The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024016	Helicobacter pylori strain 7.13_D1b chromosome, complete genome	1674080	489017	527542	1674080	transposase,protease,integrase	Helicobacter_phage(40.0%)	36	496055:496074	527378:527397
AVH01475.1|489017_490166_-|transposase	transposase	transposase	G9CU70	Helicobacter_phage	97.6	2.4e-213
AVH01476.1|490134_490602_-|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	98.7	3.0e-82
AVH01477.1|493364_494432_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	26.7	1.3e-08
AVH01478.1|494748_495552_-	hypothetical protein	NA	NA	NA	NA	NA
AVH01479.1|495523_495775_-	hypothetical protein	NA	NA	NA	NA	NA
AVH01480.1|495912_496593_-|protease	CAAX protease	protease	NA	NA	NA	NA
496055:496074	attL	GTAATGCGTGGGCGGTTGTT	NA	NA	NA	NA
AVH01481.1|496813_497827_+	hypothetical protein	NA	NA	NA	NA	NA
AVH01482.1|497831_499109_-	hypothetical protein	NA	NA	NA	NA	NA
AVH01483.1|499105_500362_-	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
AVH01484.1|500358_501792_-	hypothetical protein	NA	NA	NA	NA	NA
AVH01485.1|501801_503829_-	hypothetical protein	NA	NA	NA	NA	NA
AVH01486.1|503828_504881_-	DUF1738 domain-containing protein	NA	NA	NA	NA	NA
AVH01487.1|505682_506351_+	ParA family protein	NA	A0A222YXS3	Escherichia_phage	33.5	9.1e-24
AVH02466.1|506397_506775_+	hypothetical protein	NA	NA	NA	NA	NA
AVH01488.1|506752_507418_+	hypothetical protein	NA	NA	NA	NA	NA
AVH01489.1|507491_508295_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
AVH01490.1|508264_508750_-	hypothetical protein	NA	NA	NA	NA	NA
AVH01491.1|508789_510850_-	type IA DNA topoisomerase	NA	A0A1V0SB35	Catovirus	28.6	1.7e-57
AVH01492.1|510870_513000_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AVH01493.1|512996_513515_-	replication regulatory RepB family protein	NA	NA	NA	NA	NA
AVH01494.1|513511_514456_-	conjugal transfer protein TrbB	NA	NA	NA	NA	NA
AVH01495.1|514460_514736_-	hypothetical protein	NA	NA	NA	NA	NA
AVH01496.1|514752_515715_-	hypothetical protein	NA	NA	NA	NA	NA
AVH01497.1|515727_517968_-	RGS domain-containing GTPase-activating protein	NA	NA	NA	NA	NA
AVH01498.1|517951_519160_-	hypothetical protein	NA	NA	NA	NA	NA
AVH01499.1|519156_520812_-	type VI secretion protein	NA	NA	NA	NA	NA
AVH01500.1|520808_521945_-	hypothetical protein	NA	NA	NA	NA	NA
AVH01501.1|521937_522078_-	type IV secretion system protein VirB7	NA	NA	NA	NA	NA
AVH01502.1|522074_524651_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
AVH01503.1|524650_524887_-	hypothetical protein	NA	NA	NA	NA	NA
AVH01504.1|524898_525162_-	competence protein ComB	NA	NA	NA	NA	NA
AVH01505.1|525173_525458_-	hypothetical protein	NA	NA	NA	NA	NA
AVH01506.1|525435_525813_-	hypothetical protein	NA	NA	NA	NA	NA
AVH01507.1|525805_526036_-	hypothetical protein	NA	NA	NA	NA	NA
AVH01508.1|526038_526863_-|integrase	integrase	integrase	NA	NA	NA	NA
AVH01509.1|526876_527542_+|protease	CAAX protease	protease	NA	NA	NA	NA
527378:527397	attR	AACAACCGCCCACGCATTAC	NA	NA	NA	NA
