_-	putative ABC transporter	NA	A0A2H4PQG7	Staphylococcus_phage	38.3	3.4e-31
AVF22239.1|2253411_2254215_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22240.1|2254211_2255018_-	putative membrane protein	NA	NA	NA	NA	NA
AVF22241.1|2255004_2255817_-	putative membrane protein	NA	NA	NA	NA	NA
AVF22242.1|2255884_2256352_-	putative membrane protein	NA	NA	NA	NA	NA
AVF22243.1|2256653_2257373_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22244.1|2258348_2259056_-	trehalose operon transcriptional repressor	NA	NA	NA	NA	NA
AVF22245.1|2259086_2260496_-	Aryl-phospho-beta-D-glucosidase BglC	NA	A0A0B5JD41	Pandoravirus	29.7	1.2e-57
AVF22246.1|2260809_2261394_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVF22247.1|2261566_2262148_+	fatty acid metabolism regulator protein FadR	NA	NA	NA	NA	NA
AVF22248.1|2262170_2263373_+	multidrug resistance protein	NA	NA	NA	NA	NA
AVF22249.1|2263531_2264914_-	putative transporter	NA	NA	NA	NA	NA
AVF22250.1|2265554_2265929_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22251.1|2266282_2267914_-	2-hydroxyglutaryl-CoA dehydratase, D-component	NA	NA	NA	NA	NA
AVF22252.1|2267946_2271417_-	CoA-substrate-specific enzyme activase	NA	NA	NA	NA	NA
AVF22253.1|2271482_2271911_-	magnesium transporter-like protein	NA	NA	NA	NA	NA
AVF22254.1|2272429_2272588_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22255.1|2273075_2273717_+	colanic acid/biofilm transcriptional regulator	NA	NA	NA	NA	NA
AVF22256.1|2273976_2274741_-	3-oxoacyl-[acyl-carrier-protein] reductase FabG	NA	A0A0N9R355	Chrysochromulina_ericina_virus	35.2	7.5e-30
AVF22257.1|2275704_2275827_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22258.1|2275823_2276642_-	putative MFS-type transporter	NA	NA	NA	NA	NA
AVF22259.1|2276980_2277475_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22260.1|2277730_2278036_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22261.1|2278441_2279053_-	hypothetical protein	NA	A0A2K9L5M2	Tupanvirus	35.4	1.2e-22
AVF22262.1|2279064_2279949_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22263.1|2280817_2281915_-	Nitroreductase family protein	NA	NA	NA	NA	NA
AVF22264.1|2282043_2282799_-|protease	putative serine protease HtrA	protease	W5SAB9	Pithovirus	34.7	1.2e-11
AVF22265.1|2283267_2283531_-	Cytochrome P450(BM-3)	NA	NA	NA	NA	NA
AVF22266.1|2283643_2284273_+	Purine efflux pump PbuE	NA	NA	NA	NA	NA
AVF22267.1|2284341_2284827_+	Purine efflux pump PbuE	NA	NA	NA	NA	NA
AVF22268.1|2284849_2285608_-	putative transcriptional regulator	NA	NA	NA	NA	NA
AVF22269.1|2285786_2286518_+	exodeoxyribonuclease III (xth)	NA	NA	NA	NA	NA
AVF22270.1|2286555_2288013_+	type I phosphodiesterase/nucleotide pyrophosphatase	NA	NA	NA	NA	NA
AVF22271.1|2288096_2288660_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22272.1|2288784_2289681_-	CDF family cation diffusion facilitator	NA	NA	NA	NA	NA
AVF22273.1|2290318_2290465_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22274.1|2290663_2291032_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22275.1|2291222_2291957_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVF22276.1|2292012_2292798_-	N-acetylmuramic acid deacetylase-like protein	NA	NA	NA	NA	NA
AVF22277.1|2292911_2294429_-	membrane protein	NA	NA	NA	NA	NA
AVF22278.1|2294507_2295626_-	two-component response regulator	NA	NA	NA	NA	NA
AVF22279.1|2296097_2296370_-	ribonuclease inhibitor-like protein	NA	NA	NA	NA	NA
AVF22280.1|2296390_2296810_-	ribonuclease	NA	NA	NA	NA	NA
AVF22281.1|2297333_2298764_-	hydrolase-like protein	NA	A0A2N9QVZ6	Dishui_lake_phycodnavirus	36.6	1.3e-06
AVF22282.1|2298838_2300038_-	NAD(FAD)-dependent dehydrogenase	NA	NA	NA	NA	NA
AVF22283.1|2300244_2301300_-|transposase	transposase	transposase	A0A1P8DJG9	Virus_Rctr71	29.6	2.5e-15
>prophage 18
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	2326480	2333194	4288947	transposase	Paenibacillus_phage(83.33%)	9	NA	NA
AVF22307.1|2326480_2326987_-	hypothetical protein	NA	R9VWV6	Paenibacillus_phage	33.3	8.5e-06
AVF22308.1|2328049_2328193_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22309.1|2328179_2329538_-	putative DNA-binding protein	NA	A0A0K2CP77	Brevibacillus_phage	34.7	2.0e-73
AVF22310.1|2329811_2330357_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22311.1|2330328_2330547_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22312.1|2330654_2330897_-	hypothetical protein	NA	A0A2I7SC00	Paenibacillus_phage	91.2	2.6e-29
AVF22313.1|2330906_2331416_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7SCE7	Paenibacillus_phage	93.3	2.0e-79
AVF22314.1|2331544_2331817_-	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	94.7	1.6e-30
AVF22315.1|2331970_2333194_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 19
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	2477261	2503749	4288947	transposase	Paenibacillus_phage(77.78%)	27	NA	NA
AVF22430.1|2477261_2477942_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AVF22431.1|2478115_2478820_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	51.1	1.1e-56
AVF22432.1|2478969_2480697_-	glycine betaine transport system permease protein OpuAB	NA	NA	NA	NA	NA
AVF22433.1|2480693_2481893_-	glycine betaine transport ATP-binding protein OpuAA	NA	G3M9Y6	Bacillus_virus	39.5	1.8e-30
AVF22434.1|2482192_2482771_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF22435.1|2483037_2484522_+	putative aldehyde dehydrogenase DhaS	NA	NA	NA	NA	NA
AVF22436.1|2484571_2485744_-	spore autolysin-like protein	NA	NA	NA	NA	NA
AVF22437.1|2485759_2485939_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22438.1|2485989_2486100_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22439.1|2486896_2488147_-	carbohydrate kinase, YjeF related protein	NA	NA	NA	NA	NA
AVF22440.1|2488162_2489122_-	glycerophosphodiester phosphodiesterase family protein	NA	NA	NA	NA	NA
AVF22441.1|2489331_2490420_-	putative dipeptidase YkvY	NA	NA	NA	NA	NA
AVF22442.1|2490615_2491614_-	Phosphate/sulfate permease	NA	NA	NA	NA	NA
AVF22443.1|2491947_2492115_+	thioredoxin-disulfide reductase	NA	NA	NA	NA	NA
AVF22444.1|2492159_2492801_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AVF22445.1|2492764_2492953_-	hypothetical protein	NA	A0A2I7SCW2	Paenibacillus_phage	93.0	3.7e-23
AVF22446.1|2492942_2493140_-	hypothetical protein	NA	A0A2I7SCV7	Paenibacillus_phage	66.2	1.9e-17
AVF22447.1|2493281_2493614_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22448.1|2493610_2493787_+	hypothetical protein	NA	A0A0C5AEJ6	Paenibacillus_phage	89.7	8.5e-22
AVF22449.1|2494284_2494842_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF22450.1|2494859_2495369_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF22451.1|2495372_2496413_-	putative lethal factor domain protein	NA	A0A1V0E017	Clostridioides_phage	26.2	1.9e-07
AVF22452.1|2496743_2497592_-	toxin-like protein	NA	A0A0K2CYN4	Paenibacillus_phage	30.5	9.5e-10
AVF22453.1|2497726_2498950_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVF22454.1|2501269_2501947_-	toxin-like protein	NA	NA	NA	NA	NA
AVF22455.1|2502043_2502436_-	toxin-like protein	NA	NA	NA	NA	NA
AVF22456.1|2502576_2503749_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	99.7	5.6e-218
>prophage 20
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	2602187	2657900	4288947	terminase,capsid,portal,tRNA,tail,protease,head	Paenibacillus_phage(96.1%)	84	NA	NA
AVF22555.1|2602187_2603582_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	27.6	2.9e-40
AVF22556.1|2603751_2604294_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
AVF22557.1|2604472_2605801_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil-5-)- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
AVF22558.1|2605813_2607904_-	DNA topoisomerase 1	NA	A0A2K9L5F8	Tupanvirus	40.9	1.8e-110
AVF22559.1|2608288_2609161_-	DNA processing Smf single strand binding protein-like protein	NA	S6BFL3	Thermus_phage	41.5	1.2e-36
AVF22560.1|2609264_2610200_-	succinyl-CoA ligase [ADP-forming] subunit alpha	NA	NA	NA	NA	NA
AVF22561.1|2610256_2611417_-	succinyl-CoA ligase [ADP-forming] subunit beta	NA	NA	NA	NA	NA
AVF22562.1|2611804_2612065_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22563.1|2612096_2612492_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22564.1|2612673_2613675_+	Mg chelatase-like protein	NA	NA	NA	NA	NA
AVF22565.1|2613796_2614132_+	antitoxin HipB	NA	A0A0K2CYN0	Paenibacillus_phage	100.0	1.1e-54
AVF22566.1|2614171_2614459_-	hypothetical protein	NA	A0A0K2CYG5	Paenibacillus_phage	98.7	8.4e-35
AVF22567.1|2614409_2614517_-	hypothetical protein	NA	A0A0K2CYK6	Paenibacillus_phage	100.0	4.8e-12
AVF22568.1|2614694_2615051_-	LytTr DNA-binding domain protein	NA	A0A0K2CYP4	Paenibacillus_phage	100.0	1.0e-61
AVF22569.1|2615057_2615186_-	hypothetical protein	NA	A0A0K2CYW0	Paenibacillus_phage	100.0	3.6e-14
AVF22570.1|2615182_2615698_-	putative accessory genes regulator protein	NA	A0A0K2CZ30	Paenibacillus_phage	100.0	1.8e-88
AVF22571.1|2615690_2616359_-	hypothetical protein	NA	A0A0K2CYM6	Paenibacillus_phage	100.0	3.5e-108
AVF22572.1|2616612_2617134_+	Telomeric repeat-binding factor 2	NA	A0A0K2CYG1	Paenibacillus_phage	100.0	3.3e-69
AVF22573.1|2617603_2617831_-	hypothetical protein	NA	A0A0K2CYV5	Paenibacillus_phage	100.0	8.6e-35
AVF22574.1|2618299_2618485_+	hypothetical protein	NA	A0A0K2CZ26	Paenibacillus_phage	100.0	8.3e-28
AVF22575.1|2618570_2618834_+	hypothetical protein	NA	A0A0K2CYM1	Paenibacillus_phage	100.0	3.8e-42
AVF22576.1|2619145_2622073_-	hypothetical protein	NA	A0A0K2CYN4	Paenibacillus_phage	100.0	0.0e+00
AVF22577.1|2622925_2623369_-	hypothetical protein	NA	A0A0K2CYV0	Paenibacillus_phage	100.0	5.8e-75
AVF22578.1|2623352_2623706_-	hypothetical protein	NA	R9W0N7	Paenibacillus_phage	100.0	4.8e-64
AVF22579.1|2623725_2624694_-	hypothetical protein	NA	A0A0K2CYL7	Paenibacillus_phage	100.0	1.6e-178
AVF22580.1|2624880_2625135_-	hypothetical protein	NA	R9W000	Paenibacillus_phage	100.0	2.7e-37
AVF22581.1|2625147_2625423_-	hypothetical protein	NA	R9VWV2	Paenibacillus_phage	100.0	7.2e-52
AVF22582.1|2625419_2626097_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0K2CYU5	Paenibacillus_phage	100.0	6.2e-137
AVF22583.1|2626093_2626333_-	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	100.0	2.8e-36
AVF22584.1|2626313_2626475_-	hypothetical protein	NA	A0A0K2CZ44	Paenibacillus_phage	100.0	8.8e-26
AVF22585.1|2626471_2626813_-	hypothetical protein	NA	A0A0K2CZC5	Paenibacillus_phage	100.0	9.9e-59
AVF22586.1|2626822_2627896_-	phage structural protein	NA	A0A0K2CZJ3	Paenibacillus_phage	99.7	7.1e-212
AVF22587.1|2627901_2629020_-	hypothetical protein	NA	A0A0K2CZQ1	Paenibacillus_phage	100.0	2.0e-212
AVF22588.1|2629022_2629889_-	Phage-related protein	NA	A0A0K2CZA8	Paenibacillus_phage	100.0	4.0e-165
AVF22589.1|2629889_2633594_-|tail	phage tail tape measure protein, TP901 family, core region	tail	A0A0K2CYK9	Paenibacillus_phage	100.0	0.0e+00
AVF22590.1|2633827_2634199_-	hypothetical protein	NA	A0A0K2CZI8	Paenibacillus_phage	100.0	2.9e-64
AVF22591.1|2634270_2634867_-|tail	phage major tail protein, phi13 family	tail	A0A0K2CZP8	Paenibacillus_phage	100.0	3.9e-111
AVF22592.1|2634902_2635232_-	hypothetical protein	NA	A0A0K2CZA4	Paenibacillus_phage	100.0	4.4e-56
AVF22593.1|2635228_2635621_-	phage protein, HK97 gp10 family	NA	A0A0K2CZ33	Paenibacillus_phage	100.0	4.3e-66
AVF22594.1|2635617_2635938_-|head,tail	putative phage head-tail adaptor	head,tail	A0A0K2CZB5	Paenibacillus_phage	100.0	3.0e-57
AVF22595.1|2635934_2636198_-	putative phage protein (possible DNA packaging)	NA	A0A0K2CZI4	Paenibacillus_phage	100.0	4.2e-41
AVF22596.1|2636323_2637466_-|capsid	phage major capsid protein, HK97 family	capsid	A0A0K2CZ99	Paenibacillus_phage	99.5	6.6e-208
AVF22597.1|2637462_2638218_-|protease	ATP-dependent Clp protease proteolytic subunit ClpP	protease	A0A0K2CZ28	Paenibacillus_phage	100.0	4.6e-133
AVF22598.1|2638168_2639404_-|portal	phage portal protein, HK97 family	portal	A0A0K2CZB0	Paenibacillus_phage	99.8	3.5e-239
AVF22599.1|2639418_2641146_-|terminase	Phage terminase-like protein, large subunit	terminase	A0A0K2CZH9	Paenibacillus_phage	100.0	0.0e+00
AVF22600.1|2641123_2641438_-|terminase	putative phage terminase, small subunit, P27 family	terminase	A0A0K2CZ94	Paenibacillus_phage	100.0	1.6e-50
AVF22601.1|2641575_2641944_-	HNH endonuclease	NA	A0A0K2CYS9	Paenibacillus_phage	100.0	8.7e-61
AVF22602.1|2641903_2642218_-	hypothetical protein	NA	A0A0K2CZ01	Paenibacillus_phage	100.0	1.9e-48
AVF22603.1|2642397_2642601_+	YcfA-like protein	NA	A0A0K2CYR6	Paenibacillus_phage	100.0	1.5e-33
AVF22604.1|2642631_2643048_+	Antitoxin HicB	NA	A0A0K2CYJ8	Paenibacillus_phage	100.0	9.2e-75
AVF22605.1|2643102_2643447_-	hypothetical protein	NA	A0A0K2CYS5	Paenibacillus_phage	100.0	4.5e-59
AVF22606.1|2643652_2644090_-	phage transcriptional regulator, ArpU family	NA	A0A0K2CYZ6	Paenibacillus_phage	100.0	3.7e-74
AVF22607.1|2644218_2644362_-	hypothetical protein	NA	A0A0K2CZ63	Paenibacillus_phage	100.0	3.0e-17
AVF22608.1|2644358_2644604_-	hypothetical protein	NA	A0A0K2CYR3	Paenibacillus_phage	100.0	1.6e-39
AVF22609.1|2644596_2644830_-	hypothetical protein	NA	A0A0K2CYJ4	Paenibacillus_phage	100.0	4.3e-37
AVF22610.1|2644881_2645064_-	hypothetical protein	NA	A0A0K2CYS1	Paenibacillus_phage	100.0	7.7e-26
AVF22611.1|2645047_2645830_-	modification methylase	NA	A0A0K2CYZ1	Paenibacillus_phage	100.0	7.4e-158
AVF22612.1|2645846_2646212_-	hypothetical protein	NA	A0A0K2CZ58	Paenibacillus_phage	100.0	4.7e-67
AVF22613.1|2646393_2646768_-	Holliday junction resolvase	NA	A0A0K2CYQ8	Paenibacillus_phage	100.0	1.4e-66
AVF22614.1|2646760_2646979_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	100.0	3.7e-35
AVF22615.1|2646985_2647096_-	hypothetical protein	NA	A0A0K2CYR7	Paenibacillus_phage	100.0	4.9e-12
AVF22616.1|2647097_2647730_-	phage-related protein	NA	A0A0K2CYY7	Paenibacillus_phage	100.0	2.5e-116
AVF22617.1|2647809_2648592_-	DnaD domain protein	NA	A0A0K2CZ53	Paenibacillus_phage	100.0	1.9e-137
AVF22618.1|2648671_2649004_-	hypothetical protein	NA	A0A0K2CYQ2	Paenibacillus_phage	100.0	2.8e-58
AVF22619.1|2649000_2649390_-	hypothetical protein	NA	A0A0K2CYI4	Paenibacillus_phage	100.0	1.5e-66
AVF22620.1|2649398_2649803_-	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	100.0	7.8e-71
AVF22621.1|2649792_2650431_-	ERF superfamily protein	NA	A0A0K2CYY2	Paenibacillus_phage	100.0	5.9e-113
AVF22622.1|2650433_2650982_-	Mu-like prophage host-nuclease inhibitor protein Gam	NA	A0A0K2CZ48	Paenibacillus_phage	100.0	4.3e-96
AVF22623.1|2650978_2651242_-	hypothetical protein	NA	A0A0K2CYP7	Paenibacillus_phage	100.0	2.6e-43
AVF22624.1|2651341_2651482_-	hypothetical protein	NA	A0A0K2CYI0	Paenibacillus_phage	100.0	3.1e-19
AVF22625.1|2651459_2651804_-	hypothetical protein	NA	A0A0K2CYQ7	Paenibacillus_phage	100.0	3.8e-58
AVF22626.1|2651890_2652403_+	hypothetical protein	NA	A0A0K2CYX7	Paenibacillus_phage	100.0	2.9e-94
AVF22627.1|2652392_2652650_-	hypothetical protein	NA	A0A0K2CZ43	Paenibacillus_phage	100.0	1.7e-42
AVF22628.1|2652642_2653218_-	hypothetical protein	NA	A0A0K2CYP2	Paenibacillus_phage	100.0	1.1e-102
AVF22629.1|2653214_2653967_-	putative prophage antirepressor	NA	A0A0K2CY14	Paenibacillus_phage	100.0	3.9e-140
AVF22630.1|2653971_2654145_-	hypothetical protein	NA	R9VY98	Paenibacillus_phage	100.0	6.0e-28
AVF22631.1|2654128_2654359_-	hypothetical protein	NA	R9W0P6	Paenibacillus_phage	100.0	1.0e-35
AVF22632.1|2654355_2654733_-	hypothetical protein	NA	R9VW30	Paenibacillus_phage	100.0	1.2e-65
AVF22633.1|2654739_2654943_-	hypothetical protein	NA	R9W009	Paenibacillus_phage	100.0	2.2e-34
AVF22634.1|2654963_2655233_-	hypothetical protein	NA	A0A0K2CYH1	Paenibacillus_phage	100.0	8.4e-45
AVF22635.1|2655247_2655445_-	hypothetical protein	NA	A0A0K2CYD7	Paenibacillus_phage	100.0	2.8e-29
AVF22636.1|2655561_2655783_-	anaerobic benzoate catabolism transcriptional regulator	NA	A0A0K2CYW6	Paenibacillus_phage	100.0	1.7e-35
AVF22637.1|2655877_2656216_+	helix-turn-helix family protein	NA	A0A0K2CZ35	Paenibacillus_phage	100.0	9.2e-57
AVF22638.1|2656217_2657900_+	putative DNA recombinase CisA	NA	A0A0K2CYN0	Paenibacillus_phage	100.0	0.0e+00
>prophage 21
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	2690996	2717335	4288947	integrase,transposase	Paenibacillus_phage(22.22%)	31	2685952:2685968	2715513:2715529
2685952:2685968	attL	GTGCTTCCTCAAAGGCT	NA	NA	NA	NA
AVF22678.1|2690996_2691308_+|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
AVF22679.1|2691346_2692156_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AVF22680.1|2693556_2693907_-	hypothetical protein	NA	A0A0K2CYS5	Paenibacillus_phage	60.0	1.4e-28
AVF22681.1|2694637_2695117_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22682.1|2695888_2695999_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22683.1|2695998_2696223_-	helix-turn-helix protein	NA	NA	NA	NA	NA
AVF22684.1|2696369_2696921_+	LexA repressor-like protein	NA	R9VW28	Paenibacillus_phage	33.3	3.6e-18
AVF22685.1|2697086_2697422_+|integrase	phage integrase-like protein	integrase	S5MNZ2	Brevibacillus_phage	43.2	6.8e-12
AVF22686.1|2697537_2698023_+|integrase	phage integrase-like protein	integrase	S5MNZ2	Brevibacillus_phage	57.9	1.7e-27
AVF22687.1|2698889_2699093_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22688.1|2699351_2700056_-	FMN reductase (NAD(P)H)	NA	NA	NA	NA	NA
AVF22689.1|2700206_2701478_-	NAD-specific glutamate dehydrogenase RocG	NA	NA	NA	NA	NA
AVF22690.1|2701612_2702944_-	ATPase/histidine kinase/DNA gyrase B/HSP90 domain protein	NA	NA	NA	NA	NA
AVF22691.1|2703354_2703756_-	ABC transporter-like protein	NA	A0A1B0RXA0	Streptococcus_phage	30.0	4.4e-05
AVF22692.1|2703752_2703875_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22693.1|2703871_2704033_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22694.1|2704101_2704440_-	YolD-like protein	NA	NA	NA	NA	NA
AVF22695.1|2704436_2705684_-	DNA polymerase IV 2	NA	NA	NA	NA	NA
AVF22696.1|2706239_2707295_-	arsenite resistance protein ArsB	NA	NA	NA	NA	NA
AVF22697.1|2707323_2707671_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF22698.1|2708333_2708696_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF22699.1|2708905_2711038_+	putative cadmium-transporting ATPase CadA	NA	E4ZFI9	Streptococcus_phage	44.6	1.0e-164
AVF22700.1|2711263_2711941_+	transcriptional regulatory protein ResD	NA	W8CYM9	Bacillus_phage	54.3	2.8e-65
AVF22701.1|2711972_2713352_+	alkaline phosphatase synthesis sensor protein PhoR	NA	W8CYF6	Bacillus_phage	41.0	4.0e-58
AVF22702.1|2713430_2714537_+	acidobacterial duplicated orphan permease	NA	NA	NA	NA	NA
AVF22703.1|2714536_2715220_+	putative ABC transporter ATP-binding protein YvrO	NA	G9BWD6	Planktothrix_phage	39.0	5.3e-35
AVF22704.1|2715112_2715325_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22705.1|2715467_2715761_+	hypothetical protein	NA	NA	NA	NA	NA
2715513:2715529	attR	GTGCTTCCTCAAAGGCT	NA	NA	NA	NA
AVF22706.1|2715616_2716018_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22707.1|2716250_2716808_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF22708.1|2716825_2717335_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 22
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	2796370	2862217	4288947	terminase,integrase,portal,coat,transposase,lysis,tail,head,holin	Paenibacillus_phage(56.25%)	78	2788419:2788435	2842942:2842958
2788419:2788435	attL	TCATAGCTGATCTTTTT	NA	NA	NA	NA
AVF22787.1|2796370_2797594_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVF22788.1|2797955_2799215_+	glycosyl transferase	NA	NA	NA	NA	NA
AVF22789.1|2799807_2801370_-	bacillolysin	NA	NA	NA	NA	NA
AVF22790.1|2802210_2803779_+	spore germination protein KA	NA	NA	NA	NA	NA
AVF22791.1|2803867_2804206_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AVF22792.1|2804166_2805018_+|transposase	transposase-like protein	transposase	A0A1B1P773	Bacillus_phage	35.1	1.7e-35
AVF22793.1|2805501_2805849_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	99.1	1.5e-57
AVF22794.1|2807099_2807447_-	hypothetical protein	NA	A0A0C5AN23	Paenibacillus_phage	92.5	1.1e-31
AVF22795.1|2807989_2808427_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22796.1|2808690_2809362_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0C5AEW3	Paenibacillus_phage	94.6	4.4e-127
AVF22797.1|2809460_2809868_-|holin,lysis	toxin secretion/phage lysis holin	holin,lysis	D0R7H7	Paenibacillus_phage	52.9	3.2e-32
AVF22798.1|2809902_2810070_-	hypothetical protein	NA	A0A0C5ABK5	Bacteriophage	87.0	2.3e-16
AVF22799.1|2810195_2810396_-	hypothetical protein	NA	A0A0C5AE97	Paenibacillus_phage	62.5	3.9e-15
AVF22800.1|2810407_2811172_-	hypothetical protein	NA	A0A0C5AEQ0	Bacteriophage	80.9	1.5e-70
AVF22801.1|2811171_2812650_-	hypothetical protein	NA	A0A1B2APX2	Phage_Wrath	55.4	6.8e-120
AVF22802.1|2812649_2813348_-	Phage-related protein	NA	A0A1B2APY0	Phage_Wrath	41.8	2.4e-43
AVF22803.1|2813350_2816551_-	tape measure domain protein	NA	M1IEW1	Bacillus_virus	43.2	6.7e-56
AVF22804.1|2816571_2816919_-	hypothetical protein	NA	A0A097PAX1	Streptococcus_pyogenes_phage	44.6	2.1e-19
AVF22805.1|2816996_2817302_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22806.1|2817301_2817826_-|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	72.8	1.6e-52
AVF22807.1|2817839_2818250_-	hypothetical protein	NA	A0A097PAW5	Streptococcus_pyogenes_phage	44.9	3.9e-33
AVF22808.1|2818254_2818590_-	hypothetical protein	NA	A0A097PAT9	Streptococcus_pyogenes_phage	37.2	2.4e-09
AVF22809.1|2818595_2818901_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22810.1|2818897_2819221_-|head,tail	Phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
AVF22811.1|2819223_2820120_-	hypothetical protein	NA	A7J297	Streptococcus_phage	52.1	4.3e-69
AVF22812.1|2820132_2820729_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22813.1|2820809_2821652_-|head	phage head morphogenesis protein, SPP1 gp7 family	head	S5MTV5	Brevibacillus_phage	34.2	3.8e-35
AVF22814.1|2821611_2823021_-|portal	phage portal protein, SPP1 family	portal	A0A097PAT2	Streptococcus_pyogenes_phage	50.7	2.4e-114
AVF22815.1|2823021_2824317_-|terminase	phage terminase, large subunit, PBSX family	terminase	A0A1L2JY46	Aeribacillus_phage	58.6	3.9e-140
AVF22816.1|2824300_2825080_-|terminase	phage-related terminase-like protein small subunit	terminase	A0A1L2JY44	Aeribacillus_phage	52.3	6.4e-53
AVF22817.1|2825135_2825303_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22818.1|2825318_2825687_-	hypothetical protein	NA	R9VWV2	Paenibacillus_phage	76.3	6.1e-38
AVF22819.1|2825655_2825898_-	hypothetical protein	NA	A0A1C8E971	Bacillus_phage	85.5	1.3e-28
AVF22820.1|2825953_2826160_-	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	93.9	2.2e-29
AVF22821.1|2826292_2826721_-	phage transcriptional regulator, RinA family	NA	A0A0K2CZI2	Paenibacillus_phage	100.0	1.9e-75
AVF22822.1|2826717_2826912_-	hypothetical protein	NA	A0A0K2CZP1	Paenibacillus_phage	100.0	3.2e-30
AVF22823.1|2826945_2828046_-	RNA polymerase sigma-F factor SigF	NA	A0A0K2CZU8	Paenibacillus_phage	100.0	6.6e-213
AVF22824.1|2828047_2828269_-	hypothetical protein	NA	A0A0K2CZG3	Paenibacillus_phage	100.0	9.9e-36
AVF22825.1|2828272_2828668_-	Holliday junction resolvase	NA	A0A0K2CZ96	Paenibacillus_phage	100.0	2.0e-71
AVF22826.1|2828657_2829011_-	hypothetical protein	NA	A0A0K2CZH7	Paenibacillus_phage	100.0	2.1e-64
AVF22827.1|2829222_2831529_-	Regulatory protein RepA	NA	A0A0K2CZ75	Paenibacillus_phage	100.0	0.0e+00
AVF22828.1|2831688_2833269_-	UvrABC system protein B	NA	A0A0K2CZF8	Paenibacillus_phage	100.0	4.7e-305
AVF22829.1|2833278_2833785_-	hypothetical protein	NA	A0A0K2CZ91	Paenibacillus_phage	100.0	1.8e-93
AVF22830.1|2833809_2834886_-	hypothetical protein	NA	A0A0K2CZH1	Paenibacillus_phage	100.0	5.1e-210
AVF22831.1|2834888_2836199_-	putative ATP-binding protein involved in virulence	NA	A0A0K2CZN2	Paenibacillus_phage	99.8	1.4e-180
AVF22832.1|2836264_2836975_-	hypothetical protein	NA	A0A0K2CZT8	Paenibacillus_phage	100.0	3.6e-127
AVF22833.1|2837011_2837383_-	hypothetical protein	NA	A0A0K2CZF3	Paenibacillus_phage	100.0	5.7e-60
AVF22834.1|2837415_2837700_-	transition state regulatory protein AbrB	NA	A0A0K2CZ86	Paenibacillus_phage	95.7	2.1e-46
AVF22835.1|2837696_2837927_-	hypothetical protein	NA	A0A2I7SC43	Paenibacillus_phage	88.2	1.8e-32
AVF22836.1|2837942_2838194_-	hypothetical protein	NA	A0A0K2CYH1	Paenibacillus_phage	46.9	2.8e-10
AVF22837.1|2838210_2838459_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22838.1|2838428_2838611_-	DNA binding domain, excisionase family	NA	NA	NA	NA	NA
AVF22839.1|2839063_2839396_+	putative phage protein	NA	A0A0K2CZS1	Paenibacillus_phage	34.5	2.8e-18
AVF22840.1|2839403_2839868_+	hypothetical protein	NA	A0A2I7SC21	Paenibacillus_phage	58.8	1.1e-49
AVF22841.1|2839947_2841087_+|integrase	phage integrase family protein	integrase	A0A1B0T6A8	Bacillus_phage	39.7	2.2e-62
AVF22842.1|2841139_2841505_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22843.1|2842082_2843888_-	oligoendopeptidase, pepF/M3 family	NA	NA	NA	NA	NA
2842942:2842958	attR	TCATAGCTGATCTTTTT	NA	NA	NA	NA
AVF22844.1|2844255_2844549_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22845.1|2844676_2845378_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22846.1|2845405_2845789_-	bacterial globin family protein	NA	NA	NA	NA	NA
AVF22847.1|2845844_2845943_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22848.1|2846100_2847351_+	sporulation integral membrane protein YlbJ	NA	NA	NA	NA	NA
AVF22849.1|2847494_2848301_+	putative inorganic polyphosphate/ATP-NAD kinase PpnK	NA	NA	NA	NA	NA
AVF22850.1|2848499_2849159_+|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	54.3	4.9e-62
AVF22851.1|2849351_2850116_+|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	43.8	4.5e-35
AVF22852.1|2849977_2850397_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22853.1|2850434_2851319_-	lipoyl synthase LipA	NA	NA	NA	NA	NA
AVF22854.1|2851507_2852593_+	peptidase, M23 family	NA	A0A7K9	Microcystis_virus	37.0	5.1e-08
AVF22855.1|2852647_2853397_-	spore formation-associated protein	NA	NA	NA	NA	NA
AVF22856.1|2853929_2854034_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22857.1|2854116_2855022_-	transcriptional regulator	NA	NA	NA	NA	NA
AVF22858.1|2855600_2856353_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	1.9e-134
AVF22859.1|2857262_2858201_-	O-acetylserine sulfhydrylase CysK	NA	C3U2M1	Lactococcus_phage	55.4	4.9e-84
AVF22860.1|2858224_2859043_-	RNA methyltransferase, TrmH family	NA	NA	NA	NA	NA
AVF22861.1|2859045_2859705_-	Ktr system potassium uptake protein C	NA	NA	NA	NA	NA
AVF22862.1|2859861_2860071_+	small, acid-soluble spore protein I	NA	NA	NA	NA	NA
AVF22863.1|2860331_2861093_-|coat	endospore coat-associated protein YheD	coat	NA	NA	NA	NA
AVF22864.1|2861089_2862217_-|coat	spore coat protein SA	coat	NA	NA	NA	NA
>prophage 23
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	2912109	2969879	4288947	tRNA,transposase	Paenibacillus_phage(44.44%)	60	NA	NA
AVF22905.1|2912109_2912397_-|tRNA	aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C	tRNA	NA	NA	NA	NA
AVF22906.1|2912612_2913677_+	sensor-like protein	NA	NA	NA	NA	NA
AVF22907.1|2913771_2914152_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22908.1|2914319_2914694_-	aminopeptidase-like protein	NA	NA	NA	NA	NA
AVF22909.1|2914802_2915426_-	metallo-beta-lactamase domain protein	NA	A0A1X9I5D3	Streptococcus_phage	40.3	3.3e-28
AVF22910.1|2915449_2916016_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22911.1|2916131_2916737_-	membrane phosphatase-like protein	NA	NA	NA	NA	NA
AVF22912.1|2916867_2917383_+	Cytochrome c oxidase subunit 2	NA	NA	NA	NA	NA
AVF22913.1|2917583_2917772_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22914.1|2918119_2918698_+	transcriptional regulator, TetR family	NA	NA	NA	NA	NA
AVF22915.1|2918835_2919651_+	phage infection protein Pip	NA	NA	NA	NA	NA
AVF22916.1|2919708_2921142_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22917.1|2921412_2922204_+	polysaccharide deacetylase, PdaB family	NA	NA	NA	NA	NA
AVF22918.1|2922225_2922918_+	putative L,D-transpeptidase YkuD	NA	NA	NA	NA	NA
AVF22919.1|2923270_2923816_-	putative sporulation protein YyaC	NA	G3M9W0	Bacillus_virus	37.4	7.0e-22
AVF22920.1|2924024_2924141_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22921.1|2924249_2924954_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AVF22922.1|2925510_2927394_+	putative lantibiotic biosynthesis protein	NA	A0A2H4PQG8	Staphylococcus_phage	26.2	4.7e-49
AVF22923.1|2927430_2929749_+	putative lantibiotic biosynthesis protein	NA	NA	NA	NA	NA
AVF22924.1|2929820_2930075_+	putative lantibiotic biosynthesis protein	NA	NA	NA	NA	NA
AVF22925.1|2930363_2931680_-	DAACS family dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
AVF22926.1|2931798_2931942_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22927.1|2931967_2932951_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22928.1|2932975_2933272_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22929.1|2933292_2935236_-	sodium/proton antiporter, CPA1 family	NA	NA	NA	NA	NA
AVF22930.1|2935360_2935639_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22931.1|2936411_2937191_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22932.1|2937426_2938884_+	cardiolipin synthase	NA	NA	NA	NA	NA
AVF22933.1|2939069_2940155_-	micrococcal nuclease	NA	NA	NA	NA	NA
AVF22934.1|2940765_2941539_-	phosphosugar-binding transcriptional regulator	NA	NA	NA	NA	NA
AVF22935.1|2941614_2942808_-	protein MalY	NA	NA	NA	NA	NA
AVF22936.1|2942833_2944393_-	PTS system maltose- and glucose-specific EIICB component MalX	NA	NA	NA	NA	NA
AVF22937.1|2945158_2945407_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22938.1|2945413_2945677_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22939.1|2945860_2946802_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22940.1|2946983_2947598_+	Anti-sigma-V factor RsiV	NA	NA	NA	NA	NA
AVF22941.1|2947820_2949041_-	anion ABC transporter-like protein	NA	NA	NA	NA	NA
AVF22942.1|2949046_2949736_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF22943.1|2949935_2950226_-	putative dienelactone hydrolase	NA	NA	NA	NA	NA
AVF22944.1|2950692_2951121_+	pyruvate formate-lyase-activating enzyme	NA	NA	NA	NA	NA
AVF22945.1|2951115_2951880_-	putative phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AVF22946.1|2952131_2953355_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVF22947.1|2953459_2953618_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22948.1|2953692_2954430_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22949.1|2954614_2954839_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22950.1|2954937_2955552_+	RNA polymerase sigma-B factor SigB	NA	NA	NA	NA	NA
AVF22951.1|2957750_2959121_+	arylsulfatase regulator Fe-S oxidoreductase	NA	NA	NA	NA	NA
AVF22952.1|2959098_2959686_+	putative coenzyme A biosynthesis bifunctional protein CoaBC	NA	NA	NA	NA	NA
AVF22953.1|2959657_2960944_+	major facilitator superfamily MFS_1 protein	NA	NA	NA	NA	NA
AVF22954.1|2961177_2961627_+|transposase	transposase IS3/IS911 family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	47.1	2.7e-24
AVF22955.1|2962208_2962796_-|transposase	transposase-like protein	transposase	A0A2I7SC85	Paenibacillus_phage	96.2	2.3e-95
AVF22956.1|2963045_2963327_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	98.9	2.4e-42
AVF22957.1|2963514_2963847_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22958.1|2964165_2964435_+	Antitoxin MazE	NA	NA	NA	NA	NA
AVF22959.1|2964428_2964761_+	mRNA interferase NdoA	NA	NA	NA	NA	NA
AVF22960.1|2965012_2965303_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF22961.1|2965299_2967810_+	coenzyme A disulfide reductase	NA	NA	NA	NA	NA
AVF22962.1|2967915_2968212_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22963.1|2968728_2969016_+|transposase	transposase IS3/IS911 family protein	transposase	Q6H9S5	Enterobacteria_phage	44.7	6.9e-05
AVF22964.1|2969063_2969879_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	1.1e-58
>prophage 24
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	2980389	3024807	4288947	integrase,transposase,protease	Bacillus_phage(40.0%)	49	2969952:2969985	3029863:3029896
2969952:2969985	attL	GTTTCAATACACCTTGTGTTACTGTCAAACCCAA	NA	NA	NA	NA
AVF22973.1|2980389_2980512_+|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
AVF22974.1|2981230_2981593_-|integrase	integrase catalytic region	integrase	NA	NA	NA	NA
AVF22975.1|2982039_2982291_+	DNA polymerase IV 2	NA	NA	NA	NA	NA
AVF22976.1|2982522_2982639_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22977.1|2983329_2983617_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AVF22978.1|2983679_2983931_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22979.1|2984288_2985302_+	transcriptional regulatory protein	NA	NA	NA	NA	NA
AVF22980.1|2985305_2985815_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF22981.1|2986132_2987785_+	Beta-xylosidase	NA	NA	NA	NA	NA
AVF22982.1|2987969_2989136_+	amidohydrolase-like protein	NA	NA	NA	NA	NA
AVF22983.1|2989207_2990395_+	putative MFS-type transporter YitG	NA	NA	NA	NA	NA
AVF22984.1|2990454_2990745_+	putative L-serine dehydratase, alpha chain	NA	NA	NA	NA	NA
AVF22985.1|2991320_2991695_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	92.7	5.0e-64
AVF22986.1|2991842_2992160_+|transposase	transposase IS3/IS911	transposase	NA	NA	NA	NA
AVF22987.1|2992374_2992938_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A1B1P773	Bacillus_phage	41.0	2.6e-24
AVF22988.1|2994543_2994642_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22989.1|2995019_2996390_-	putrescine importer PuuP	NA	NA	NA	NA	NA
AVF22990.1|2996480_2997593_-	alanine dehydrogenase Ald	NA	NA	NA	NA	NA
AVF22991.1|2998279_2998369_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22992.1|2999205_2999682_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22993.1|2999837_3000068_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22994.1|3000599_3001100_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22995.1|3001181_3001676_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22996.1|3002862_3003060_-	hypothetical protein	NA	NA	NA	NA	NA
AVF22997.1|3003615_3004107_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22998.1|3004149_3004326_+	hypothetical protein	NA	NA	NA	NA	NA
AVF22999.1|3004424_3004517_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23000.1|3004859_3005060_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23001.1|3005283_3005694_+	hypothetical protein	NA	NA	NA	NA	NA
AVF23002.1|3006369_3007512_-|protease	minor extracellular protease Epr	protease	A0A1B0T6A2	Bacillus_phage	37.4	7.2e-45
AVF23003.1|3007556_3007943_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23004.1|3008047_3008422_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23005.1|3009113_3009263_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23006.1|3011340_3011493_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23007.1|3013421_3013673_+	hypothetical protein	NA	NA	NA	NA	NA
AVF23008.1|3013749_3014187_+	hypothetical protein	NA	NA	NA	NA	NA
AVF23009.1|3014319_3014691_-	DNA polymerase III PolC-like protein	NA	A2I2Z6	Vibrio_virus	44.0	4.3e-15
AVF23010.1|3014958_3015258_-|integrase	integrase family protein	integrase	NA	NA	NA	NA
AVF23011.1|3015511_3016036_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23012.1|3016163_3017696_-	NADH dehydrogenase AhpF	NA	A0A2I2L5E1	Orpheovirus	32.4	5.7e-37
AVF23013.1|3017704_3018268_-	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
AVF23014.1|3018410_3018578_-	Virus attachment protein p12 family protein	NA	NA	NA	NA	NA
AVF23015.1|3018591_3020340_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
AVF23016.1|3020450_3020579_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
AVF23017.1|3020575_3020803_-	FeoA family protein	NA	NA	NA	NA	NA
AVF23018.1|3021598_3022477_-	HTH-type transcriptional regulator GltC	NA	NA	NA	NA	NA
AVF23019.1|3022588_3023746_+	putative transporter protein	NA	NA	NA	NA	NA
AVF23020.1|3024004_3024517_+|transposase	transposase	transposase	NA	NA	NA	NA
AVF23021.1|3024513_3024807_+|transposase	transposase	transposase	NA	NA	NA	NA
3029863:3029896	attR	GTTTCAATACACCTTGTGTTACTGTCAAACCCAA	NA	NA	NA	NA
>prophage 25
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	3031305	3077219	4288947	transposase	Paenibacillus_phage(25.0%)	41	NA	NA
AVF23029.1|3031305_3032058_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	1.9e-134
AVF23030.1|3032195_3032879_-|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	96.5	4.5e-119
AVF23031.1|3033282_3034599_-	putative membrane protein	NA	NA	NA	NA	NA
AVF23032.1|3035252_3035429_-	sensor histidine kinase ResE	NA	NA	NA	NA	NA
AVF23033.1|3035534_3036650_-	toxin-like protein	NA	A0A1V0E026	Clostridioides_phage	41.7	2.3e-43
AVF23034.1|3036659_3036884_-	toxin-like protein	NA	NA	NA	NA	NA
AVF23035.1|3037005_3037197_-	toxin-like protein	NA	NA	NA	NA	NA
AVF23036.1|3037249_3037822_-	toxin-like protein	NA	Q331X8	Clostridium_botulinum_C_phage	40.2	4.3e-30
AVF23037.1|3037782_3037995_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23038.1|3038182_3040630_-	3-oxoacyl-[acyl-carrier-protein] synthase	NA	NA	NA	NA	NA
AVF23039.1|3040641_3041688_-	aminomethyltransferase GcvT	NA	NA	NA	NA	NA
AVF23040.1|3041737_3042247_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF23041.1|3042264_3042822_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF23042.1|3045728_3046688_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23043.1|3047278_3047470_+|transposase	transposase-like protein	transposase	A0A0C5AEB1	Paenibacillus_phage	64.8	4.3e-11
AVF23044.1|3048183_3048390_+	cold shock-like protein CspLB	NA	Q9AZD3	Lactococcus_phage	64.6	4.6e-19
AVF23045.1|3048490_3048769_+	DNA-binding protein HU 1	NA	M4SRV7	Rhodobacter_phage	38.3	7.2e-07
AVF23046.1|3049805_3050444_+	channel protein, hemolysin III family	NA	NA	NA	NA	NA
AVF23047.1|3050839_3051562_-	ubiquinone/menaquinone biosynthesis methyltransferase	NA	NA	NA	NA	NA
AVF23048.1|3051579_3052221_-	bacterial transferase hexapeptide repeat protein	NA	NA	NA	NA	NA
AVF23049.1|3053472_3054339_-	glycosyltransferase-like protein	NA	A0A1V0SAH6	Catovirus	32.4	8.2e-09
AVF23050.1|3054556_3056086_+	Hyaluronan synthase	NA	A0A0N7G7L1	Chrysochromulina_ericina_virus	32.4	2.0e-42
AVF23051.1|3056466_3057558_-	PTS system, fructose-specific, IIB component/PTS system, fructose subfamily, IIC component	NA	NA	NA	NA	NA
AVF23052.1|3057572_3057920_-	PTS system, fructose-specific, IIB component/PTS system, fructose subfamily, IIC component	NA	NA	NA	NA	NA
AVF23053.1|3057916_3058381_-	PTS system, fructose subfamily, IIA component	NA	NA	NA	NA	NA
AVF23054.1|3058409_3060293_-	PTS system fructose-specific EIIABC component FruA	NA	NA	NA	NA	NA
AVF23055.1|3060320_3061199_-	D-tagatose-1,6-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
AVF23056.1|3061218_3061977_-	putative transcriptional regulator ManR	NA	NA	NA	NA	NA
AVF23057.1|3061961_3063050_-	transcriptional regulator MtlR	NA	NA	NA	NA	NA
AVF23058.1|3063293_3064298_-	5-dehydro-2-deoxygluconokinase IolC	NA	NA	NA	NA	NA
AVF23059.1|3064299_3064950_-	KHG/KDPG aldolase	NA	NA	NA	NA	NA
AVF23060.1|3065015_3066410_-	Uronate isomerase	NA	NA	NA	NA	NA
AVF23061.1|3066430_3066943_-	glucuronide transporter	NA	NA	NA	NA	NA
AVF23062.1|3066943_3067918_-	Glucuronide permease	NA	NA	NA	NA	NA
AVF23063.1|3068034_3069105_-	Mannonate dehydratase	NA	NA	NA	NA	NA
AVF23064.1|3069095_3069440_-	Mannitol-1-phosphate/altronate dehydrogenase	NA	NA	NA	NA	NA
AVF23065.1|3069433_3070459_-	Polyol:NADP oxidoreductase	NA	NA	NA	NA	NA
AVF23066.1|3071032_3071701_+	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF23067.1|3072478_3074794_-	magnesium-transporting ATPase, P-type 1	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	24.7	4.9e-32
AVF23068.1|3075743_3076403_+|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	53.3	5.4e-61
AVF23069.1|3076595_3077219_+|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	43.8	3.7e-35
>prophage 26
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	3437950	3444707	4288947		Staphylococcus_phage(57.14%)	7	NA	NA
AVF23432.1|3437950_3438595_-	segregation and condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.9	8.2e-14
AVF23433.1|3438560_3439343_-	segregation and condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	34.2	9.7e-09
AVF23434.1|3439773_3440244_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.9	1.1e-42
AVF23435.1|3440279_3441509_-	riboflavin biosynthesis protein RibBA	NA	A0A2H4PQS2	Staphylococcus_phage	51.0	8.1e-111
AVF23436.1|3441543_3442209_-	riboflavin synthase alpha chain RibE	NA	A0A2H4PQS5	Staphylococcus_phage	43.3	3.4e-39
AVF23437.1|3442212_3443346_-	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.5	1.6e-52
AVF23438.1|3444269_3444707_-	peptidyl-prolyl cis-trans isomerase B	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	45.3	1.6e-21
>prophage 27
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	3476359	3487395	4288947	transposase	Streptococcus_phage(50.0%)	13	NA	NA
AVF23471.1|3476359_3476986_+|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	53.8	4.6e-54
AVF23472.1|3477212_3477815_+|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	43.8	3.6e-35
AVF23473.1|3478570_3479071_-	Phenolic acid decarboxylase PadC	NA	NA	NA	NA	NA
AVF23474.1|3479185_3479785_+	transcriptional regulator, Acidobacterial, PadR-family	NA	NA	NA	NA	NA
AVF23475.1|3480139_3480358_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF23476.1|3480826_3481228_-|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	60.3	1.7e-38
AVF23477.1|3481377_3481632_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23478.1|3481658_3482168_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23479.1|3482601_3483354_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	1.9e-134
AVF23480.1|3484339_3484729_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23481.1|3484966_3485461_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23482.1|3486243_3486531_+|transposase	transposase IS3/IS911 family protein	transposase	A0A1P8CWP5	Bacillus_phage	37.8	3.1e-05
AVF23483.1|3486918_3487395_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	53.4	8.4e-40
>prophage 28
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	3491927	3517339	4288947	transposase,coat	Paenibacillus_phage(81.82%)	31	NA	NA
AVF23488.1|3491927_3492194_-|coat	spore coat peptide assembly protein	coat	NA	NA	NA	NA
AVF23489.1|3492466_3492679_-|coat	Spore coat associated protein JA (CotJA)	coat	NA	NA	NA	NA
AVF23490.1|3492859_3493543_+|transposase	transposase family protein	transposase	A0A0C5AJ29	Paenibacillus_phage	99.1	9.7e-122
AVF23491.1|3493680_3494433_+|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A0C5AEA5	Paenibacillus_phage	97.9	9.3e-134
AVF23492.1|3494592_3495963_-	Magnesium and cobalt efflux protein CorC	NA	NA	NA	NA	NA
AVF23493.1|3496015_3497140_-	radical SAM domain protein	NA	NA	NA	NA	NA
AVF23494.1|3497507_3498359_-	undecaprenyl-diphosphatase UppP	NA	NA	NA	NA	NA
AVF23495.1|3498503_3499919_-	putative metallophosphoesterase YunD	NA	NA	NA	NA	NA
AVF23496.1|3500355_3501072_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23497.1|3501264_3501597_+	putative membrane protein	NA	NA	NA	NA	NA
AVF23498.1|3501675_3502722_+	metal dependent phosphohydrolase	NA	NA	NA	NA	NA
AVF23499.1|3502916_3503312_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23500.1|3503716_3503980_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23501.1|3503999_3505043_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23502.1|3505315_3505549_+	hypothetical protein	NA	NA	NA	NA	NA
AVF23503.1|3505803_3506130_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF23504.1|3506516_3507347_-|transposase	transposase-like protein	transposase	A0A2I7SC85	Paenibacillus_phage	98.9	2.2e-152
AVF23505.1|3507352_3507589_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	98.7	2.2e-33
AVF23506.1|3507824_3508229_-	hypothetical protein	NA	A0A2I7SDE8	Paenibacillus_phage	100.0	8.7e-70
AVF23507.1|3508492_3509473_-	toxin-like protein	NA	A0A2I7SDE4	Paenibacillus_phage	81.6	1.4e-68
AVF23508.1|3509600_3509771_-	toxin-like protein	NA	A0A2I7SCU7	Paenibacillus_phage	86.0	2.9e-19
AVF23509.1|3509781_3510081_-	toxin-like protein	NA	A0A0K2CXS6	Paenibacillus_phage	93.9	1.1e-45
AVF23510.1|3510680_3510947_-	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	76.1	7.5e-30
AVF23511.1|3511741_3512080_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23512.1|3512101_3512380_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23513.1|3512500_3513724_+|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVF23514.1|3513716_3514085_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23515.1|3514421_3515417_-	amidinotransferase family protein	NA	NA	NA	NA	NA
AVF23516.1|3515869_3516172_-	hypothetical protein	NA	J7KJ12	Streptococcus_phage	45.0	9.8e-10
AVF23517.1|3516284_3517013_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AVF23518.1|3517051_3517339_-|transposase	transposase IS3/IS911 family protein	transposase	NA	NA	NA	NA
>prophage 29
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	3648160	3674070	4288947	integrase,tRNA,transposase	Bacillus_phage(28.57%)	25	3655586:3655645	3674921:3675935
AVF23647.1|3648160_3650611_-|tRNA	phenylalanine--tRNA ligase beta chain PheT	tRNA	NA	NA	NA	NA
AVF23648.1|3650634_3651663_-|tRNA	phenylalanine--tRNA ligase alpha chain PheS	tRNA	A0A2K9L3A8	Tupanvirus	37.9	1.7e-29
AVF23649.1|3652764_3653280_-	type I signal peptidase-like protein	NA	NA	NA	NA	NA
AVF23650.1|3653447_3654371_+	putative oxidoreductase YajO	NA	NA	NA	NA	NA
AVF23651.1|3654477_3654774_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AVF23652.1|3655009_3655588_+|transposase	transposase-like protein	transposase	A0A1B1P773	Bacillus_phage	41.1	3.1e-36
3655586:3655645	attL	TGATCTTACCCCCGTCAAGTAGACAGCATTAAAACTGATAGGTCCTAAGCAACCTTAGTA	NA	NA	NA	NA
AVF23653.1|3655718_3656150_-|transposase	putative transposase InsK for insertion sequence element IS150	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	47.9	6.5e-23
AVF23654.1|3656577_3658305_-|transposase	transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.6	7.4e-94
AVF23655.1|3658318_3659224_-|integrase	phage integrase family protein	integrase	A0A0A7AR08	Bacillus_phage	57.0	1.4e-91
AVF23656.1|3659367_3659748_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23657.1|3660664_3661567_+	hypothetical protein	NA	NA	NA	NA	NA
AVF23658.1|3661585_3661687_+	hypothetical protein	NA	NA	NA	NA	NA
AVF23659.1|3662824_3663619_-	methyltransferase type 11	NA	NA	NA	NA	NA
AVF23660.1|3663692_3664136_-	transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVF23661.1|3664399_3664558_-	Arsenate reductase	NA	NA	NA	NA	NA
AVF23662.1|3665139_3666057_-	D-ribose-binding protein RbsB	NA	NA	NA	NA	NA
AVF23663.1|3666075_3667044_-	ribose transport system permease protein RbsC	NA	NA	NA	NA	NA
AVF23664.1|3667045_3668527_-	ribose import ATP-binding protein RbsA	NA	G3M9Y6	Bacillus_virus	27.6	4.1e-16
AVF23665.1|3668541_3668940_-	D-ribose pyranase RbsD	NA	NA	NA	NA	NA
AVF23666.1|3668941_3669820_-	ribokinase RbsK	NA	NA	NA	NA	NA
AVF23667.1|3669812_3670802_-	ribose operon repressor	NA	NA	NA	NA	NA
AVF23668.1|3671879_3672056_+	hypothetical protein	NA	NA	NA	NA	NA
AVF23669.1|3672100_3673450_+	putative DNA-binding protein	NA	A0A0K2CP77	Brevibacillus_phage	34.9	7.6e-70
AVF23670.1|3673453_3673594_+	hypothetical protein	NA	NA	NA	NA	NA
AVF23671.1|3673752_3674070_+|transposase	transposase IS3/IS911	transposase	NA	NA	NA	NA
3674921:3675935	attR	TACTAAGGTTGCTTAGGACCTATCAGTTTTAATGCTGTCTACTTGACGGGGGTAAGATCAGAGTACCGACGCCAGCTTGCCGCCCAGGGTCTTTTTTCAATGTCTACAAAATGGGGTCTTGACCAATATCCGGCGGGGATTTCCCTTTGAGAATATTTGAGGATATTCAAAGGATTAAAAATATATAAGATGTGCAGTCTCTTTCTATTTTTATTTTCCATACACATCATGAAGCTGATCAACCAGCAGGTTTACCGCTAGTATATGCCAGCCATATTCCAGATAATATTCGACCAGAGGATTTCTGCATAATCTCTTTCAAGCACCAACCGGCTCAACCCTGATGAGAATGATTATCATTACTATTATTAATATAATGATTTTTTTCCTATTCGTCAAGACAAGTTCTCCCCGCTGCAATTTGGATAGGCGGTTTGTCAAAATCATCATGATGTCATCTTTGGCGAAACCGTCTACAAAAAAAGTCCGAATCTGACCCCCGCGAATCCCAACTTCCTGTGAATCACATCAAAGCTTTGTTCCACACCTAAAGCCCTCAAAAAACCAATATTTTCGTCAAAATTGAAAGTAAGCAGCTGATTGTGCTGCCCCTCTCTCGTATCCGGATTACGCATCTGGTCTCCTCCATCACTCATCCATATAACTTTTTCCAGTTATTTCCAACCATATAGCGGTTAAAACCTGCTTTCCGGAGGAAAAACGATACGTAAAGGCATTTAATTCTTATGTTTGGCCAAATCTCTGTTTGTTTTCATTTCCATATCCGATAAAATCGAGACAGGCGAAGGAGGAGATATTTTTGCTTAAACCAACAGCCGGAAAAGAACGCATTGCGGATCTTGACTATATTCGCGGCTTCGCCCTAATCGGGATTCTGCTCGTGAATATGCCCCTGTTCAGTGGAGCTGAATATCAGACTTATACAGGAGCTGACCGTGTGATCCGGCTAATATTTGATTTGTTTGTGCAGGCCAAATTTTATACTATATTTTCT	NA	NA	NA	NA
>prophage 30
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	3793106	3824272	4288947	integrase,transposase,protease	Paenibacillus_phage(50.0%)	35	3793978:3793992	3816409:3816423
AVF23805.1|3793106_3793442_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF23806.1|3793548_3794592_+	glycosyl transferase	NA	NA	NA	NA	NA
3793978:3793992	attL	TTTAAAACATCCGTA	NA	NA	NA	NA
AVF23807.1|3795048_3795447_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23808.1|3795459_3797421_-	toxin-like protein	NA	A0A2I7SCU7	Paenibacillus_phage	80.5	8.8e-192
AVF23809.1|3797775_3798381_-	putative ADP-ribosyltransferase	NA	Q331X8	Clostridium_botulinum_C_phage	41.8	7.5e-33
AVF23810.1|3798907_3801520_-	toxin-like protein	NA	A0A1V0E026	Clostridioides_phage	34.4	4.4e-98
AVF23811.1|3801590_3802781_-	toxin-like protein	NA	NA	NA	NA	NA
AVF23812.1|3803692_3804139_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23813.1|3804717_3804876_+	hypothetical protein	NA	NA	NA	NA	NA
AVF23814.1|3804862_3805555_-	hypothetical protein	NA	D2XR29	Bacillus_phage	43.7	4.4e-45
AVF23815.1|3805625_3805871_-	hypothetical protein	NA	A0A2I7SC00	Paenibacillus_phage	92.6	2.8e-31
AVF23816.1|3805880_3806552_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7SD00	Paenibacillus_phage	95.5	1.4e-128
AVF23817.1|3806548_3806785_-	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	98.6	6.0e-31
AVF23818.1|3807094_3807382_-	hypothetical protein	NA	E2ELK3	Clostridium_phage	51.6	3.8e-19
AVF23819.1|3807393_3807984_-	phage structural protein	NA	NA	NA	NA	NA
AVF23820.1|3808283_3808547_+	hypothetical protein	NA	NA	NA	NA	NA
AVF23821.1|3808553_3809048_+	LexA repressor-like protein	NA	NA	NA	NA	NA
AVF23822.1|3809060_3809351_+|integrase	phage integrase family protein	integrase	S5MNZ2	Brevibacillus_phage	54.5	1.8e-16
AVF23823.1|3809338_3810037_+|integrase	phage integrase-like protein	integrase	A0A2I7SC08	Paenibacillus_phage	58.4	1.9e-72
AVF23824.1|3810758_3811229_-	SprT-like protein	NA	NA	NA	NA	NA
AVF23825.1|3811327_3811684_+	hypothetical protein	NA	NA	NA	NA	NA
AVF23826.1|3812261_3812459_-	thermophilic serine proteinase	NA	NA	NA	NA	NA
AVF23827.1|3812455_3813460_-|protease	minor extracellular protease Epr	protease	A0A217EQY2	Bacillus_phage	38.4	7.5e-38
AVF23828.1|3813715_3813943_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23829.1|3814364_3814502_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23830.1|3814534_3814993_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23831.1|3815375_3815957_+	ECF subfamily RNA polymerase sigma-24 factor	NA	NA	NA	NA	NA
AVF23832.1|3816158_3818447_-	hypothetical protein	NA	NA	NA	NA	NA
3816409:3816423	attR	TTTAAAACATCCGTA	NA	NA	NA	NA
AVF23833.1|3818534_3818885_-	mRNA interferase NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	6.9e-15
AVF23834.1|3818888_3819170_-	putative transcriptional regulator, CopG family	NA	NA	NA	NA	NA
AVF23835.1|3819404_3820592_-	alanine racemase Alr	NA	NA	NA	NA	NA
AVF23836.1|3820759_3822016_-	sporulation protein YdcC	NA	NA	NA	NA	NA
AVF23837.1|3822560_3822767_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23838.1|3823508_3823883_+|transposase	putative transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	68.9	1.1e-47
AVF23839.1|3823978_3824272_+|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	43.8	3.7e-14
>prophage 31
CP019651	Paenibacillus larvae subsp. larvae strain ERIC_I chromosome, complete genome	4288947	3828026	3889644	4288947	integrase,coat,tRNA,transposase,bacteriocin	Paenibacillus_phage(25.0%)	57	3856816:3856830	3894864:3894878
AVF23845.1|3828026_3828353_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
AVF23846.1|3828672_3829506_+	sensor protein DegS	NA	NA	NA	NA	NA
AVF23847.1|3829474_3830143_+	oxygen regulatory protein NreC	NA	NA	NA	NA	NA
AVF23848.1|3830393_3831122_+|transposase	transposase mutator type	transposase	A0A218MNI5	uncultured_virus	68.3	4.9e-15
AVF23849.1|3831212_3832118_-	CRISPR-associated protein, Cmr3 family	NA	NA	NA	NA	NA
AVF23850.1|3832120_3833794_-	CRISPR-associated RAMP Crm2 family protein	NA	NA	NA	NA	NA
AVF23851.1|3833793_3834726_-	CRISPR-associated RAMP Cmr1 family protein	NA	NA	NA	NA	NA
AVF23852.1|3834748_3835630_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23853.1|3835783_3836050_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23854.1|3836846_3837023_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23855.1|3839301_3839928_+	transporter-like protein	NA	NA	NA	NA	NA
AVF23856.1|3840490_3840799_-	ECF subfamily RNA polymerase sigma-24 factor	NA	NA	NA	NA	NA
AVF23857.1|3841041_3841896_-|coat	spore coat polysaccharide biosynthesis protein SpsK	coat	NA	NA	NA	NA
AVF23858.1|3841892_3842852_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	46.0	5.1e-76
AVF23859.1|3842848_3843406_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	43.6	7.1e-38
AVF23860.1|3844866_3845682_-	sporulation-specific N-acetylmuramoyl-L-alanine amidase CwlC	NA	D6QWP2	uncultured_phage	53.5	5.3e-42
AVF23861.1|3845913_3846618_-	putative membrane protein	NA	NA	NA	NA	NA
AVF23862.1|3846873_3847170_-	TrpR like protein, YerC/YecD	NA	NA	NA	NA	NA
AVF23863.1|3847456_3848773_-	putative tyrosine permease, NhaC family	NA	NA	NA	NA	NA
AVF23864.1|3848932_3849748_-	pyridoxine kinase PdxK	NA	NA	NA	NA	NA
AVF23865.1|3849857_3851720_-	decarboxylase	NA	NA	NA	NA	NA
AVF23866.1|3851777_3853226_-	putative transporter	NA	NA	NA	NA	NA
AVF23867.1|3854351_3855053_-	Replication protein	NA	NA	NA	NA	NA
AVF23868.1|3855084_3856347_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.2e-87
3856816:3856830	attL	GAATCAATTTCATAA	NA	NA	NA	NA
AVF23869.1|3856896_3858285_-	Na(+)/H(+) antiporter NhaC	NA	NA	NA	NA	NA
AVF23870.1|3858355_3860224_-	decarboxylase	NA	NA	NA	NA	NA
AVF23871.1|3860235_3861687_-	amino acid antiporter	NA	NA	NA	NA	NA
AVF23872.1|3862444_3862687_+	hypothetical protein	NA	NA	NA	NA	NA
AVF23873.1|3862733_3862910_+	hypothetical protein	NA	NA	NA	NA	NA
AVF23874.1|3863382_3863802_-	putative DNA-binding protein	NA	NA	NA	NA	NA
AVF23875.1|3864923_3865142_+	hypothetical protein	NA	NA	NA	NA	NA
AVF23876.1|3865290_3865533_-	hypothetical protein	NA	A0A2I7SCT4	Paenibacillus_phage	93.8	1.2e-31
AVF23877.1|3865559_3865712_-	N-acetylmuramoyl-l-alanine amidase	NA	NA	NA	NA	NA
AVF23878.1|3865669_3865921_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2I7QIN4	Bacillus_phage	52.0	2.1e-10
AVF23879.1|3865904_3866069_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23880.1|3866070_3866295_-	hypothetical protein	NA	A0A0C5AEG8	Bacteriophage	85.7	2.1e-25
AVF23881.1|3866662_3867886_-	putative lethal factor domain protein	NA	NA	NA	NA	NA
AVF23882.1|3868023_3871050_-	toxin-like protein	NA	A0A1V0E026	Clostridioides_phage	37.6	1.7e-88
AVF23883.1|3871121_3872372_-	toxin-like protein	NA	NA	NA	NA	NA
AVF23884.1|3873165_3874695_+	spore germination protein KA	NA	NA	NA	NA	NA
AVF23885.1|3874691_3875795_+	spore germination protein YndE	NA	NA	NA	NA	NA
AVF23886.1|3875791_3876286_+	spore germination receptor subunit-like protein	NA	NA	NA	NA	NA
AVF23887.1|3876552_3877224_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0K2CXQ8	Paenibacillus_phage	96.4	9.5e-130
AVF23888.1|3877465_3879241_-	GlcNAc-binding protein A	NA	NA	NA	NA	NA
AVF23889.1|3879989_3880205_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF23890.1|3880511_3880880_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23891.1|3881372_3881774_-	YmaF family protein	NA	NA	NA	NA	NA
AVF23892.1|3881985_3882111_+	hypothetical protein	NA	NA	NA	NA	NA
AVF23893.1|3882079_3882547_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23894.1|3883678_3884902_-|transposase	transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
AVF23895.1|3885194_3885410_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23896.1|3885564_3885873_+	helix-turn-helix family protein	NA	O03970	Lactobacillus_phage	34.1	1.5e-10
AVF23897.1|3885990_3886428_+|integrase	integrase	integrase	A0A0C5AN64	Paenibacillus_phage	56.8	1.0e-36
AVF23898.1|3886516_3888145_-	60 kDa chaperonin	NA	A0A219YK78	uncultured_virus	59.1	8.1e-159
AVF23899.1|3888234_3888516_-	10 kDa chaperonin	NA	A0A221S3C8	uncultured_virus	52.2	2.4e-18
AVF23900.1|3888590_3888845_-	hypothetical protein	NA	NA	NA	NA	NA
AVF23901.1|3888837_3889644_-	Sec-independent protein translocase protein TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	27.7	1.5e-12
3894864:3894878	attR	TTATGAAATTGATTC	NA	NA	NA	NA
