The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024074	Helicobacter pylori strain 7.13_R2a chromosome, complete genome	1673951	488986	527511	1673951	integrase,protease,transposase	Helicobacter_phage(40.0%)	36	496024:496043	527347:527366
AVG91163.1|488986_490135_-|transposase	transposase	transposase	G9CU70	Helicobacter_phage	97.6	2.4e-213
AVG91164.1|490103_490571_-|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	98.7	3.0e-82
AVG91165.1|493333_494401_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	26.7	1.3e-08
AVG91166.1|494717_495521_-	hypothetical protein	NA	NA	NA	NA	NA
AVG91167.1|495492_495744_-	hypothetical protein	NA	NA	NA	NA	NA
AVG91168.1|495881_496562_-|protease	CAAX protease	protease	NA	NA	NA	NA
496024:496043	attL	GTAATGCGTGGGCGGTTGTT	NA	NA	NA	NA
AVG91169.1|496782_497796_+	hypothetical protein	NA	NA	NA	NA	NA
AVG91170.1|497800_499078_-	hypothetical protein	NA	NA	NA	NA	NA
AVG91171.1|499074_500331_-	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
AVG91172.1|500327_501761_-	hypothetical protein	NA	NA	NA	NA	NA
AVG91173.1|501770_503798_-	hypothetical protein	NA	NA	NA	NA	NA
AVG91174.1|503797_504850_-	DUF1738 domain-containing protein	NA	NA	NA	NA	NA
AVG91175.1|505651_506320_+	ParA family protein	NA	A0A222YXS3	Escherichia_phage	33.5	9.1e-24
AVG91176.1|506366_506744_+	hypothetical protein	NA	NA	NA	NA	NA
AVG91177.1|506721_507387_+	hypothetical protein	NA	NA	NA	NA	NA
AVG91178.1|507460_508264_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
AVG91179.1|508233_508719_-	hypothetical protein	NA	NA	NA	NA	NA
AVG91180.1|508758_510819_-	type IA DNA topoisomerase	NA	A0A1V0SB35	Catovirus	28.6	1.7e-57
AVG91181.1|510839_512969_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AVG91182.1|512965_513484_-	replication regulatory RepB family protein	NA	NA	NA	NA	NA
AVG91183.1|513480_514425_-	conjugal transfer protein TrbB	NA	NA	NA	NA	NA
AVG91184.1|514429_514705_-	hypothetical protein	NA	NA	NA	NA	NA
AVG91185.1|514721_515684_-	hypothetical protein	NA	NA	NA	NA	NA
AVG91186.1|515696_517937_-	RGS domain-containing GTPase-activating protein	NA	NA	NA	NA	NA
AVG91187.1|517920_519129_-	hypothetical protein	NA	NA	NA	NA	NA
AVG91188.1|519125_520781_-	type VI secretion protein	NA	NA	NA	NA	NA
AVG91189.1|520777_521914_-	hypothetical protein	NA	NA	NA	NA	NA
AVG91190.1|521906_522047_-	type IV secretion system protein VirB7	NA	NA	NA	NA	NA
AVG91191.1|522043_524620_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
AVG91192.1|524619_524856_-	hypothetical protein	NA	NA	NA	NA	NA
AVG91193.1|524867_525131_-	competence protein ComB	NA	NA	NA	NA	NA
AVG91194.1|525142_525427_-	hypothetical protein	NA	NA	NA	NA	NA
AVG91195.1|525404_525782_-	hypothetical protein	NA	NA	NA	NA	NA
AVG91196.1|525774_526005_-	hypothetical protein	NA	NA	NA	NA	NA
AVG91197.1|526007_526832_-|integrase	integrase	integrase	NA	NA	NA	NA
AVG91198.1|526845_527511_+|protease	CAAX protease	protease	NA	NA	NA	NA
527347:527366	attR	AACAACCGCCCACGCATTAC	NA	NA	NA	NA
