The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024075	Helicobacter pylori strain 7.13_R2b chromosome, complete genome	1674026	488993	527518	1674026	integrase,protease,transposase	Helicobacter_phage(40.0%)	36	496031:496050	527354:527373
AVG92646.1|488993_490142_-|transposase	transposase	transposase	G9CU70	Helicobacter_phage	97.6	2.4e-213
AVG92647.1|490110_490578_-|transposase	IS200/IS605 family transposase	transposase	G9CU69	Helicobacter_phage	98.7	3.0e-82
AVG92648.1|493340_494408_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	26.7	1.3e-08
AVG92649.1|494724_495528_-	hypothetical protein	NA	NA	NA	NA	NA
AVG92650.1|495499_495751_-	hypothetical protein	NA	NA	NA	NA	NA
AVG92651.1|495888_496569_-|protease	CAAX protease	protease	NA	NA	NA	NA
496031:496050	attL	GTAATGCGTGGGCGGTTGTT	NA	NA	NA	NA
AVG92652.1|496789_497803_+	hypothetical protein	NA	NA	NA	NA	NA
AVG92653.1|497807_499085_-	hypothetical protein	NA	NA	NA	NA	NA
AVG92654.1|499081_500338_-	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
AVG92655.1|500334_501768_-	hypothetical protein	NA	NA	NA	NA	NA
AVG92656.1|501777_503805_-	hypothetical protein	NA	NA	NA	NA	NA
AVG92657.1|503804_504857_-	DUF1738 domain-containing protein	NA	NA	NA	NA	NA
AVG92658.1|505658_506327_+	ParA family protein	NA	A0A222YXS3	Escherichia_phage	33.5	9.1e-24
AVG92659.1|506373_506751_+	hypothetical protein	NA	NA	NA	NA	NA
AVG92660.1|506728_507394_+	hypothetical protein	NA	NA	NA	NA	NA
AVG92661.1|507467_508271_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
AVG92662.1|508240_508726_-	hypothetical protein	NA	NA	NA	NA	NA
AVG92663.1|508765_510826_-	type IA DNA topoisomerase	NA	A0A1V0SB35	Catovirus	28.6	1.7e-57
AVG92664.1|510846_512976_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AVG92665.1|512972_513491_-	replication regulatory RepB family protein	NA	NA	NA	NA	NA
AVG92666.1|513487_514432_-	conjugal transfer protein TrbB	NA	NA	NA	NA	NA
AVG92667.1|514436_514712_-	hypothetical protein	NA	NA	NA	NA	NA
AVG92668.1|514728_515691_-	hypothetical protein	NA	NA	NA	NA	NA
AVG92669.1|515703_517944_-	RGS domain-containing GTPase-activating protein	NA	NA	NA	NA	NA
AVG92670.1|517927_519136_-	hypothetical protein	NA	NA	NA	NA	NA
AVG92671.1|519132_520788_-	type VI secretion protein	NA	NA	NA	NA	NA
AVG92672.1|520784_521921_-	hypothetical protein	NA	NA	NA	NA	NA
AVG92673.1|521913_522054_-	type IV secretion system protein VirB7	NA	NA	NA	NA	NA
AVG92674.1|522050_524627_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
AVG92675.1|524626_524863_-	hypothetical protein	NA	NA	NA	NA	NA
AVG92676.1|524874_525138_-	competence protein ComB	NA	NA	NA	NA	NA
AVG92677.1|525149_525434_-	hypothetical protein	NA	NA	NA	NA	NA
AVG92678.1|525411_525789_-	hypothetical protein	NA	NA	NA	NA	NA
AVG92679.1|525781_526012_-	hypothetical protein	NA	NA	NA	NA	NA
AVG92680.1|526014_526839_-|integrase	integrase	integrase	NA	NA	NA	NA
AVG92681.1|526852_527518_+|protease	CAAX protease	protease	NA	NA	NA	NA
527354:527373	attR	AACAACCGCCCACGCATTAC	NA	NA	NA	NA
