The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024023	Helicobacter pylori isolate 7.13_D3c chromosome, complete genome	1674013	488983	527508	1674013	integrase,protease,transposase	Helicobacter_phage(40.0%)	36	496021:496040	527344:527363
AVH11790.1|488983_490132_-|transposase	transposase	transposase	G9CU70	Helicobacter_phage	97.6	2.4e-213
AVH11791.1|490100_490568_-|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	98.7	3.0e-82
AVH11792.1|493330_494398_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	26.7	1.3e-08
AVH11793.1|494714_495518_-	hypothetical protein	NA	NA	NA	NA	NA
AVH11794.1|495489_495741_-	hypothetical protein	NA	NA	NA	NA	NA
AVH11795.1|495878_496559_-|protease	CAAX protease	protease	NA	NA	NA	NA
496021:496040	attL	GTAATGCGTGGGCGGTTGTT	NA	NA	NA	NA
AVH11796.1|496779_497793_+	hypothetical protein	NA	NA	NA	NA	NA
AVH11797.1|497797_499075_-	hypothetical protein	NA	NA	NA	NA	NA
AVH11798.1|499071_500328_-	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
AVH11799.1|500324_501758_-	hypothetical protein	NA	NA	NA	NA	NA
AVH11800.1|501767_503795_-	hypothetical protein	NA	NA	NA	NA	NA
AVH11801.1|503794_504847_-	DUF1738 domain-containing protein	NA	NA	NA	NA	NA
AVH11802.1|505648_506317_+	ParA family protein	NA	A0A222YXS3	Escherichia_phage	33.5	9.1e-24
AVH11803.1|506363_506741_+	hypothetical protein	NA	NA	NA	NA	NA
AVH11804.1|506718_507384_+	hypothetical protein	NA	NA	NA	NA	NA
AVH11805.1|507457_508261_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
AVH11806.1|508230_508716_-	hypothetical protein	NA	NA	NA	NA	NA
AVH11807.1|508755_510816_-	type IA DNA topoisomerase	NA	A0A1V0SB35	Catovirus	28.6	1.7e-57
AVH11808.1|510836_512966_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AVH11809.1|512962_513481_-	replication regulatory RepB family protein	NA	NA	NA	NA	NA
AVH11810.1|513477_514422_-	conjugal transfer protein TrbB	NA	NA	NA	NA	NA
AVH11811.1|514426_514702_-	hypothetical protein	NA	NA	NA	NA	NA
AVH11812.1|514718_515681_-	hypothetical protein	NA	NA	NA	NA	NA
AVH11813.1|515693_517934_-	RGS domain-containing GTPase-activating protein	NA	NA	NA	NA	NA
AVH11814.1|517917_519126_-	hypothetical protein	NA	NA	NA	NA	NA
AVH11815.1|519122_520778_-	type VI secretion protein	NA	NA	NA	NA	NA
AVH11816.1|520774_521911_-	hypothetical protein	NA	NA	NA	NA	NA
AVH11817.1|521903_522044_-	type IV secretion system protein VirB7	NA	NA	NA	NA	NA
AVH11818.1|522040_524617_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
AVH11819.1|524616_524853_-	hypothetical protein	NA	NA	NA	NA	NA
AVH11820.1|524864_525128_-	competence protein ComB	NA	NA	NA	NA	NA
AVH11821.1|525139_525424_-	hypothetical protein	NA	NA	NA	NA	NA
AVH11822.1|525401_525779_-	hypothetical protein	NA	NA	NA	NA	NA
AVH11823.1|525771_526002_-	hypothetical protein	NA	NA	NA	NA	NA
AVH11824.1|526004_526829_-|integrase	integrase	integrase	NA	NA	NA	NA
AVH11825.1|526842_527508_+|protease	CAAX protease	protease	NA	NA	NA	NA
527344:527363	attR	AACAACCGCCCACGCATTAC	NA	NA	NA	NA
