The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024021	Helicobacter pylori strain 7.13_D3a chromosome, complete genome	1674015	488984	527509	1674015	integrase,transposase,protease	Helicobacter_phage(40.0%)	36	496022:496041	527345:527364
AVH08824.1|488984_490133_-|transposase	transposase	transposase	G9CU70	Helicobacter_phage	97.6	2.4e-213
AVH08825.1|490101_490569_-|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	98.7	3.0e-82
AVH08826.1|493331_494399_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	26.7	1.3e-08
AVH08827.1|494715_495519_-	hypothetical protein	NA	NA	NA	NA	NA
AVH08828.1|495490_495742_-	hypothetical protein	NA	NA	NA	NA	NA
AVH08829.1|495879_496560_-|protease	CAAX protease	protease	NA	NA	NA	NA
496022:496041	attL	GTAATGCGTGGGCGGTTGTT	NA	NA	NA	NA
AVH08830.1|496780_497794_+	hypothetical protein	NA	NA	NA	NA	NA
AVH08831.1|497798_499076_-	hypothetical protein	NA	NA	NA	NA	NA
AVH08832.1|499072_500329_-	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
AVH08833.1|500325_501759_-	hypothetical protein	NA	NA	NA	NA	NA
AVH08834.1|501768_503796_-	hypothetical protein	NA	NA	NA	NA	NA
AVH08835.1|503795_504848_-	DUF1738 domain-containing protein	NA	NA	NA	NA	NA
AVH08836.1|505649_506318_+	ParA family protein	NA	A0A222YXS3	Escherichia_phage	33.5	9.1e-24
AVH08837.1|506364_506742_+	hypothetical protein	NA	NA	NA	NA	NA
AVH08838.1|506719_507385_+	hypothetical protein	NA	NA	NA	NA	NA
AVH08839.1|507458_508262_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
AVH08840.1|508231_508717_-	hypothetical protein	NA	NA	NA	NA	NA
AVH08841.1|508756_510817_-	type IA DNA topoisomerase	NA	A0A1V0SB35	Catovirus	28.6	1.7e-57
AVH08842.1|510837_512967_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AVH08843.1|512963_513482_-	replication regulatory RepB family protein	NA	NA	NA	NA	NA
AVH08844.1|513478_514423_-	conjugal transfer protein TrbB	NA	NA	NA	NA	NA
AVH08845.1|514427_514703_-	hypothetical protein	NA	NA	NA	NA	NA
AVH08846.1|514719_515682_-	hypothetical protein	NA	NA	NA	NA	NA
AVH08847.1|515694_517935_-	RGS domain-containing GTPase-activating protein	NA	NA	NA	NA	NA
AVH08848.1|517918_519127_-	hypothetical protein	NA	NA	NA	NA	NA
AVH08849.1|519123_520779_-	type VI secretion protein	NA	NA	NA	NA	NA
AVH08850.1|520775_521912_-	hypothetical protein	NA	NA	NA	NA	NA
AVH08851.1|521904_522045_-	type IV secretion system protein VirB7	NA	NA	NA	NA	NA
AVH08852.1|522041_524618_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
AVH08853.1|524617_524854_-	hypothetical protein	NA	NA	NA	NA	NA
AVH08854.1|524865_525129_-	competence protein ComB	NA	NA	NA	NA	NA
AVH08855.1|525140_525425_-	hypothetical protein	NA	NA	NA	NA	NA
AVH08856.1|525402_525780_-	hypothetical protein	NA	NA	NA	NA	NA
AVH08857.1|525772_526003_-	hypothetical protein	NA	NA	NA	NA	NA
AVH08858.1|526005_526830_-|integrase	integrase	integrase	NA	NA	NA	NA
AVH08859.1|526843_527509_+|protease	CAAX protease	protease	NA	NA	NA	NA
527345:527364	attR	AACAACCGCCCACGCATTAC	NA	NA	NA	NA
