The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019700	Helicobacter pylori strain B128_1 chromosome, complete genome	1674002	377556	385673	1674002	tRNA	Tupanvirus(33.33%)	10	NA	NA
AVG73345.1|377556_378285_+	UDP-glucose 4-epimerase GalE	NA	A0A2D2W2J1	Stenotrophomonas_phage	34.2	7.9e-21
AVG73346.1|378218_378590_+	UDP-glucose 4-epimerase	NA	A0A2K9L5H6	Tupanvirus	41.3	2.1e-14
AVG73347.1|378583_379312_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AVG73348.1|379313_380351_-	permease	NA	NA	NA	NA	NA
AVG73349.1|380361_380991_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	39.4	8.0e-22
AVG73350.1|381000_382026_-	ribonucleotide-diphosphate reductase subunit beta	NA	A2PYN0	Cyanophage	34.3	5.5e-52
AVG73351.1|382346_383474_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2K9L0G1	Tupanvirus	28.4	6.7e-27
AVG73352.1|383470_384070_-	Laminin subunit alpha-2 precursor	NA	NA	NA	NA	NA
AVG73353.1|384162_384711_-	restriction endonuclease	NA	NA	NA	NA	NA
AVG73354.1|384710_385673_-	SAM-dependent methyltransferase	NA	A0A076FMQ7	Aureococcus_anophage	42.2	2.7e-53
>prophage 2
CP019700	Helicobacter pylori strain B128_1 chromosome, complete genome	1674002	488979	527504	1674002	protease,integrase,transposase	Helicobacter_phage(40.0%)	36	496017:496036	527340:527359
AVG73428.1|488979_490128_-|transposase	transposase	transposase	G9CU70	Helicobacter_phage	97.6	2.4e-213
AVG73429.1|490096_490564_-|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	98.7	3.0e-82
AVG73430.1|493326_494394_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	26.7	1.3e-08
AVG73431.1|494710_495514_-	hypothetical protein	NA	NA	NA	NA	NA
AVG73432.1|495485_495737_-	hypothetical protein	NA	NA	NA	NA	NA
AVG73433.1|495874_496555_-|protease	CAAX protease	protease	NA	NA	NA	NA
496017:496036	attL	GTAATGCGTGGGCGGTTGTT	NA	NA	NA	NA
AVG73434.1|496775_497789_+	hypothetical protein	NA	NA	NA	NA	NA
AVG73435.1|497793_499071_-	hypothetical protein	NA	NA	NA	NA	NA
AVG73436.1|499067_500324_-	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
AVG73437.1|500320_501754_-	hypothetical protein	NA	NA	NA	NA	NA
AVG73438.1|501763_503791_-	hypothetical protein	NA	NA	NA	NA	NA
AVG73439.1|503790_504843_-	hypothetical protein	NA	NA	NA	NA	NA
AVG73440.1|505644_506313_+	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	33.5	9.1e-24
AVG73441.1|506359_506737_+	hypothetical protein	NA	NA	NA	NA	NA
AVG73442.1|506714_507380_+	hypothetical protein	NA	NA	NA	NA	NA
AVG73443.1|507453_508257_-	hypothetical protein	NA	NA	NA	NA	NA
AVG73444.1|508226_508712_-	hypothetical protein	NA	NA	NA	NA	NA
AVG73445.1|508751_510812_-	DNA topoisomerase I	NA	A0A1V0SB35	Catovirus	28.6	1.7e-57
AVG73446.1|510832_512962_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AVG73447.1|512958_513477_-	replication regulatory RepB family protein	NA	NA	NA	NA	NA
AVG73448.1|513473_514418_-	conjugal transfer protein TrbB	NA	NA	NA	NA	NA
AVG73449.1|514422_514698_-	hypothetical protein	NA	NA	NA	NA	NA
AVG73450.1|514714_515677_-	hypothetical protein	NA	NA	NA	NA	NA
AVG73451.1|515689_517930_-	RGS domain-containing GTPase-activating protein	NA	NA	NA	NA	NA
AVG73452.1|517913_519122_-	hypothetical protein	NA	NA	NA	NA	NA
AVG73453.1|519118_520774_-	type VI secretion protein	NA	NA	NA	NA	NA
AVG73454.1|520770_521907_-	hypothetical protein	NA	NA	NA	NA	NA
AVG73455.1|521899_522040_-	type IV secretion system protein VirB7	NA	NA	NA	NA	NA
AVG73456.1|522036_524613_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
AVG73457.1|524612_524849_-	hypothetical protein	NA	NA	NA	NA	NA
AVG73458.1|524860_525124_-	competence protein ComB	NA	NA	NA	NA	NA
AVG73459.1|525135_525420_-	hypothetical protein	NA	NA	NA	NA	NA
AVG73460.1|525397_525775_-	hypothetical protein	NA	NA	NA	NA	NA
AVG73461.1|525767_525998_-	hypothetical protein	NA	NA	NA	NA	NA
AVG73462.1|526000_526789_-|integrase	integrase	integrase	NA	NA	NA	NA
AVG73463.1|526838_527504_+|protease	CAAX protease	protease	NA	NA	NA	NA
527340:527359	attR	AACAACCGCCCACGCATTAC	NA	NA	NA	NA
