The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024077	Helicobacter pylori strain 7.13_R3a chromosome, complete genome	1674020	488989	527514	1674020	protease,integrase,transposase	Helicobacter_phage(40.0%)	36	496027:496046	527350:527369
AVG95615.1|488989_490138_-|transposase	transposase	transposase	G9CU70	Helicobacter_phage	97.6	2.4e-213
AVG95616.1|490106_490574_-|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	98.7	3.0e-82
AVG95617.1|493336_494404_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	26.7	1.3e-08
AVG95618.1|494720_495524_-	hypothetical protein	NA	NA	NA	NA	NA
AVG95619.1|495495_495747_-	hypothetical protein	NA	NA	NA	NA	NA
AVG95620.1|495884_496565_-|protease	CAAX protease	protease	NA	NA	NA	NA
496027:496046	attL	GTAATGCGTGGGCGGTTGTT	NA	NA	NA	NA
AVG95621.1|496785_497799_+	hypothetical protein	NA	NA	NA	NA	NA
AVG95622.1|497803_499081_-	hypothetical protein	NA	NA	NA	NA	NA
AVG95623.1|499077_500334_-	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
AVG95624.1|500330_501764_-	hypothetical protein	NA	NA	NA	NA	NA
AVG95625.1|501773_503801_-	hypothetical protein	NA	NA	NA	NA	NA
AVG95626.1|503800_504853_-	DUF1738 domain-containing protein	NA	NA	NA	NA	NA
AVG95627.1|505654_506323_+	ParA family protein	NA	A0A222YXS3	Escherichia_phage	33.5	9.1e-24
AVG96618.1|506369_506747_+	hypothetical protein	NA	NA	NA	NA	NA
AVG95628.1|506724_507390_+	hypothetical protein	NA	NA	NA	NA	NA
AVG95629.1|507463_508267_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
AVG95630.1|508236_508722_-	hypothetical protein	NA	NA	NA	NA	NA
AVG95631.1|508761_510822_-	type IA DNA topoisomerase	NA	A0A1V0SB35	Catovirus	28.6	1.7e-57
AVG95632.1|510842_512972_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AVG95633.1|512968_513487_-	replication regulatory RepB family protein	NA	NA	NA	NA	NA
AVG95634.1|513483_514428_-	conjugal transfer protein TrbB	NA	NA	NA	NA	NA
AVG95635.1|514432_514708_-	hypothetical protein	NA	NA	NA	NA	NA
AVG95636.1|514724_515687_-	hypothetical protein	NA	NA	NA	NA	NA
AVG95637.1|515699_517940_-	RGS domain-containing GTPase-activating protein	NA	NA	NA	NA	NA
AVG95638.1|517923_519132_-	hypothetical protein	NA	NA	NA	NA	NA
AVG95639.1|519128_520784_-	type VI secretion protein	NA	NA	NA	NA	NA
AVG95640.1|520780_521917_-	hypothetical protein	NA	NA	NA	NA	NA
AVG95641.1|521909_522050_-	type IV secretion system protein VirB7	NA	NA	NA	NA	NA
AVG95642.1|522046_524623_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
AVG95643.1|524622_524859_-	hypothetical protein	NA	NA	NA	NA	NA
AVG95644.1|524870_525134_-	competence protein ComB	NA	NA	NA	NA	NA
AVG95645.1|525145_525430_-	hypothetical protein	NA	NA	NA	NA	NA
AVG95646.1|525407_525785_-	hypothetical protein	NA	NA	NA	NA	NA
AVG95647.1|525777_526008_-	hypothetical protein	NA	NA	NA	NA	NA
AVG95648.1|526010_526835_-|integrase	integrase	integrase	NA	NA	NA	NA
AVG95649.1|526848_527514_+|protease	CAAX protease	protease	NA	NA	NA	NA
527350:527369	attR	AACAACCGCCCACGCATTAC	NA	NA	NA	NA
