The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	848775	857379	5052887		Stx2-converting_phage(40.0%)	12	NA	NA
AUX01104.1|848775_849102_+	Mobile element protein	NA	Q6H9S4	Enterobacteria_phage	97.2	7.0e-54
AUX01105.1|849101_849458_+	Mobile element protein	NA	Q6H9S3	Enterobacteria_phage	100.0	9.4e-36
AUX01106.1|849469_849988_+	Mobile element protein	NA	Q6H9S3	Enterobacteria_phage	97.7	3.8e-94
AUX01107.1|850162_851122_-	Mobile element protein	NA	NA	NA	NA	NA
AUX01108.1|851296_851500_-	Mobile element protein	NA	NA	NA	NA	NA
AUX01109.1|851736_852048_+	Mobile element protein	NA	Q716C1	Shigella_phage	40.8	2.4e-11
AUX01110.1|852167_852914_+	Mobile element protein	NA	Q716C2	Shigella_phage	59.0	2.5e-83
AUX01111.1|853092_854085_-	Mobile element protein	NA	A0A0P0ZEB3	Stx2-converting_phage	45.5	9.6e-54
AUX01112.1|854104_854452_-	Mobile element protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
AUX01113.1|854448_855123_-	Mobile element protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
AUX01114.1|855376_855997_+	Mobile element protein	NA	A0A0P0ZBS5	Stx2-converting_phage	99.0	4.7e-115
AUX01115.1|856113_857379_-	Mobile element protein	NA	A0A1B0VMI6	Pseudomonas_phage	43.1	1.2e-80
>prophage 2
CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	1126089	1134006	5052887		Escherichia_phage(71.43%)	7	NA	NA
AUX01377.1|1126089_1126686_-	Ribulose-5-phosphate 4-epimerase and related epimerase and aldolase	NA	A0A077SK32	Escherichia_phage	74.6	2.3e-79
AUX01378.1|1126724_1127987_-	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AUX01379.1|1127983_1128892_-	D-beta-hydroxybutyrate dehydrogenase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AUX01380.1|1129087_1129855_+	hypothetical protein	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AUX01381.1|1130112_1130616_+	Mobile element protein	NA	U5P0U6	Shigella_phage	98.8	8.2e-94
AUX01382.1|1130682_1131339_-	Serine/threonine protein phosphatase 2	NA	A0A222YWF0	Escherichia_phage	47.9	1.1e-50
AUX01383.1|1131444_1134006_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	1.0e-30
>prophage 3
CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	1170907	1281111	5052887	capsid,plate,portal,tRNA,tail	Shigella_phage(34.62%)	113	NA	NA
AUX01422.1|1170907_1173427_+|tRNA	Alanyl-tRNA synthetase	tRNA	A0A2K9L1X7	Tupanvirus	38.3	8.9e-72
AUX01423.1|1173661_1173847_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AUX01424.1|1175439_1176006_+	Putative phosphatase YqaB	NA	NA	NA	NA	NA
AUX01425.1|1176002_1176431_+	Putative membrane protein	NA	NA	NA	NA	NA
AUX01426.1|1176503_1178060_+	Glutamate--cysteine ligase	NA	NA	NA	NA	NA
AUX01427.1|1178209_1178725_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
AUX01428.1|1178788_1180327_-	Multidrug resistance protein B	NA	NA	NA	NA	NA
AUX01429.1|1180343_1181516_-	Multidrug resistance protein A (ErmA)	NA	NA	NA	NA	NA
AUX01430.1|1181642_1182068_-	Transcription repressor of tripartite multidrug resistance system	NA	NA	NA	NA	NA
AUX01431.1|1182263_1182599_-	Branched-chain amino acid transport, AzlD	NA	NA	NA	NA	NA
AUX01432.1|1182588_1183281_-	hypothetical protein	NA	NA	NA	NA	NA
AUX01433.1|1183449_1184634_-	MFS permease protein	NA	NA	NA	NA	NA
AUX01434.1|1184925_1185918_-	hypothetical protein	NA	NA	NA	NA	NA
AUX01435.1|1185974_1187039_-	L-proline glycine betaine ABC transport system permease protein ProW	NA	NA	NA	NA	NA
AUX01436.1|1187031_1188234_-	L-proline glycine betaine ABC transport system permease protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
AUX01437.1|1188588_1189086_-	Ribonucleotide reductase of class Ib (aerobic), beta subunit	NA	A0A0N7CCA3	Skermania_phage	74.8	1.2e-65
AUX01438.1|1189101_1189548_-	Ribonucleotide reductase of class Ib (aerobic), beta subunit	NA	R4TBI6	Mycobacterium_phage	72.3	2.2e-58
AUX01439.1|1189557_1191663_-	Ribonucleotide reductase of class Ib (aerobic), alpha subunit	NA	A8E2R1	Enterococcus_phage	47.8	7.7e-194
AUX01440.1|1191674_1192085_-	Ribonucleotide reduction protein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
AUX01441.1|1192081_1192327_-	Glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
AUX01442.1|1192574_1192904_-	hypothetical protein	NA	NA	NA	NA	NA
AUX01443.1|1193055_1193400_+	hypothetical protein	NA	NA	NA	NA	NA
AUX01444.1|1193435_1193885_-	Putative inner membrane protein	NA	NA	NA	NA	NA
AUX01445.1|1194552_1194957_+	DNA-binding protein H-NS	NA	NA	NA	NA	NA
AUX01446.1|1195003_1195528_-	Rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
AUX01447.1|1195537_1195837_-	Transcriptional regulator, ArsR family	NA	NA	NA	NA	NA
AUX01448.1|1196019_1196178_+	hypothetical protein	NA	NA	NA	NA	NA
AUX01449.1|1196261_1196711_+	hypothetical protein	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
AUX01450.1|1196711_1197374_-	CsiR, transcriptional repressor of CsiD	NA	NA	NA	NA	NA
AUX01451.1|1197394_1198795_-	gamma-aminobutyrate (GABA) permease	NA	NA	NA	NA	NA
AUX01452.1|1199105_1200386_-	Gamma-aminobutyrate:alpha-ketoglutarate aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
AUX01453.1|1200399_1201848_-	hypothetical protein	NA	NA	NA	NA	NA
AUX01454.1|1201870_1203139_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
AUX01455.1|1203157_1204135_-	Carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
AUX01456.1|1204469_1206722_-	Alpha-amylase	NA	NA	NA	NA	NA
AUX01457.1|1208108_1208570_+	hypothetical protein	NA	NA	NA	NA	NA
AUX01458.1|1208737_1209481_+	hypothetical protein	NA	NA	NA	NA	NA
AUX01459.1|1209911_1210124_+	hypothetical protein	NA	NA	NA	NA	NA
AUX01460.1|1210833_1211580_-	Mobile element protein	NA	Q716C2	Shigella_phage	59.0	2.5e-83
AUX01461.1|1211699_1212011_-	Mobile element protein	NA	Q716C1	Shigella_phage	40.8	2.4e-11
AUX01462.1|1212070_1212562_+|portal	Phage portal protein	portal	Q8HAD4	Salmonella_phage	97.3	5.0e-80
AUX01463.1|1212612_1213125_+|portal	phage portal protein, HK97 family	portal	U5P411	Shigella_phage	100.0	1.7e-94
AUX01464.1|1213102_1213753_+	hypothetical protein	NA	U5P4H2	Shigella_phage	100.0	2.5e-119
AUX01465.1|1213767_1214973_+|capsid	Phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
AUX01466.1|1215022_1215223_+	Putative bacteriophage protein	NA	S5FNU1	Shigella_phage	97.0	8.4e-26
AUX01467.1|1215225_1215549_+	hypothetical protein	NA	U5P072	Shigella_phage	99.1	1.1e-56
AUX01468.1|1215545_1215956_+	Sb9	NA	M1FJ87	Enterobacteria_phage	97.1	1.7e-73
AUX01469.1|1215930_1216437_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	89.9	8.9e-80
AUX01470.1|1216433_1216994_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.9	1.5e-104
AUX01471.1|1217002_1217173_+	Mu-like prophage FluMu protein GP38	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
AUX01472.1|1217156_1218653_+|tail	Bacteriophage tail sheath protein	tail	S5FKL0	Shigella_phage	99.0	1.2e-276
AUX01473.1|1218652_1219009_+|tail	Phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
AUX01474.1|1219008_1219278_+	hypothetical protein	NA	S5FNR3	Shigella_phage	100.0	3.5e-43
AUX01475.1|1219419_1221252_+|tail	Phage tail length tape-measure protein	tail	Q8SBG9	Shigella_phage	97.2	1.2e-299
AUX01476.1|1221374_1221875_+	hypothetical protein	NA	NA	NA	NA	NA
AUX01477.1|1221978_1223265_+|tail	Phage tail/DNA circulation protein	tail	Q8SBG8	Shigella_phage	98.4	5.0e-236
AUX01478.1|1223261_1224341_+|tail	Prophage tail protein	tail	U5P0H6	Shigella_phage	99.7	9.1e-207
AUX01479.1|1224340_1224889_+|plate	Prophage baseplate assembly protein V	plate	Q8SBG6	Shigella_phage	100.0	2.3e-97
AUX01480.1|1224888_1225314_+	Bacteriophage protein GP46	NA	U5P0R9	Shigella_phage	98.6	5.7e-80
AUX01481.1|1225300_1226359_+	Phage FluMu protein gp47	NA	Q8SBG4	Shigella_phage	98.6	8.1e-200
AUX01482.1|1226349_1226934_+	hypothetical protein	NA	O22003	Shigella_phage	99.5	4.1e-113
AUX01483.1|1226937_1227600_+|tail	Phage tail fiber protein	tail	M1FN94	Enterobacteria_phage	67.3	8.1e-65
AUX01484.1|1227596_1228016_+	Tail fiber assembly protein	NA	M1SNQ2	Escherichia_phage	64.7	3.8e-36
AUX01485.1|1228046_1228382_-|tail	Phage tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	40.8	6.6e-07
AUX01486.1|1228390_1228795_-|tail	Phage tail fiber protein	tail	M1FN94	Enterobacteria_phage	42.3	4.7e-15
AUX01487.1|1228825_1229392_+	Phage DNA invertase	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
AUX01488.1|1229534_1230707_+|tail	Phage tail sheath monomer	tail	A0A1S6KZY7	Salmonella_phage	90.0	1.3e-203
AUX01489.1|1230716_1231232_+|tail	Phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
AUX01490.1|1231286_1231589_+	Tail protein	NA	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AUX01491.1|1231715_1234793_+	hypothetical protein	NA	E5G6Q1	Salmonella_phage	69.6	0.0e+00
AUX01492.1|1234789_1235275_+|tail	Phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
AUX01493.1|1235271_1236372_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	7.6e-177
AUX01494.1|1236685_1237168_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	4.6e-17
AUX01495.1|1237868_1238351_-	tmRNA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
AUX01496.1|1238482_1238959_+	Putative oligoketide cyclase/lipid transport protein	NA	NA	NA	NA	NA
AUX01497.1|1238948_1239239_+	hypothetical protein	NA	NA	NA	NA	NA
AUX01498.1|1239300_1239642_-	Outer membrane lipoprotein SmpA	NA	NA	NA	NA	NA
AUX01499.1|1239790_1241452_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AUX01500.1|1241537_1242344_-	hypothetical protein	NA	NA	NA	NA	NA
AUX01501.1|1242377_1242542_+	Heat shock protein GrpE	NA	NA	NA	NA	NA
AUX01502.1|1242538_1243132_+	Heat shock protein GrpE	NA	NA	NA	NA	NA
AUX01503.1|1243186_1244449_-	CBS/transporter associated domain protein	NA	NA	NA	NA	NA
AUX01504.1|1244493_1245360_-	Glutamate synthase [NADPH] small chain	NA	NA	NA	NA	NA
AUX01505.1|1245451_1246813_+	Signal recognition particle, subunit Ffh SRP54	NA	NA	NA	NA	NA
AUX01506.1|1246949_1247198_+	SSU ribosomal protein S16p	NA	NA	NA	NA	NA
AUX01507.1|1247216_1247765_+	16S rRNA-processing protein M	NA	NA	NA	NA	NA
AUX01508.1|1247795_1248563_+|tRNA	tRNA (Guanine37-N1) -methyltransferase	tRNA	NA	NA	NA	NA
AUX01509.1|1248604_1248952_+	LSU ribosomal protein L19p	NA	NA	NA	NA	NA
AUX01510.1|1249028_1249511_-	Integral membrane protein YfiB	NA	NA	NA	NA	NA
AUX01511.1|1249526_1250753_-	Inner membrane protein YfiN	NA	NA	NA	NA	NA
AUX01512.1|1250742_1251261_-	hypothetical protein	NA	NA	NA	NA	NA
AUX01513.1|1251410_1251776_-	hypothetical protein	NA	NA	NA	NA	NA
AUX01514.1|1251985_1253056_+	2-keto-3-deoxy-D-arabino-heptulosonate-7- phosphate synthase I alpha	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	1.2e-89
AUX01515.1|1253066_1254188_+	Chorismate mutase I	NA	NA	NA	NA	NA
AUX01516.1|1254230_1255391_-	Chorismate mutase I	NA	NA	NA	NA	NA
AUX01517.1|1255640_1255982_-	Ribosome hibernation protein YfiA	NA	NA	NA	NA	NA
AUX01518.1|1256252_1256990_-	outer membrane biogenesis protein BamD	NA	NA	NA	NA	NA
AUX01519.1|1257124_1258105_+	23S rRNA pseudouridine synthase D	NA	NA	NA	NA	NA
AUX01520.1|1258101_1258833_+	hypothetical protein	NA	NA	NA	NA	NA
AUX01521.1|1258962_1261536_+	ClpB protein	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
AUX01522.1|1267391_1268690_+	Alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
AUX01523.1|1268686_1268959_-	Putative outer membrane lipoprotein	NA	NA	NA	NA	NA
AUX01524.1|1269055_1270411_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AUX01525.1|1270524_1273185_-	Protein acetyltransferase	NA	NA	NA	NA	NA
AUX01526.1|1273216_1273939_-	hypothetical protein	NA	NA	NA	NA	NA
AUX01527.1|1273983_1274403_-	Thioredoxin 2	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AUX01528.1|1274609_1275647_+	methyltransferase	NA	NA	NA	NA	NA
AUX01529.1|1275694_1276384_-	Uracil-DNA glycosylase, family 1	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
AUX01530.1|1276688_1277072_+	Pyruvate formate-lyase	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
AUX01531.1|1277127_1277715_-	Transporter, LysE family	NA	NA	NA	NA	NA
AUX01532.1|1277772_1278699_+	LysR family transcriptional regulator YfiE	NA	NA	NA	NA	NA
AUX01533.1|1278907_1280242_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
AUX01534.1|1280337_1281111_+|tRNA	tRNA (adenine37-N(6))-methyltransferase TrmN6	tRNA	NA	NA	NA	NA
>prophage 4
CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	1677897	1729590	5052887	protease,portal,integrase,tail,holin,terminase	Enterobacteria_phage(54.0%)	71	1676519:1676544	1684765:1684790
1676519:1676544	attL	CCGTATAACTAAACGTATAACTAAAA	NA	NA	NA	NA
AUX01894.1|1677897_1678386_-|terminase	Phage terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	41.7	3.9e-24
AUX01895.1|1678513_1678675_-	hypothetical protein	NA	NA	NA	NA	NA
AUX01896.1|1678678_1678873_-	hypothetical protein	NA	NA	NA	NA	NA
AUX01897.1|1679003_1679249_-	hypothetical protein	NA	NA	NA	NA	NA
AUX01898.1|1679245_1679470_-	hypothetical protein	NA	NA	NA	NA	NA
AUX01899.1|1679450_1680851_-	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
AUX01900.1|1680847_1681147_-	hypothetical protein	NA	NA	NA	NA	NA
AUX01901.1|1681152_1681386_-	hypothetical protein	NA	NA	NA	NA	NA
AUX01902.1|1681387_1681609_-	hypothetical protein	NA	NA	NA	NA	NA
AUX01903.1|1681581_1681824_-	hypothetical protein	NA	NA	NA	NA	NA
AUX01904.1|1682198_1682378_+	hypothetical protein	NA	NA	NA	NA	NA
AUX01905.1|1682757_1682964_-	transcriptional regulator	NA	NA	NA	NA	NA
AUX01906.1|1683131_1683362_-	hypothetical protein	NA	NA	NA	NA	NA
AUX01907.1|1683460_1684702_-|integrase	Prophage CP4-57 integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.2e-98
AUX01908.1|1685404_1686172_+	hypothetical protein	NA	NA	NA	NA	NA
1684765:1684790	attR	CCGTATAACTAAACGTATAACTAAAA	NA	NA	NA	NA
AUX01909.1|1686161_1686545_+	hypothetical protein	NA	NA	NA	NA	NA
AUX01910.1|1687028_1687985_+	hypothetical protein	NA	NA	NA	NA	NA
AUX01911.1|1688122_1689301_-	Mobile element protein	NA	A0A2D1GN00	Marinobacter_phage	30.6	2.7e-31
AUX01912.1|1689303_1689513_-	hypothetical protein	NA	NA	NA	NA	NA
AUX01913.1|1689574_1689790_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	92.1	3.7e-27
AUX01914.1|1689580_1689829_+	hypothetical protein	NA	NA	NA	NA	NA
AUX01915.1|1689786_1690128_-	Eae protein	NA	K7PH61	Enterobacteria_phage	99.1	3.0e-63
AUX01916.1|1690139_1690676_-	hypothetical protein	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
AUX01917.1|1690803_1691628_-	hypothetical protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AUX01918.1|1691693_1692056_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AUX01919.1|1692758_1693406_-	regulatory protein	NA	K7PKK1	Enterobacteria_phage	99.5	2.3e-117
AUX01920.1|1693548_1693809_+	hypothetical protein	NA	K7PJQ8	Enterobacteria_phage	98.8	7.1e-41
AUX01921.1|1693801_1694353_+	hypothetical protein	NA	U5P4K1	Shigella_phage	98.9	3.8e-100
AUX01922.1|1694349_1694688_+	hypothetical protein	NA	U5P0J9	Shigella_phage	97.3	1.1e-54
AUX01923.1|1694697_1695654_+	Primosomal protein I	NA	U5P0A0	Shigella_phage	91.5	6.1e-138
AUX01924.1|1695656_1696103_+	perC transcriptional activator family protein	NA	U5P0U0	Shigella_phage	95.3	2.9e-74
AUX01925.1|1696142_1697030_-	Mobile element protein	NA	Q6H9S6	Enterobacteria_phage	98.0	9.8e-167
AUX01926.1|1697029_1697356_-	Mobile element protein	NA	Q6H9S4	Enterobacteria_phage	97.2	7.0e-54
AUX01927.1|1697457_1698111_+	DNA adenine methylase	NA	A5LH72	Enterobacteria_phage	98.6	4.7e-126
AUX01928.1|1698107_1698434_+|protease	SOS-response repressor and protease LexA	protease	A0A291AWY9	Escherichia_phage	98.1	3.5e-53
AUX01929.1|1698430_1698820_+	Holliday junction resolvase / Crossover junction endodeoxyribonuclease rusA	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
AUX01930.1|1698839_1699649_+	Phage-related protein	NA	Q8SBE6	Shigella_phage	98.1	1.1e-151
AUX01931.1|1699656_1700646_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	98.5	1.8e-193
AUX01932.1|1700663_1701026_+	Phage antitermination protein Q	NA	A5LH77	Enterobacteria_phage	89.2	2.9e-56
AUX01933.1|1701044_1701458_-	hypothetical protein	NA	NA	NA	NA	NA
AUX01934.1|1701450_1701711_-	hypothetical protein	NA	NA	NA	NA	NA
AUX01935.1|1701720_1702584_-	hypothetical protein	NA	NA	NA	NA	NA
AUX01936.1|1702859_1703063_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
AUX01937.1|1703213_1704266_+	hypothetical protein	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
AUX01938.1|1704333_1704549_+|holin	Phage holin	holin	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AUX01939.1|1704548_1705046_+	hypothetical protein	NA	A5LH83	Enterobacteria_phage	97.6	7.1e-90
AUX01940.1|1705042_1705504_+	Phage endopeptidase	NA	A0A0K2FJD0	Enterobacteria_phage	66.4	7.6e-46
AUX01941.1|1705543_1705783_+	hypothetical protein	NA	NA	NA	NA	NA
AUX01942.1|1706462_1706954_+	hypothetical protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
AUX01943.1|1706953_1709056_+	hypothetical protein	NA	A0A291AWY5	Escherichia_phage	97.1	0.0e+00
AUX01944.1|1709052_1709265_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AUX01945.1|1709264_1710740_+|portal	Phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	1.6e-283
AUX01946.1|1710786_1712745_+	hypothetical protein	NA	A5LH30	Enterobacteria_phage	99.8	0.0e+00
AUX01947.1|1712831_1713155_+	hypothetical protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
AUX01948.1|1713147_1713423_+	hypothetical protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AUX01949.1|1713434_1714013_+|tail	Phage tail completion protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
AUX01950.1|1714009_1714411_+|tail	Phage minor tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
AUX01951.1|1714422_1715166_+|tail	Phage tail assembly	tail	A0A291AWU6	Escherichia_phage	98.4	7.3e-131
AUX01952.1|1715226_1715613_+|tail	Phage minor tail protein	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
AUX01953.1|1715675_1715951_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	1.3e-45
AUX01954.1|1715922_1718997_+|tail	Phage tail length tape-measure protein 1	tail	A0A291AWX1	Escherichia_phage	94.8	0.0e+00
AUX01955.1|1718993_1719323_+|tail	Phage minor tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	7.6e-56
AUX01956.1|1719322_1720021_+|tail	Phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	2.0e-130
AUX01957.1|1720170_1720770_+|tail	Phage tail assembly protein	tail	A5LH41	Enterobacteria_phage	93.5	1.7e-114
AUX01958.1|1720802_1721315_+|tail	Phage tail assembly protein I	tail	K7PH50	Enterobacteria_phage	96.4	1.9e-85
AUX01959.1|1721375_1724873_+|tail	Phage tail fiber protein	tail	A5LH43	Enterobacteria_phage	97.4	0.0e+00
AUX01960.1|1724943_1725543_+	hypothetical protein	NA	A5LH44	Enterobacteria_phage	97.0	4.1e-108
AUX01961.1|1725543_1725717_-	hypothetical protein	NA	Q6H9T0	Enterobacteria_phage	100.0	1.9e-26
AUX01962.1|1726104_1726842_-|tail	Phage tail fiber protein	tail	NA	NA	NA	NA
AUX01963.1|1726972_1729006_+|tail	Phage tail fiber protein	tail	X2KTY7	Enterobacteria_phage	57.4	1.3e-198
AUX01964.1|1729005_1729590_+|tail	Phage tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	6.0e-104
>prophage 5
CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	1801452	1810894	5052887	lysis	Enterobacteria_phage(85.71%)	9	NA	NA
AUX02028.1|1801452_1802379_+	Osmoprotectant ABC transporter ATP-binding subunit YehX	NA	G3M9Y6	Bacillus_virus	30.3	3.1e-22
AUX02029.1|1802383_1803115_+	Osmoprotectant ABC transporter inner membrane protein YehW	NA	NA	NA	NA	NA
AUX02030.1|1803262_1803994_-	HTH-type transcriptional regulator mlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AUX02031.1|1804215_1805901_+|lysis	Autolysis histidine kinase LytS	lysis	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AUX02032.1|1805897_1806617_+	Two-component response-regulatory protein YehT	NA	NA	NA	NA	NA
AUX02033.1|1806663_1807134_+	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AUX02034.1|1807174_1807636_-	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AUX02035.1|1807760_1809761_-	YehQ protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
AUX02036.1|1809757_1810894_-	Mg-chelatase subunit ChlD	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 6
CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	2351683	2409073	5052887	capsid,portal,integrase,tail,terminase	Enterobacteria_phage(36.21%)	69	2348002:2348016	2380437:2380451
2348002:2348016	attL	ATCAGCGCCAGAACG	NA	NA	NA	NA
AUX02543.1|2351683_2354110_-	hypothetical protein	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
AUX02544.1|2354308_2354614_-	hypothetical protein	NA	NA	NA	NA	NA
AUX02545.1|2354808_2355432_+	lipoprotein	NA	NA	NA	NA	NA
AUX02546.1|2355434_2355995_-	Spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AUX02547.1|2356029_2356371_-	putative secreted protein	NA	NA	NA	NA	NA
AUX02548.1|2356505_2356832_+	hypothetical protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AUX02549.1|2357037_2358252_+	Starvation sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AUX02550.1|2358263_2359283_+	Starvation sensing protein RspB	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
AUX02551.1|2359470_2360751_-|integrase	putative integrase	integrase	B6DZ48	Enterobacteria_phage	62.2	9.6e-155
AUX02552.1|2360785_2361022_-	Putative excisionase	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
AUX02553.1|2361109_2363554_-	Exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	58.5	2.2e-176
AUX02554.1|2363646_2363835_-	hypothetical protein	NA	NA	NA	NA	NA
AUX02555.1|2363831_2364020_-	division inhibition protein dicB	NA	NA	NA	NA	NA
AUX02556.1|2364584_2364794_+	hypothetical protein	NA	NA	NA	NA	NA
AUX02557.1|2364794_2365433_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
AUX02558.1|2365444_2365678_-	Mobile element protein	NA	M4QQ57	Salicola_phage	55.3	1.6e-07
AUX02559.1|2365862_2366117_-	hypothetical protein	NA	NA	NA	NA	NA
AUX02560.1|2366382_2366664_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
AUX02561.1|2366647_2367073_+	Phage or Prophage Related	NA	NA	NA	NA	NA
AUX02562.1|2367170_2368049_+	Primosomal protein I	NA	U5P0A0	Shigella_phage	50.7	2.0e-63
AUX02563.1|2368055_2368796_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
AUX02564.1|2368825_2369596_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	66.8	1.1e-84
AUX02565.1|2369611_2370007_+	LygF protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
AUX02566.1|2370063_2370420_+	Phage protein	NA	A0A2R2Z307	Escherichia_phage	94.1	1.4e-55
AUX02567.1|2370468_2370651_+	Phage protein	NA	A0A2R2Z310	Escherichia_phage	86.4	2.9e-25
AUX02568.1|2370628_2371303_+	hypothetical protein	NA	A0A0P0ZD75	Stx2-converting_phage	86.1	1.2e-34
AUX02569.1|2371712_2371925_+	hok/gef family protein	NA	A0A0U2QV81	Escherichia_phage	92.9	6.8e-26
AUX02570.1|2372110_2372290_-	hypothetical protein	NA	NA	NA	NA	NA
AUX02571.1|2372372_2373422_+	Phage antitermination protein Q	NA	U5P0K4	Shigella_phage	53.7	1.9e-108
AUX02572.1|2373434_2373809_+	Holliday junction resolvase / Crossover junction endodeoxyribonuclease rusA	NA	V5URS4	Shigella_phage	62.7	4.2e-34
AUX02573.1|2373805_2374627_+	Phage antitermination protein Q	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
AUX02574.1|2374853_2375051_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
AUX02575.1|2375201_2376260_+	DNA methyl transferase, phage-associated	NA	S5MDR0	Escherichia_phage	89.9	9.2e-188
AUX02576.1|2376702_2377134_+	hypothetical protein	NA	H6WZJ6	Escherichia_phage	98.6	6.0e-69
AUX02577.1|2377130_2377298_+	hypothetical protein	NA	H6WZJ7	Escherichia_phage	74.5	1.1e-10
AUX02578.1|2377705_2379307_+	Mobile element protein	NA	B6DZ89	Enterobacteria_phage	98.9	1.7e-310
AUX02579.1|2379795_2380002_+	hypothetical protein	NA	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
AUX02580.1|2380006_2380351_+	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
AUX02581.1|2380401_2380935_+	hypothetical protein	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
2380437:2380451	attR	CGTTCTGGCGCTGAT	NA	NA	NA	NA
AUX02582.1|2381233_2381701_+	hypothetical protein	NA	Q7AYI6	Enterobacteria_phage	96.1	1.8e-74
AUX02583.1|2382142_2382688_+	Terminase small subunit	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AUX02584.1|2382662_2384588_+|terminase	Phage terminase, large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	98.9	0.0e+00
AUX02585.1|2384584_2384791_+	hypothetical protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
AUX02586.1|2384787_2386389_+|portal	Phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.3e-307
AUX02587.1|2386369_2387689_+|capsid	Phage capsid and scaffold	capsid	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
AUX02588.1|2387698_2388031_+	Head decoration protein	NA	A0A2R9YJN3	Escherichia_phage	97.3	9.3e-54
AUX02589.1|2388086_2389112_+|capsid	Phage major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
AUX02590.1|2389153_2389549_+	Phage DNA-packaging protein	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
AUX02591.1|2389560_2389914_+|capsid	Phage capsid and scaffold	capsid	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
AUX02592.1|2389925_2390504_+	hypothetical protein	NA	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
AUX02593.1|2390500_2390896_+|tail	Phage minor tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
AUX02594.1|2390903_2391656_+|tail	Phage minor tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
AUX02595.1|2391669_2392074_+|tail	Phage minor tail protein	tail	Q687F5	Enterobacteria_phage	92.9	1.1e-64
AUX02596.1|2392124_2392514_+|tail	Phage minor tail protein	tail	Q687F4	Enterobacteria_phage	82.8	2.2e-38
AUX02597.1|2392494_2395107_+|tail	Phage tail length tape-measure protein	tail	Q687F3	Enterobacteria_phage	96.2	0.0e+00
AUX02598.1|2395103_2395433_+|tail	Phage minor tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AUX02599.1|2395432_2396131_+|tail	Phage minor tail protein	tail	Q687F1	Enterobacteria_phage	98.7	8.1e-132
AUX02600.1|2396141_2396885_+|tail	Phage tail assembly protein	tail	Q9EYE4	Enterobacteria_phage	97.2	7.3e-147
AUX02601.1|2396881_2397460_+|tail	Phage tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.2	1.9e-94
AUX02602.1|2397700_2399860_+|tail	Phage tail fiber protein	tail	A0A0P0ZDT4	Stx2-converting_phage	97.3	0.0e+00
AUX02603.1|2399783_2401178_+|tail	phage tail protein	tail	A0A0P0ZCI5	Stx2-converting_phage	92.6	1.7e-237
AUX02604.1|2401245_2401845_+	Attachment invasion locus protein precursor	NA	A0A0P0ZE39	Stx2-converting_phage	97.5	1.8e-108
AUX02605.1|2401909_2403109_+|tail	tail fiber protein	tail	A0A0P0ZDE7	Stx2-converting_phage	97.1	4.7e-79
AUX02606.1|2403110_2403380_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	100.0	6.4e-45
AUX02607.1|2403520_2404396_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
AUX02608.1|2404620_2405271_-	hypothetical protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
AUX02609.1|2405866_2406073_-	DNA-damage-inducible protein	NA	Q687E4	Enterobacteria_phage	83.8	1.6e-24
AUX02610.1|2406240_2407524_+	Putative transport protein	NA	NA	NA	NA	NA
AUX02611.1|2407612_2409073_+	D-mannonate oxidoreductase	NA	G8DCZ3	Micromonas_pusilla_virus	29.6	3.6e-41
>prophage 7
CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	2450735	2458250	5052887		Salmonella_phage(66.67%)	6	NA	NA
AUX02652.1|2450735_2451779_+	hypothetical protein	NA	A0A2L1IV18	Escherichia_phage	31.3	2.0e-25
AUX02653.1|2451755_2454722_-	Mobile element protein	NA	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
AUX02654.1|2454725_2455286_-	Mobile element protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
AUX02655.1|2455274_2455442_+	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
AUX02656.1|2455595_2457173_+	Aerotaxis sensor receptor protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
AUX02657.1|2457401_2458250_+	lipoprotein/autotransporter domain protein	NA	A0A2L1IV18	Escherichia_phage	50.4	1.2e-81
>prophage 8
CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	2691455	2762058	5052887	capsid,protease,portal,tail,terminase,transposase	Stx2-converting_phage(28.85%)	79	NA	NA
AUX02862.1|2691455_2692505_-|protease	putative protease sohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
AUX02863.1|2692724_2693483_+	YciK-like oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
AUX02864.1|2693479_2694070_+	Cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
AUX02865.1|2694109_2694982_-	Ribosomal large subunit pseudouridine synthase B	NA	NA	NA	NA	NA
AUX02866.1|2695082_2695703_-	hypothetical protein	NA	NA	NA	NA	NA
AUX02867.1|2695699_2696581_-	metal-dependent phosphoesterase	NA	NA	NA	NA	NA
AUX02868.1|2696852_2698415_+	Anthranilate synthase, aminase component	NA	NA	NA	NA	NA
AUX02869.1|2698414_2700010_+	hypothetical protein	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AUX02870.1|2700013_2701372_+	Indole-3-glycerol phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
AUX02871.1|2701383_2702577_+	Tryptophan synthase beta chain	NA	NA	NA	NA	NA
AUX02872.1|2702576_2703383_+	Tryptophan synthase alpha chain	NA	NA	NA	NA	NA
AUX02873.1|2703763_2703943_+	Conidiation-specific protein 10	NA	NA	NA	NA	NA
AUX02874.1|2704028_2704529_+	protein YciF	NA	NA	NA	NA	NA
AUX02875.1|2704574_2705081_+	Protein YciE	NA	NA	NA	NA	NA
AUX02876.1|2706406_2706769_-	hypothetical protein	NA	A0A0P0ZBX1	Stx2-converting_phage	43.2	2.4e-18
AUX02877.1|2707288_2707453_+	Mobile element protein	NA	NA	NA	NA	NA
AUX02878.1|2707743_2707938_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AUX02879.1|2707947_2708130_+	Transposase	NA	NA	NA	NA	NA
AUX02880.1|2708563_2709154_-	fimbrial chaperone YehC precursor	NA	NA	NA	NA	NA
AUX02881.1|2711511_2711808_+	Mobile element protein	NA	A0A218MNI5	uncultured_virus	51.5	1.8e-11
AUX02882.1|2712141_2712567_-	type III effector	NA	NA	NA	NA	NA
AUX02883.1|2712776_2713688_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
AUX02884.1|2714161_2714854_+	Mobile element protein	NA	K7PHK0	Enterobacteria_phage	88.2	9.5e-109
AUX02885.1|2715514_2716840_+	hypothetical protein	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
AUX02886.1|2717865_2718135_-|tail	Phage tail fiber protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
AUX02887.1|2718196_2718943_-	Mobile element protein	NA	Q716C2	Shigella_phage	59.0	2.5e-83
AUX02888.1|2719062_2719374_-	Mobile element protein	NA	Q716C1	Shigella_phage	40.8	2.4e-11
AUX02889.1|2719430_2720711_-|tail	Phage tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.3	3.4e-67
AUX02890.1|2720862_2721462_-	Attachment invasion locus protein precursor	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
AUX02891.1|2721529_2725003_-|tail	Phage tail fiber protein	tail	A0A0P0ZBW1	Stx2-converting_phage	90.0	0.0e+00
AUX02892.1|2725345_2725927_-|tail	Phage tail assembly protein I	tail	Q9EYE5	Enterobacteria_phage	90.1	3.4e-91
AUX02893.1|2725923_2726667_-|tail	Phage tail assembly protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
AUX02894.1|2726677_2727376_-|tail	Phage minor tail protein	tail	H6WZM3	Escherichia_phage	98.3	6.8e-131
AUX02895.1|2727375_2727717_-|tail	Phage minor tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
AUX02896.1|2727709_2730151_-|tail	Phage tail length tape-measure protein 1	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.8	0.0e+00
AUX02897.1|2730134_2730326_-	hypothetical protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	95.0	4.4e-24
AUX02898.1|2730363_2730675_-	hypothetical protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	99.0	1.1e-43
AUX02899.1|2730786_2730954_-	hypothetical protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	98.1	3.7e-19
AUX02900.1|2731334_2731670_-	hypothetical protein	NA	A0A0P0ZE84	Stx2-converting_phage	95.7	4.7e-45
AUX02901.1|2731666_2731831_-|capsid	Phage capsid and scaffold	capsid	A0A0P0ZB28	Stx2-converting_phage	100.0	9.3e-23
AUX02902.1|2732104_2732314_-	DNA-damage-inducible protein I	NA	A0A0P0ZBH1	Stx2-converting_phage	100.0	8.5e-29
AUX02903.1|2732316_2732568_-|portal	Phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	7.3e-43
AUX02904.1|2732564_2734895_-|portal	Phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.2	1.2e-296
AUX02905.1|2734840_2735062_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
AUX02906.1|2735106_2737044_-|capsid	Phage capsid and scaffold	capsid	H6WZL0	Escherichia_phage	99.8	0.0e+00
AUX02907.1|2737107_2738769_-|terminase	Phage terminase, large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
AUX02908.1|2738765_2739329_-	hypothetical protein	NA	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
AUX02909.1|2739720_2739966_+	hypothetical protein	NA	NA	NA	NA	NA
AUX02910.1|2740025_2740211_+	DNA-damage-inducible protein I	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
AUX02911.1|2740837_2741062_-	hypothetical protein	NA	NA	NA	NA	NA
AUX02912.1|2741085_2741553_-	putative endopeptidase	NA	A0A0H4IT10	Shigella_phage	96.1	5.5e-76
AUX02913.1|2741706_2742276_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
AUX02914.1|2742546_2743080_-	hypothetical protein	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
AUX02915.1|2743130_2743475_-	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	96.5	2.7e-56
AUX02916.1|2743479_2743686_-	hypothetical protein	NA	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
AUX02917.1|2743850_2745704_-	Mobile element protein	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
AUX02918.1|2746018_2746186_-	hypothetical protein	NA	H6WZJ7	Escherichia_phage	70.6	5.4e-10
AUX02919.1|2747223_2747808_-	Phage antitermination protein Q	NA	I6PDF8	Cronobacter_phage	49.2	3.9e-47
AUX02920.1|2747850_2748738_-	Mobile element protein	NA	H6WZH1	Escherichia_phage	97.3	2.1e-164
AUX02921.1|2748737_2749013_-	hypothetical protein	NA	A0A0N7C1Z2	Escherichia_phage	98.9	1.0e-45
AUX02922.1|2749222_2749588_-	Holliday junction resolvase / Crossover junction endodeoxyribonuclease rusA	NA	V5URS4	Shigella_phage	67.5	1.6e-38
AUX02923.1|2749588_2750521_-	hypothetical protein	NA	U5P0K4	Shigella_phage	48.5	9.0e-78
AUX02924.1|2750993_2751251_-	hypothetical protein	NA	NA	NA	NA	NA
AUX02925.1|2751471_2751684_-	regulatory protein	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
AUX02926.1|2751962_2752709_-	Accessory colonization factor AcfC	NA	NA	NA	NA	NA
AUX02927.1|2753580_2754315_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	84.3	2.3e-108
AUX02928.1|2754348_2754771_-	putative phage replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
AUX02929.1|2754802_2755843_-	Primosomal protein I	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
AUX02930.1|2755814_2756366_-	hypothetical protein	NA	NA	NA	NA	NA
AUX02931.1|2756349_2756577_-	Putative regulator of cell division	NA	NA	NA	NA	NA
AUX02932.1|2756653_2757061_+	transcriptional regulator	NA	I6PD69	Cronobacter_phage	49.6	5.7e-29
AUX02933.1|2757268_2757625_+	hypothetical protein	NA	NA	NA	NA	NA
AUX02934.1|2757697_2757916_+	hypothetical protein	NA	NA	NA	NA	NA
AUX02935.1|2757938_2758346_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
AUX02936.1|2758323_2758557_-	hypothetical protein	NA	NA	NA	NA	NA
AUX02937.1|2758918_2759089_-	hypothetical protein	NA	NA	NA	NA	NA
AUX02938.1|2759117_2759306_+	Division inhibition protein dicB	NA	NA	NA	NA	NA
AUX02939.1|2759302_2759491_+	hypothetical protein	NA	NA	NA	NA	NA
AUX02940.1|2759586_2762058_+	Exodeoxyribonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
>prophage 9
CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	2866547	2939835	5052887	capsid,portal,head,tRNA,tail,terminase	Enterobacteria_phage(30.16%)	93	NA	NA
AUX03043.1|2866547_2867654_+|tRNA	tRNA-specific 2-thiouridylase MnmA	tRNA	NA	NA	NA	NA
AUX03044.1|2867689_2868331_+	hypothetical protein	NA	NA	NA	NA	NA
AUX03045.1|2868334_2869705_+	Adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
AUX03046.1|2869872_2870544_+	Transcriptional regulatory protein PhoP	NA	NA	NA	NA	NA
AUX03047.1|2870543_2872004_+	Sensor protein PhoQ	NA	NA	NA	NA	NA
AUX03048.1|2872740_2873022_-	hypothetical protein	NA	NA	NA	NA	NA
AUX03049.1|2873035_2874514_-|terminase	Phage terminase, large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.9	2.9e-248
AUX03050.1|2874680_2875037_-	hypothetical protein	NA	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
AUX03051.1|2875160_2875334_-	hypothetical protein	NA	NA	NA	NA	NA
AUX03052.1|2875326_2875539_-	Phage endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.5	4.9e-24
AUX03053.1|2875766_2876063_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
AUX03054.1|2876059_2876398_-|head,tail	Phage head-tail adapter	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	5.6e-30
AUX03055.1|2876394_2877606_-|portal	Phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
AUX03056.1|2877607_2878180_-	hypothetical protein	NA	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	1.8e-60
AUX03057.1|2878219_2879377_-|capsid	Phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	1.6e-137
AUX03058.1|2879558_2879726_-	hypothetical protein	NA	NA	NA	NA	NA
AUX03059.1|2879664_2879937_-	transcriptional activator PerC	NA	NA	NA	NA	NA
AUX03060.1|2879949_2880360_-	hypothetical protein	NA	NA	NA	NA	NA
AUX03061.1|2880369_2880558_-	hypothetical protein	NA	NA	NA	NA	NA
AUX03062.1|2880671_2880923_-	hypothetical protein	NA	NA	NA	NA	NA
AUX03063.1|2881123_2882524_-	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	1.6e-115
AUX03064.1|2882520_2882820_-	hypothetical protein	NA	NA	NA	NA	NA
AUX03065.1|2882825_2883059_-	hypothetical protein	NA	NA	NA	NA	NA
AUX03066.1|2883051_2883516_-	hypothetical protein	NA	NA	NA	NA	NA
AUX03067.1|2883505_2883718_-	hypothetical protein	NA	NA	NA	NA	NA
AUX03068.1|2883710_2883908_-	hypothetical protein	NA	NA	NA	NA	NA
AUX03069.1|2883916_2884777_-	hypothetical protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	46.4	3.5e-12
AUX03070.1|2885386_2886616_-	Mobile element protein	NA	A0A2H4JB45	uncultured_Caudovirales_phage	56.6	2.3e-134
AUX03071.1|2886620_2886785_+	hypothetical protein	NA	NA	NA	NA	NA
AUX03072.1|2886864_2887986_+	hypothetical protein	NA	NA	NA	NA	NA
AUX03073.1|2888131_2889361_-	Tripeptide aminopeptidase	NA	NA	NA	NA	NA
AUX03074.1|2889416_2889632_+	hypothetical protein	NA	NA	NA	NA	NA
AUX03075.1|2889610_2890747_+	Putrescine transport ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
AUX03076.1|2890730_2891594_+	Spermidine Putrescine ABC transporter permease component PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AUX03077.1|2891957_2893319_+	Leucine-rich repeat protein	NA	Q9MBM1	Phage_Gifsy-1	29.4	4.7e-51
AUX03078.1|2893736_2894717_-	hypothetical protein	NA	Q8HAB2	Salmonella_phage	48.6	8.0e-85
AUX03079.1|2894894_2895164_-	hypothetical protein	NA	Q9EYE9	Enterobacteria_phage	97.8	5.4e-44
AUX03080.1|2895165_2895444_-|tail	Phage tail fiber protein	tail	B6DZB7	Enterobacteria_phage	100.0	8.4e-40
AUX03081.1|2895542_2896478_-|tail	Phage tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.1	5.5e-59
AUX03082.1|2896542_2897166_-	Attachment invasion locus protein precursor	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	8.7e-69
AUX03083.1|2897234_2900714_-|tail	Phage tail fiber protein	tail	Q6H9T2	Enterobacteria_phage	94.6	0.0e+00
AUX03084.1|2900847_2901375_+	superoxide dismutase	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
AUX03085.1|2901565_2902147_-|tail	Phage tail assembly protein I	tail	Q9EYE5	Enterobacteria_phage	91.6	6.2e-93
AUX03086.1|2902143_2902887_-|tail	Phage tail assembly protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
AUX03087.1|2902897_2903596_-|tail	Phage minor tail protein	tail	H6WZM3	Escherichia_phage	98.3	6.8e-131
AUX03088.1|2903595_2903937_-|tail	Phage minor tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
AUX03089.1|2903929_2907172_-|tail	Phage tail length tape-measure protein 1	tail	A0A0P0ZCJ4	Stx2-converting_phage	96.6	0.0e+00
AUX03090.1|2907299_2907758_-	Mobile element protein	NA	I4AZI8	Saccharomonospora_phage	32.3	8.5e-13
AUX03091.1|2907935_2908139_-	hypothetical protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.3e-31
AUX03092.1|2908240_2908615_-	hypothetical protein	NA	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
AUX03093.1|2908620_2909337_-	Phage neck whisker protein	NA	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
AUX03094.1|2909395_2909740_-	hypothetical protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
AUX03095.1|2909736_2910183_-	hypothetical protein	NA	A0A0P0ZCD2	Stx2-converting_phage	99.3	4.0e-76
AUX03096.1|2910179_2910530_-|capsid	Phage capsid and scaffold	capsid	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AUX03097.1|2910540_2910867_-	DNA-damage-inducible protein I	NA	A0A0P0ZDA0	Stx2-converting_phage	99.1	1.6e-53
AUX03098.1|2910863_2912087_-|portal	Phage portal protein	portal	B6DZX7	Stx2-converting_phage	92.4	1.5e-77
AUX03099.1|2912083_2913448_-|portal	Phage portal protein	portal	B6DZX6	Stx2-converting_phage	95.8	4.0e-252
AUX03100.1|2913393_2913615_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
AUX03101.1|2913659_2915597_-|capsid	Phage capsid and scaffold	capsid	B6ETE8	Enterobacteria_phage	99.5	0.0e+00
AUX03102.1|2915660_2917322_-|terminase	Phage terminase, large subunit	terminase	B6DZ98	Enterobacteria_phage	99.3	0.0e+00
AUX03103.1|2917318_2917882_-	hypothetical protein	NA	A0A0P0ZCQ9	Stx2-converting_phage	84.0	2.4e-70
AUX03104.1|2918173_2918539_-	putative Dnase	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
AUX03105.1|2918580_2918808_+	hypothetical protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
AUX03106.1|2919176_2919401_-	hypothetical protein	NA	NA	NA	NA	NA
AUX03107.1|2919397_2919892_-	Phage endopeptidase	NA	Q9ZXB6	Enterobacteria_phage	100.0	1.7e-83
AUX03108.1|2920190_2920724_-	hypothetical protein	NA	B6DZ92	Enterobacteria_phage	96.6	2.8e-100
AUX03109.1|2920774_2921119_-	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
AUX03110.1|2921123_2921330_-	hypothetical protein	NA	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
AUX03111.1|2921631_2923482_-	Mobile element protein	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
AUX03112.1|2923889_2924057_-	hypothetical protein	NA	H6WZJ7	Escherichia_phage	74.5	1.1e-10
AUX03113.1|2924053_2924485_-	hypothetical protein	NA	H6WZJ6	Escherichia_phage	95.8	2.1e-66
AUX03114.1|2924792_2925167_-	Phage DNA-binding protein	NA	NA	NA	NA	NA
AUX03115.1|2925227_2925488_-	hypothetical protein	NA	NA	NA	NA	NA
AUX03116.1|2925636_2926662_-	DNA methyl transferase, phage-associated	NA	Q8W637	Enterobacteria_phage	93.0	6.0e-184
AUX03117.1|2926813_2927011_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
AUX03118.1|2927237_2928059_-	Phage antitermination protein Q	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
AUX03119.1|2928055_2928223_-	Holliday junction resolvase / Crossover junction endodeoxyribonuclease rusA	NA	A5VW85	Enterobacteria_phage	61.4	2.3e-08
AUX03120.1|2928236_2928437_-	hypothetical protein	NA	NA	NA	NA	NA
AUX03121.1|2928442_2929492_-	Phage antitermination protein Q	NA	U5P0K4	Shigella_phage	54.0	9.4e-108
AUX03122.1|2929574_2929754_+	hypothetical protein	NA	NA	NA	NA	NA
AUX03123.1|2930560_2931145_-	hypothetical protein	NA	A0A0P0ZD75	Stx2-converting_phage	86.1	1.0e-34
AUX03124.1|2931201_2931597_-	LygF	NA	A0A0U2QQN3	Escherichia_phage	50.7	1.9e-29
AUX03125.1|2931612_2932383_-	hypothetical protein	NA	A0A088CE47	Shigella_phage	67.3	2.2e-82
AUX03126.1|2932408_2933149_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
AUX03127.1|2933155_2934043_-	Primosomal protein I	NA	U5P0A0	Shigella_phage	50.2	8.0e-60
AUX03128.1|2934140_2934566_-	Phage or Prophage Related	NA	NA	NA	NA	NA
AUX03129.1|2934997_2935474_+	Rac prophage repressor	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
AUX03130.1|2935711_2935948_+	Mobile element protein	NA	M4QQ57	Salicola_phage	48.9	1.1e-05
AUX03131.1|2936107_2936326_+	hypothetical protein	NA	NA	NA	NA	NA
AUX03132.1|2936329_2936494_-	hypothetical protein	NA	NA	NA	NA	NA
AUX03133.1|2936894_2937083_+	Division inhibition protein dicB	NA	NA	NA	NA	NA
AUX03134.1|2937079_2937271_+	hypothetical protein	NA	NA	NA	NA	NA
AUX03135.1|2937363_2939835_+	Exodeoxyribonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
>prophage 10
CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	3063511	3123952	5052887	tail,capsid,terminase,portal	Enterobacteria_phage(34.78%)	75	NA	NA
AUX03263.1|3063511_3066058_-	Trimethylamine-N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	5.9e-71
AUX03264.1|3066057_3067230_-	Cytochrome c-type protein TorC	NA	NA	NA	NA	NA
AUX03265.1|3067359_3068052_+	TorCAD operon transcriptional regulatory protein TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
AUX03266.1|3068024_3069053_-	Periplasmic protein torT precursor	NA	NA	NA	NA	NA
AUX03267.1|3069651_3070095_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	97.3	6.8e-76
AUX03268.1|3070094_3070259_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	86.5	1.1e-18
AUX03269.1|3070638_3070908_-|tail	Phage tail fiber protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
AUX03271.1|3070909_3071188_-|tail	Phage tail fiber protein	tail	B6DZB7	Enterobacteria_phage	100.0	8.4e-40
AUX03270.1|3071139_3072000_+	Phage protein	NA	Q7Y2V7	Escherichia_phage	68.3	1.7e-06
AUX03272.1|3072287_3072887_-	hypothetical protein	NA	Q687E7	Enterobacteria_phage	99.5	3.0e-111
AUX03273.1|3072953_3074351_-|tail	Phage tail fiber protein	tail	Q687E8	Enterobacteria_phage	97.0	4.3e-241
AUX03274.1|3074274_3076434_-|tail	Phage tail fiber protein	tail	A0A0P0ZDT4	Stx2-converting_phage	97.9	0.0e+00
AUX03275.1|3076669_3077251_-|tail	Phage tail assembly protein I	tail	A0A0P0ZDX8	Stx2-converting_phage	99.0	8.6e-95
AUX03276.1|3077247_3077985_-|tail	Phage tail assembly protein	tail	A0A0P0ZDT1	Stx2-converting_phage	97.1	6.1e-146
AUX03277.1|3078039_3079044_-	putative antirepressor protein	NA	A0A0N7KZK0	Stx2-converting_phage	100.0	5.9e-192
AUX03278.1|3079033_3079207_-	hypothetical protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
AUX03279.1|3079290_3079635_+	arc-like DNA binding domain protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.2e-49
AUX03280.1|3079651_3080350_-|tail	Phage minor tail protein	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	1.5e-130
AUX03281.1|3080349_3080691_-|tail	Phage minor tail protein	tail	H6WZM2	Escherichia_phage	96.5	6.2e-61
AUX03282.1|3080683_3083926_-|tail	Phage tail length tape-measure protein 1	tail	A0A0P0ZE78	Stx2-converting_phage	98.3	0.0e+00
AUX03283.1|3083976_3084258_-	hypothetical protein	NA	H6WZM0	Escherichia_phage	98.9	3.0e-45
AUX03284.1|3084281_3084656_-	hypothetical protein	NA	A0A0P0ZE84	Stx2-converting_phage	98.4	6.6e-64
AUX03285.1|3084661_3085378_-	Phage neck whisker protein	NA	A0A0P0ZD29	Stx2-converting_phage	99.2	1.5e-128
AUX03286.1|3085444_3085789_-	hypothetical protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AUX03287.1|3085785_3086232_-	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AUX03288.1|3086228_3086579_-|capsid	Phage capsid and scaffold	capsid	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AUX03289.1|3086588_3086915_-	DNA-damage-inducible protein I	NA	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
AUX03290.1|3086911_3088297_-|portal	Phage portal protein	portal	H6WZL3	Escherichia_phage	87.4	1.7e-93
AUX03291.1|3088293_3089658_-|portal	Phage portal protein	portal	H6WZL2	Escherichia_phage	99.8	7.8e-256
AUX03292.1|3089603_3089825_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
AUX03293.1|3089869_3091807_-|capsid	Phage capsid and scaffold	capsid	H6WZL0	Escherichia_phage	99.8	0.0e+00
AUX03294.1|3091870_3093532_-|terminase	Phage terminase, large subunit	terminase	H6WZK9	Escherichia_phage	99.5	0.0e+00
AUX03295.1|3093528_3094092_-	hypothetical protein	NA	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
AUX03296.1|3094380_3094746_-	putative Dnase	NA	B6ETE5	Enterobacteria_phage	98.3	4.2e-63
AUX03297.1|3094787_3094988_+	DNA-damage-inducible protein I	NA	H6WZK6	Escherichia_phage	95.5	3.7e-29
AUX03298.1|3095119_3095446_-	tonB-like membrane protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
AUX03299.1|3095784_3096243_-	hypothetical protein	NA	Q7AYI6	Enterobacteria_phage	94.1	2.3e-71
AUX03300.1|3096480_3097176_-	Putative DNA-binding protein Roi	NA	Q5MBW0	Stx1-converting_phage	98.7	3.6e-124
AUX03301.1|3097449_3097983_-	hypothetical protein	NA	Q6H9V6	Enterobacteria_phage	96.0	1.3e-100
AUX03302.1|3098033_3098378_-	hypothetical protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.4	2.1e-56
AUX03303.1|3098382_3098589_-	hypothetical protein	NA	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
AUX03304.1|3098596_3098758_+	hypothetical protein	NA	NA	NA	NA	NA
AUX03305.1|3098881_3100732_-	Mobile element protein	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
AUX03306.1|3101046_3101214_-	hypothetical protein	NA	H6WZJ7	Escherichia_phage	74.5	1.1e-10
AUX03307.1|3101210_3101639_-	hypothetical protein	NA	H6WZJ6	Escherichia_phage	97.1	6.4e-63
AUX03308.1|3102280_3102769_-	Phage antitermination protein Q	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
AUX03309.1|3102759_3103431_-	hypothetical protein	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
AUX03310.1|3103427_3104030_-	hypothetical protein	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	3.9e-90
AUX03311.1|3104004_3104571_-	putative endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
AUX03312.1|3104721_3104898_-	Alkaline phosphodiesterase I	NA	NA	NA	NA	NA
AUX03313.1|3105146_3106919_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.3	0.0e+00
AUX03314.1|3107601_3108129_-	hypothetical protein	NA	Q9ZWX6	Enterobacteria_phage	100.0	7.3e-101
AUX03315.1|3108125_3108431_-	hypothetical protein	NA	Q8VNP6	Enterobacteria_phage	98.0	1.9e-53
AUX03316.1|3108528_3108891_-	hypothetical protein	NA	Q8SC44	Stx2_converting_phage	100.0	2.2e-64
AUX03317.1|3109123_3109402_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
AUX03318.1|3109472_3109763_-	Ren protein	NA	A0A0N6WES4	Escherichia_phage	100.0	5.7e-47
AUX03319.1|3109759_3110461_-	hypothetical protein	NA	Q6H9X6	Enterobacteria_phage	99.1	4.9e-129
AUX03320.1|3110457_3111396_-	Origin specific replication initiation factor	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
AUX03321.1|3111428_3111725_-	Phage repressor	NA	G9L678	Escherichia_phage	94.9	2.2e-46
AUX03322.1|3111834_3112020_-	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
AUX03323.1|3112496_3112751_+	hypothetical protein	NA	A5VW98	Enterobacteria_phage	100.0	6.9e-41
AUX03324.1|3113065_3113371_+	Phage antitermination protein N	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
AUX03325.1|3113813_3113999_-	hypothetical protein	NA	NA	NA	NA	NA
AUX03326.1|3114465_3114834_+	Single stranded DNA-binding protein, phage-associated	NA	A0A0N7C1W2	Escherichia_phage	98.4	2.9e-64
AUX03327.1|3115257_3115554_+	Mobile element protein	NA	A0A1I9LJN1	Stx_converting_phage	99.0	4.7e-49
AUX03328.1|3115559_3116345_+	Recombinational DNA repair protein RecT	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.4e-148
AUX03329.1|3116341_3117022_+	Phage exonuclease	NA	H6WZG6	Escherichia_phage	98.7	1.8e-131
AUX03330.1|3117173_3117365_+	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
AUX03331.1|3117441_3117657_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
AUX03332.1|3117973_3118744_+	hypothetical protein	NA	H6WZG2	Escherichia_phage	98.8	4.7e-141
AUX03333.1|3118745_3119483_+	Phage EaA protein	NA	G9L6B4	Escherichia_phage	51.0	4.2e-54
AUX03334.1|3119538_3119832_+	hypothetical protein	NA	K7P6X8	Enterobacteria_phage	96.0	3.7e-30
AUX03335.1|3120067_3121141_+	Mobile element protein	NA	K7PHK0	Enterobacteria_phage	96.1	1.8e-194
AUX03336.1|3121265_3122489_+	Sensor protein torS	NA	NA	NA	NA	NA
AUX03337.1|3122485_3123952_+	Sensor protein torS	NA	A0A1V0SGX0	Hokovirus	29.8	9.3e-37
>prophage 11
CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	3140250	3189212	5052887	capsid,protease,portal,head,tail,terminase,transposase	Enterobacteria_phage(45.24%)	59	NA	NA
AUX03354.1|3140250_3140838_-|protease	Hydrogenase maturation protease	protease	NA	NA	NA	NA
AUX03355.1|3140834_3141542_-	Ni,Fe-hydrogenase I cytochrome b subunit	NA	NA	NA	NA	NA
AUX03356.1|3141560_3143354_-	Uptake hydrogenase large subunit	NA	NA	NA	NA	NA
AUX03357.1|3143350_3144469_-	Uptake hydrogenase small subunit precursor	NA	NA	NA	NA	NA
AUX03358.1|3145735_3146944_+	Phosphomannomutase	NA	H6WZN3	Escherichia_phage	89.3	2.1e-204
AUX03359.1|3147503_3148064_-	hypothetical protein	NA	H6WZN1	Escherichia_phage	67.5	1.2e-64
AUX03360.1|3148178_3148448_-	hypothetical protein	NA	Q9EYE9	Enterobacteria_phage	98.9	2.4e-44
AUX03361.1|3148449_3149763_-|tail	Phage tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.8	6.7e-79
AUX03362.1|3149823_3153237_-|tail	Phage tail fiber protein	tail	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
AUX03363.1|3153297_3153870_-	hypothetical protein	NA	A0A0K2FJB0	Escherichia_phage	99.5	6.7e-84
AUX03364.1|3153866_3154466_-|tail	Phage tail assembly protein	tail	K7PLW1	Enterobacteria_phage	96.5	7.4e-118
AUX03365.1|3154615_3155314_-|tail	Phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
AUX03366.1|3155313_3155643_-	hypothetical protein	NA	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
AUX03367.1|3155639_3158201_-|tail	Phage tail length tape-measure protein 1	tail	A0A2R9YJM8	Escherichia_phage	85.3	0.0e+00
AUX03368.1|3158181_3158571_-|tail	Phage minor tail protein	tail	Q687F4	Enterobacteria_phage	82.4	2.1e-36
AUX03369.1|3158621_3159053_-|tail	Phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
AUX03370.1|3159066_3159819_-|tail	Phage minor tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
AUX03371.1|3159826_3160222_-|tail	Phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
AUX03372.1|3160218_3160794_-|tail	Minor tail protein Z	tail	A0A2R9YJK4	Escherichia_phage	58.3	4.9e-50
AUX03373.1|3161037_3161313_+	hypothetical protein	NA	A0A0N7C1Z2	Escherichia_phage	98.9	1.0e-45
AUX03374.1|3161312_3162200_+|transposase	putative transposase	transposase	Q6H9S6	Enterobacteria_phage	98.0	9.8e-167
AUX03375.1|3162202_3162475_-|capsid	Phage capsid and scaffold	capsid	A0A2R9YJJ5	Escherichia_phage	54.4	2.5e-20
AUX03376.1|3162467_3162842_-	Phage DNA-packaging protein	NA	NA	NA	NA	NA
AUX03377.1|3162893_3163922_-|capsid	Phage major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
AUX03378.1|3163979_3164327_-	Head decoration protein	NA	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
AUX03379.1|3164363_3164915_-|capsid	Phage capsid and scaffold	capsid	NA	NA	NA	NA
AUX03380.1|3164914_3165868_-|capsid	Phage capsid and scaffold	capsid	A0A0K2FI53	Enterobacteria_phage	57.9	5.0e-92
AUX03381.1|3165857_3167450_-|portal	Phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.2e-184
AUX03382.1|3167446_3167653_-|head,tail	Phage head-to-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
AUX03383.1|3167636_3169484_-|terminase	Phage terminase, large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	67.4	4.3e-257
AUX03384.1|3169536_3170046_-	Terminase small subunit	NA	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AUX03385.1|3170500_3170665_+	DNA-damage-inducible protein I	NA	A0A0K2FIR8	Escherichia_phage	87.9	7.7e-09
AUX03386.1|3170746_3171061_-	transcriptional regulator	NA	NA	NA	NA	NA
AUX03387.1|3171525_3171993_-	putative endopeptidase	NA	Q7AYI6	Enterobacteria_phage	93.5	2.2e-72
AUX03388.1|3172328_3172862_-	hypothetical protein	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
AUX03389.1|3172979_3173294_+	hypothetical protein	NA	NA	NA	NA	NA
AUX03390.1|3173549_3173756_-	hypothetical protein	NA	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
AUX03391.1|3173763_3173925_+	hypothetical protein	NA	NA	NA	NA	NA
AUX03392.1|3174203_3176054_-	Mobile element protein	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
AUX03393.1|3176821_3177535_-	Putative transcriptional regulator	NA	NA	NA	NA	NA
AUX03394.1|3177629_3177869_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
AUX03395.1|3178155_3178974_-	hypothetical protein	NA	NA	NA	NA	NA
AUX03396.1|3179125_3179497_-	Phage antitermination protein Q	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
AUX03397.1|3179486_3179858_-	Holliday junction resolvase / Crossover junction endodeoxyribonuclease rusA	NA	V5URS4	Shigella_phage	63.7	1.3e-35
AUX03398.1|3179870_3180920_-	hypothetical protein	NA	U5P0K4	Shigella_phage	54.6	2.5e-108
AUX03399.1|3181002_3181182_+	hypothetical protein	NA	NA	NA	NA	NA
AUX03400.1|3181367_3181580_-	Regulatory protein	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
AUX03401.1|3182127_3182901_+	hypothetical protein	NA	NA	NA	NA	NA
AUX03402.1|3183252_3183666_-	LygF	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
AUX03403.1|3183681_3184452_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	64.1	1.0e-79
AUX03404.1|3184473_3185220_-	hypothetical protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
AUX03405.1|3185226_3186342_-	Primosomal protein I	NA	V5URT9	Shigella_phage	68.4	2.2e-131
AUX03406.1|3186420_3186876_+	hypothetical protein	NA	NA	NA	NA	NA
AUX03407.1|3186559_3187069_-	hypothetical protein	NA	NA	NA	NA	NA
AUX03408.1|3187082_3187508_-	Phage or Prophage Related	NA	NA	NA	NA	NA
AUX03409.1|3187491_3187764_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
AUX03410.1|3187875_3188274_+	XRE family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.3e-13
AUX03411.1|3188301_3188493_+	hypothetical protein	NA	NA	NA	NA	NA
AUX03412.1|3189056_3189212_+	Mobile element protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 12
CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	3424161	3470818	5052887	tail,capsid,terminase,portal	Enterobacteria_phage(58.33%)	68	NA	NA
AUX03623.1|3424161_3424923_-	Cell Inhibiting Factor	NA	A5LH49	Enterobacteria_phage	98.8	3.1e-137
AUX03624.1|3425081_3425258_+	hypothetical protein	NA	NA	NA	NA	NA
AUX03625.1|3425232_3426114_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
AUX03626.1|3426219_3426489_-|tail	Phage tail fiber protein	tail	B6DZB8	Enterobacteria_phage	97.8	1.6e-43
AUX03628.1|3426490_3426769_-|tail	Phage tail fiber protein	tail	B6DZB7	Enterobacteria_phage	100.0	8.4e-40
AUX03627.1|3426720_3427590_+	Phage protein	NA	Q7Y2V7	Escherichia_phage	92.3	1.8e-27
AUX03629.1|3427877_3428477_-	Attachment invasion locus protein precursor	NA	A5LH44	Enterobacteria_phage	97.0	7.0e-108
AUX03630.1|3428547_3431961_-|tail	Phage tail fiber protein	tail	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
AUX03631.1|3432021_3432594_-	hypothetical protein	NA	A0A0K2FJB0	Escherichia_phage	99.5	6.7e-84
AUX03632.1|3432590_3433190_-|tail	Phage tail assembly protein	tail	K7PLW1	Enterobacteria_phage	96.5	7.4e-118
AUX03633.1|3433339_3434038_-|tail	Phage minor tail protein	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
AUX03634.1|3434037_3434367_-	hypothetical protein	NA	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
AUX03635.1|3434363_3436925_-|tail	Phage tail length tape-measure protein 1	tail	A0A0K2FI43	Enterobacteria_phage	90.5	0.0e+00
AUX03636.1|3436917_3437352_-|tail	Phage minor tail protein	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AUX03637.1|3437333_3437756_-|tail	Phage minor tail protein	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
AUX03638.1|3437771_3438512_-|tail	Phage tail assembly	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
AUX03639.1|3438519_3438915_-|tail	Phage minor tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
AUX03640.1|3438911_3439490_-	hypothetical protein	NA	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
AUX03641.1|3439501_3439855_-|capsid	Phage capsid and scaffold	capsid	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
AUX03642.1|3439866_3440262_-	Phage DNA-packaging protein	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
AUX03643.1|3440303_3441329_-|capsid	Phage major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
AUX03644.1|3441384_3441717_-	Head decoration protein	NA	A0A2R9YJN3	Escherichia_phage	97.3	4.2e-54
AUX03645.1|3441726_3443046_-|capsid	Phage capsid and scaffold	capsid	A0A0K2FI53	Enterobacteria_phage	98.6	2.4e-233
AUX03646.1|3443026_3444628_-|portal	Phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.2e-309
AUX03647.1|3444624_3444831_-	hypothetical protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AUX03648.1|3444827_3446753_-|terminase	Phage terminase, large subunit	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
AUX03649.1|3446727_3447273_-	Terminase small subunit	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
AUX03650.1|3448043_3448661_-	Phage Rha protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
AUX03651.1|3448810_3449248_-	hypothetical protein	NA	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
AUX03652.1|3449244_3449742_-	hypothetical protein	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
AUX03653.1|3449741_3449948_-	hypothetical protein	NA	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
AUX03654.1|3449955_3450117_+	hypothetical protein	NA	NA	NA	NA	NA
AUX03655.1|3450395_3452246_-	Mobile element protein	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
AUX03656.1|3452547_3452703_-	hypothetical protein	NA	NA	NA	NA	NA
AUX03657.1|3452788_3453028_-	hypothetical protein	NA	NA	NA	NA	NA
AUX03658.1|3453027_3453504_-	Phage protein	NA	NA	NA	NA	NA
AUX03659.1|3453715_3454405_-	Phage antitermination protein Q	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
AUX03660.1|3454881_3455841_+	Putative outer membrane protein	NA	NA	NA	NA	NA
AUX03661.1|3456052_3456241_-	phage NinH protein	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
AUX03662.1|3456237_3456600_-	Holliday junction resolvase / Crossover junction endodeoxyribonuclease rusA	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
AUX03663.1|3456596_3456761_-	phage protein	NA	K7PK25	Enterobacteria_phage	96.3	2.5e-23
AUX03664.1|3456879_3457092_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
AUX03665.1|3457084_3457261_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
AUX03666.1|3457260_3457620_-	Phage NinX	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
AUX03667.1|3457622_3457799_-	protein ninE	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
AUX03668.1|3457795_3458323_-	hypothetical protein	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
AUX03669.1|3458319_3458760_-	Phage NinB DNA recombination	NA	A5VW91	Enterobacteria_phage	100.0	7.0e-81
AUX03670.1|3458833_3459124_-	Ren protein	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
AUX03671.1|3459120_3459822_-	hypothetical protein	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
AUX03672.1|3459818_3460718_-	Origin specific replication initiation factor	NA	A0A0K2FJ31	Enterobacteria_phage	99.3	2.1e-172
AUX03673.1|3460752_3461031_-	CII protein	NA	K7P7A2	Enterobacteria_phage	100.0	1.6e-43
AUX03674.1|3461139_3461325_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
AUX03675.1|3461696_3462056_+	Phage repressor	NA	A5VW98	Enterobacteria_phage	98.3	1.4e-63
AUX03676.1|3462368_3462641_+	Phage antitermination protein N	NA	K7PH69	Enterobacterial_phage	96.7	4.0e-26
AUX03677.1|3462657_3463212_-	putative superinfection exclusion protein	NA	Q9EYA9	Enterobacteria_phage	100.0	1.2e-93
AUX03678.1|3463499_3463868_+	Single stranded DNA-binding protein, phage-associated	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
AUX03679.1|3464291_3464588_+	Mobile element protein	NA	A0A1I9LJN1	Stx_converting_phage	99.0	4.7e-49
AUX03680.1|3464593_3465379_+	Recombinational DNA repair protein RecT (prophage associated)	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.4e-148
AUX03681.1|3465375_3466056_+	Phage exonuclease	NA	H6WZG6	Escherichia_phage	98.7	1.8e-131
AUX03682.1|3466207_3466399_+	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
AUX03683.1|3466475_3466691_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
AUX03684.1|3466789_3467011_+	conjugal transfer protein TraR	NA	A0A0N7C211	Escherichia_phage	95.9	5.5e-34
AUX03685.1|3467007_3467259_+	hypothetical protein	NA	A0A0K2FJF6	Enterobacteria_phage	92.3	5.8e-32
AUX03686.1|3467557_3468172_+	hypothetical protein	NA	NA	NA	NA	NA
AUX03687.1|3468465_3468804_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	85.7	7.1e-49
AUX03688.1|3468832_3469261_+	hypothetical protein	NA	NA	NA	NA	NA
AUX03689.1|3469344_3469512_+	Phage protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
AUX03690.1|3469747_3470818_+	Mobile element protein	NA	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
>prophage 13
CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	3702042	3711251	5052887	integrase	Shigella_phage(80.0%)	15	3699767:3699813	3711265:3711311
3699767:3699813	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
AUX03894.1|3702042_3702369_+	Mobile element protein	NA	Q6H9S4	Enterobacteria_phage	97.2	7.0e-54
AUX03895.1|3702368_3703256_+	Mobile element protein	NA	Q6H9S6	Enterobacteria_phage	98.0	9.8e-167
AUX03896.1|3703137_3704175_-	phage replication protein O	NA	U5P0A0	Shigella_phage	92.5	1.2e-126
AUX03897.1|3704184_3704523_-	hypothetical protein	NA	U5P0J9	Shigella_phage	96.4	1.7e-55
AUX03898.1|3704519_3705077_-	hypothetical protein	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
AUX03899.1|3705120_3705321_-	hypothetical protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
AUX03900.1|3705825_3706086_+	hypothetical protein	NA	U5P0T5	Shigella_phage	100.0	5.1e-47
AUX03901.1|3706300_3707068_-	hypothetical protein	NA	U5P0J5	Shigella_phage	96.2	1.8e-39
AUX03902.1|3707286_3707649_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
AUX03903.1|3707714_3708539_+	hypothetical protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AUX03904.1|3708666_3709203_+	hypothetical protein	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
AUX03905.1|3709214_3709556_+	Eae protein	NA	K7PH61	Enterobacteria_phage	98.2	3.6e-61
AUX03906.1|3709555_3709861_+	hypothetical protein	NA	U5P0J0	Shigella_phage	97.0	2.2e-49
AUX03907.1|3710087_3710792_+	Mobile element protein	NA	A0A088CD23	Shigella_phage	87.6	2.4e-115
AUX03908.1|3710792_3711251_+|integrase	prophage DLP12 integrase	integrase	A0A088CD23	Shigella_phage	84.2	3.0e-74
3711265:3711311	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 14
CP025318	Escherichia coli strain FORC_042 chromosome, complete genome	5052887	4417367	4428919	5052887	capsid,integrase	Enterobacteria_phage(72.73%)	13	4407239:4407253	4435475:4435489
4407239:4407253	attL	CTTAGAAAACAAGCT	NA	NA	NA	NA
AUX04541.1|4417367_4418837_+	serine/threonine protein kinase	NA	A0A2K9L5Y0	Tupanvirus	26.5	1.4e-11
AUX04542.1|4419037_4420303_-|integrase	putative P4-type integrase	integrase	B7SYF8	Stenotrophomonas_phage	43.1	1.1e-81
AUX04543.1|4420518_4420815_-	4Fe-4S ferredoxin, iron-sulfur binding	NA	Q38404	Enterobacteria_phage	98.0	5.8e-23
AUX04544.1|4421059_4423393_-	Zinc binding domain / DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
AUX04545.1|4423407_4423728_-	phage-associated DNA replication protein	NA	NA	NA	NA	NA
AUX04546.1|4423863_4424319_-	Phage protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
AUX04547.1|4424311_4424599_-	Phage protein	NA	Q7M2A0	Enterobacteria_phage	96.8	1.9e-47
AUX04548.1|4424591_4425182_-	Phage immunity repressor protein	NA	Q7M2A7	Enterobacteria_phage	90.3	4.1e-60
AUX04549.1|4425178_4425445_-	hypothetical protein	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
AUX04550.1|4425997_4426732_+|capsid	Phage capsid and scaffold protein	capsid	Q7M2A2	Enterobacteria_phage	98.0	1.8e-129
AUX04551.1|4426728_4427229_+	phage transcriptional activator, Ogr/Delta	NA	NA	NA	NA	NA
AUX04552.1|4427302_4427875_+	Phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	6.5e-95
AUX04553.1|4428415_4428919_+	Mobile element protein	NA	U5P0U6	Shigella_phage	98.8	8.2e-94
4435475:4435489	attR	AGCTTGTTTTCTAAG	NA	NA	NA	NA
