The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026378	Pantoea calida strain DSM 22759 chromosome, complete genome	4308453	2062022	2073485	4308453	tRNA	Agrobacterium_phage(12.5%)	13	NA	NA
AUY25159.1|2062022_2062565_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.3	6.3e-15
AUY25160.1|2062662_2062860_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AUY25161.1|2062900_2063257_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AUY25162.1|2063569_2064553_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	6.4e-34
AUY25163.1|2064567_2066955_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	28.1	2.3e-08
AUY25164.1|2066959_2067259_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	9.4e-13
AUY25165.1|2067452_2067890_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
AUY25166.1|2067999_2068983_+	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.6	7.4e-14
AUY25167.1|2069018_2069564_+	glutathione peroxidase	NA	NA	NA	NA	NA
AUY25168.1|2069563_2070313_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	27.0	6.7e-07
AUY25169.1|2070385_2070847_+	endopeptidase	NA	A0A217EQL1	Bacillus_phage	36.0	4.5e-14
AUY25170.1|2071228_2071969_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AUY25171.1|2072045_2073485_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	41.0	1.3e-59
>prophage 2
CP026378	Pantoea calida strain DSM 22759 chromosome, complete genome	4308453	2446339	2497005	4308453	integrase,tail,terminase,head,coat	uncultured_Caudovirales_phage(22.45%)	73	2448405:2448426	2495007:2495028
AUY25478.1|2446339_2448250_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.6	1.9e-90
2448405:2448426	attL	GAACACCGCATGTCGGAAGCGG	NA	NA	NA	NA
AUY25479.1|2450898_2453598_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	68.9	0.0e+00
AUY25480.1|2453597_2453996_-	hypothetical protein	NA	S4TR39	Salmonella_phage	75.0	2.4e-56
AUY25481.1|2454002_2454587_-	hypothetical protein	NA	S4TND4	Salmonella_phage	85.5	1.6e-93
AUY25482.1|2454586_2455180_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	61.9	1.6e-64
AUY25483.1|2455194_2458017_-|tail	phage tail tape measure protein	tail	A0A2H4JD96	uncultured_Caudovirales_phage	36.0	6.0e-109
AUY27149.1|2458624_2459413_-	phage antirepressor Ant	NA	H6WRU9	Salmonella_phage	63.6	4.0e-79
AUY27150.1|2459471_2460029_-	hypothetical protein	NA	Q7Y5X0	Haemophilus_phage	46.3	7.6e-24
AUY25484.1|2460121_2460268_-	DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	58.3	1.2e-08
AUY27151.1|2460410_2460704_+	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	53.6	9.5e-10
AUY25485.1|2460955_2461228_-	hypothetical protein	NA	NA	NA	NA	NA
AUY25486.1|2461377_2461830_-	hypothetical protein	NA	NA	NA	NA	NA
AUY25487.1|2461875_2463051_-	Ig domain-containing protein	NA	A0A059VG08	Pseudomonas_phage	40.9	2.3e-54
AUY25488.1|2463075_2463468_-	electron transfer flavoprotein subunit beta	NA	A0A059VK45	Pseudomonas_phage	34.6	1.9e-13
AUY25489.1|2463464_2463845_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	47.5	3.2e-26
AUY25490.1|2463844_2464228_-	glutamate 5-kinase	NA	A0A059VA70	Pseudomonas_phage	44.0	6.0e-20
AUY25491.1|2464227_2464617_-	protein singed	NA	A0A0S2SYB7	Pseudomonas_phage	44.2	2.5e-13
AUY25492.1|2464656_2464878_-	hypothetical protein	NA	A0A2H4J0Y2	uncultured_Caudovirales_phage	56.1	3.6e-09
AUY25493.1|2464921_2465977_-|coat	coat protein	coat	A0A2H4J3W6	uncultured_Caudovirales_phage	62.4	2.4e-119
AUY25494.1|2465988_2466687_-	hypothetical protein	NA	NA	NA	NA	NA
AUY25495.1|2466768_2466957_-	hypothetical protein	NA	NA	NA	NA	NA
AUY25496.1|2466966_2468013_-|head	phage head morphogenesis protein	head	A0A0S0N1M5	Pseudomonas_phage	32.9	2.5e-44
AUY25497.1|2468015_2469458_-	DUF4055 domain-containing protein	NA	A0A2H4J5M6	uncultured_Caudovirales_phage	36.9	1.2e-76
AUY25498.1|2469464_2470775_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.4	4.6e-144
AUY25499.1|2470752_2471079_-	hypothetical protein	NA	NA	NA	NA	NA
AUY25500.1|2471116_2472263_+	DDE domain-containing protein	NA	U5P429	Shigella_phage	92.6	2.3e-147
AUY25501.1|2472260_2472746_-	hypothetical protein	NA	A0A1B1P867	Bacillus_phage	33.3	2.4e-10
AUY25502.1|2472757_2473006_-	hypothetical protein	NA	NA	NA	NA	NA
AUY25503.1|2473007_2473955_-	hypothetical protein	NA	H2DE35	Erwinia_phage	31.9	8.4e-23
AUY25504.1|2474246_2474768_-	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	87.8	2.2e-86
AUY25505.1|2474983_2475337_-	hypothetical protein	NA	A0AR14	Salmonella_phage	75.2	3.0e-42
AUY25506.1|2475487_2475784_-	hypothetical protein	NA	NA	NA	NA	NA
AUY25507.1|2475780_2476125_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	49.1	3.5e-19
AUY25508.1|2476121_2476589_-	lysozyme	NA	H9C148	Vibrio_phage	45.1	2.5e-28
AUY27152.1|2476557_2476791_-	hypothetical protein	NA	NA	NA	NA	NA
AUY25509.1|2477513_2478137_-	hypothetical protein	NA	A0A2H4JCH5	uncultured_Caudovirales_phage	89.9	9.8e-105
AUY25510.1|2478248_2478473_-	protein ninY	NA	Q5G8R9	Enterobacteria_phage	55.4	1.6e-20
AUY25511.1|2478469_2478832_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A2H4J472	uncultured_Caudovirales_phage	91.7	8.9e-58
AUY25512.1|2478828_2479119_-	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	95.8	7.9e-49
AUY25513.1|2479111_2479252_-	hypothetical protein	NA	NA	NA	NA	NA
AUY25514.1|2479238_2480279_-	DNA cytosine methyltransferase	NA	W0LM09	Edwardsiella_phage	58.9	2.5e-105
AUY25515.1|2480275_2480449_-	NinE family protein	NA	NA	NA	NA	NA
AUY25516.1|2480433_2480742_-	hypothetical protein	NA	NA	NA	NA	NA
AUY25517.1|2480767_2481133_-	hypothetical protein	NA	NA	NA	NA	NA
AUY25518.1|2481129_2481324_-	hypothetical protein	NA	NA	NA	NA	NA
AUY25519.1|2481325_2481757_-	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	73.2	3.5e-53
AUY25520.1|2481725_2481920_-	protein ninD	NA	Q8HAF7	Salmonella_phage	51.9	3.7e-10
AUY25521.1|2481912_2482095_-	hypothetical protein	NA	NA	NA	NA	NA
AUY25522.1|2482094_2482286_-	hypothetical protein	NA	NA	NA	NA	NA
AUY25523.1|2482269_2483646_-	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	79.0	6.1e-208
AUY25524.1|2483642_2484032_-	hypothetical protein	NA	E5AGE9	Erwinia_phage	81.6	3.5e-60
AUY25525.1|2484225_2484741_-	hypothetical protein	NA	A0A1I9KG10	Aeromonas_phage	46.7	1.9e-29
AUY25526.1|2484902_2485193_-	hypothetical protein	NA	I6RSP4	Salmonella_phage	79.2	1.1e-34
AUY25527.1|2485317_2485545_-	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	54.1	2.7e-12
AUY25528.1|2487041_2487308_+	hypothetical protein	NA	NA	NA	NA	NA
AUY25529.1|2487909_2488218_+	hypothetical protein	NA	NA	NA	NA	NA
AUY25530.1|2488217_2489036_+	exodeoxyribonuclease VIII	NA	A0A1P8DTH1	Proteus_phage	69.5	3.4e-113
AUY25531.1|2489028_2489850_+	recombinase RecT	NA	A0A1P8DTF2	Proteus_phage	79.8	1.2e-113
AUY25532.1|2489827_2489998_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	60.0	8.8e-08
AUY25533.1|2490001_2490223_+	hypothetical protein	NA	NA	NA	NA	NA
AUY25534.1|2490215_2490923_+	hypothetical protein	NA	NA	NA	NA	NA
AUY25535.1|2490919_2491318_+	hypothetical protein	NA	NA	NA	NA	NA
AUY25536.1|2491314_2491497_+	hypothetical protein	NA	NA	NA	NA	NA
AUY25537.1|2491680_2491923_+	DNA polymerase III subunit theta	NA	A0A2H4J4A9	uncultured_Caudovirales_phage	81.2	1.8e-30
AUY27153.1|2492145_2492358_+	hypothetical protein	NA	A0A2H4IYB3	uncultured_Caudovirales_phage	46.4	8.1e-11
AUY25538.1|2492358_2492583_+	hypothetical protein	NA	A0A2H4J398	uncultured_Caudovirales_phage	70.8	4.7e-25
AUY25539.1|2492579_2492786_+	hypothetical protein	NA	NA	NA	NA	NA
AUY25540.1|2492830_2493496_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	77.8	5.8e-95
AUY25541.1|2493576_2493924_+	DNA-binding protein	NA	F1C5B3	Cronobacter_phage	70.7	1.7e-34
AUY25542.1|2493950_2494961_+|integrase	integrase	integrase	S5FNS2	Shigella_phage	63.7	2.5e-126
AUY25543.1|2494973_2495336_+	RidA family protein	NA	NA	NA	NA	NA
2495007:2495028	attR	GAACACCGCATGTCGGAAGCGG	NA	NA	NA	NA
AUY25544.1|2495336_2495519_-	YoaH family protein	NA	NA	NA	NA	NA
AUY25545.1|2495622_2497005_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	39.3	1.1e-39
>prophage 3
CP026378	Pantoea calida strain DSM 22759 chromosome, complete genome	4308453	2513474	2609557	4308453	tRNA,integrase,tail,capsid,portal,protease,plate,head	Erwinia_phage(55.32%)	94	2555807:2555823	2576289:2576305
AUY25561.1|2513474_2514356_-|protease	protease HtpX	protease	NA	NA	NA	NA
AUY25562.1|2514594_2516640_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	1.4e-86
AUY25563.1|2516659_2517349_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AUY25564.1|2517445_2517946_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AUY25565.1|2518165_2519407_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AUY25566.1|2519372_2522009_+	MCE family protein	NA	NA	NA	NA	NA
AUY25567.1|2521981_2523553_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AUY25568.1|2523607_2523808_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AUY25569.1|2523801_2524449_-	serine/threonine-protein phosphatase	NA	S4TNS0	Salmonella_phage	48.6	1.2e-57
AUY25570.1|2524723_2525593_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUY25571.1|2525730_2526624_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	30.4	6.5e-17
AUY25572.1|2526814_2527747_-	acyltransferase	NA	NA	NA	NA	NA
AUY25573.1|2529170_2529650_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUY25574.1|2529968_2530571_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUY25575.1|2530614_2531310_+	hypothetical protein	NA	NA	NA	NA	NA
AUY25576.1|2531732_2531981_+	CsbD family protein	NA	NA	NA	NA	NA
AUY25577.1|2532688_2533276_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUY25578.1|2533364_2534258_+	hypothetical protein	NA	NA	NA	NA	NA
AUY25579.1|2534305_2537416_+	hydrophobe/amphiphile efflux-1 family RND transporter	NA	S5VTK5	Leptospira_phage	22.9	6.3e-59
AUY25580.1|2537984_2538311_-	DUF1493 domain-containing protein	NA	NA	NA	NA	NA
AUY25581.1|2538480_2538714_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	58.3	1.2e-10
AUY25582.1|2538759_2539080_-	DUF1493 domain-containing protein	NA	A0A218M4K1	Erwinia_phage	70.6	2.0e-37
AUY25583.1|2539091_2539526_-	hypothetical protein	NA	A0A218M4J4	Erwinia_phage	71.5	3.8e-55
AUY25584.1|2540936_2542730_-	hypothetical protein	NA	NA	NA	NA	NA
AUY25585.1|2542802_2543645_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	50.9	1.2e-76
AUY25586.1|2543759_2544161_+	hypothetical protein	NA	NA	NA	NA	NA
AUY25587.1|2544192_2544702_+	hypothetical protein	NA	A0A218M4I4	Erwinia_phage	63.7	5.8e-55
AUY25588.1|2544709_2544904_+	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	62.5	2.4e-17
AUY25589.1|2544896_2545280_+	hypothetical protein	NA	F1BUS4	Erwinia_phage	81.1	7.5e-55
AUY25590.1|2545349_2545577_+	DUF2732 domain-containing protein	NA	F1BUS3	Erwinia_phage	64.0	9.6e-18
AUY25591.1|2545576_2545801_+	hypothetical protein	NA	F1BUS2	Erwinia_phage	64.9	7.0e-21
AUY25592.1|2545800_2548035_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	77.1	0.0e+00
AUY25593.1|2548144_2548324_+	hypothetical protein	NA	NA	NA	NA	NA
AUY25594.1|2548400_2548583_+	hypothetical protein	NA	NA	NA	NA	NA
AUY25595.1|2548742_2549873_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	34.2	3.9e-43
AUY25596.1|2549829_2550804_+	HNH endonuclease	NA	NA	NA	NA	NA
AUY25597.1|2550841_2551870_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	95.6	1.9e-193
AUY25598.1|2551869_2553633_-	oxidoreductase	NA	F1BUR2	Erwinia_phage	98.0	0.0e+00
AUY25599.1|2553778_2554627_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	89.0	2.3e-136
AUY25600.1|2554677_2555757_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	95.3	4.0e-194
AUY25601.1|2555760_2556429_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	97.3	2.7e-116
2555807:2555823	attL	AGGCCGCACAGCAGCAG	NA	NA	NA	NA
AUY25602.1|2556521_2556986_+|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	78.6	5.0e-61
AUY25603.1|2556985_2557189_+|tail	phage tail protein	tail	F1BUQ5	Erwinia_phage	94.0	3.0e-31
AUY25604.1|2557194_2557419_+	hypothetical protein	NA	F1BUQ4	Erwinia_phage	91.9	3.6e-33
AUY25605.1|2557402_2557912_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	65.6	2.0e-55
AUY25606.1|2557908_2558358_+	LysB family transcriptional regulator	NA	F1BUQ1	Erwinia_phage	88.4	3.0e-63
AUY25607.1|2558432_2558900_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	94.8	2.0e-78
AUY25608.1|2558896_2559349_+	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	81.2	3.2e-57
AUY25609.1|2559677_2559884_+	hypothetical protein	NA	NA	NA	NA	NA
AUY25610.1|2559918_2561100_+	RNA-directed DNA polymerase	NA	A0A0F7LDS3	Escherichia_phage	30.6	1.8e-27
AUY25611.1|2561090_2561312_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
AUY27156.1|2561431_2562016_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	94.3	7.3e-102
AUY25612.1|2562012_2562363_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	94.8	1.4e-55
AUY25613.1|2562367_2563276_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	97.4	2.6e-154
AUY25614.1|2563268_2563877_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	97.5	1.1e-111
AUY25615.1|2566555_2567152_+	DNA-invertase	NA	A0A1S6L009	Salmonella_phage	76.3	7.3e-73
AUY25616.1|2568395_2568908_+|tail	phage major tail tube protein	tail	F1BUU2	Erwinia_phage	97.6	4.6e-92
AUY25617.1|2568968_2569265_+|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	85.7	2.6e-39
AUY27157.1|2569279_2569402_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	74.3	2.2e-08
AUY25618.1|2572367_2573543_+	hypothetical protein	NA	A0A0M5M5V5	Salmonella_phage	68.6	1.0e-150
AUY25619.1|2573635_2573854_+	transcriptional regulator	NA	F1BUT0	Erwinia_phage	83.3	1.4e-29
AUY25620.1|2573997_2575062_+|integrase	integrase	integrase	A0A0M4S6G4	Salmonella_phage	58.3	1.8e-119
AUY25621.1|2575394_2575736_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AUY25622.1|2575786_2576662_-	copper resistance protein CopD	NA	NA	NA	NA	NA
2576289:2576305	attR	AGGCCGCACAGCAGCAG	NA	NA	NA	NA
AUY25623.1|2576664_2577042_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AUY25624.1|2577159_2577387_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	6.9e-16
AUY25625.1|2577414_2578086_+	exodeoxyribonuclease X	NA	NA	NA	NA	NA
AUY25626.1|2578082_2580146_-	oligopeptidase B	NA	NA	NA	NA	NA
AUY25627.1|2580273_2580945_-	DUF533 domain-containing protein	NA	NA	NA	NA	NA
AUY25628.1|2581218_2581533_-	DNA damage-inducible SOS regulon protein	NA	NA	NA	NA	NA
AUY25629.1|2581668_2582847_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
AUY25630.1|2582886_2583525_-	keto-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
AUY25631.1|2583735_2585211_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.0	1.6e-76
AUY25632.1|2585570_2586443_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AUY25633.1|2586739_2588182_+	pyruvate kinase	NA	NA	NA	NA	NA
AUY25634.1|2588685_2590242_+	pyridoxal-dependent decarboxylase	NA	NA	NA	NA	NA
AUY25635.1|2590252_2591545_+	alcaligin biosynthesis protein	NA	NA	NA	NA	NA
AUY25636.1|2591546_2593904_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUY25637.1|2594143_2595376_+	multidrug transporter MdfA	NA	NA	NA	NA	NA
AUY25638.1|2595448_2596429_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AUY25639.1|2596614_2597940_-	murein DD-endopeptidase MepM	NA	G9BW84	Planktothrix_phage	43.8	1.2e-19
AUY25640.1|2597953_2598901_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUY25641.1|2598978_2599731_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	31.2	8.4e-18
AUY25642.1|2599730_2600516_+	zinc ABC transporter permease	NA	NA	NA	NA	NA
AUY25643.1|2600627_2601632_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.8	1.8e-07
AUY25644.1|2601640_2602255_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AUY25645.1|2602339_2602864_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	33.3	2.9e-09
AUY25646.1|2602900_2603644_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AUY25647.1|2603823_2604258_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AUY25648.1|2604259_2606038_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	29.1	8.1e-11
AUY25649.1|2606350_2606914_+	hydrolase	NA	NA	NA	NA	NA
AUY25650.1|2606954_2607779_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	75.6	4.7e-54
AUY25651.1|2607851_2608592_+|tRNA	tRNA (cmo5U34)-methyltransferase	tRNA	NA	NA	NA	NA
AUY25652.1|2608588_2609557_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
>prophage 4
CP026378	Pantoea calida strain DSM 22759 chromosome, complete genome	4308453	3309070	3381096	4308453	tRNA,integrase,tail,capsid,portal,plate,head	Salmonella_phage(55.56%)	85	3352355:3352402	3381209:3381256
AUY26206.1|3309070_3309799_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
AUY26207.1|3309919_3310723_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
AUY26208.1|3310796_3311786_-	nickel transporter	NA	NA	NA	NA	NA
AUY26209.1|3311770_3312436_-	DUF1007 domain-containing protein	NA	NA	NA	NA	NA
AUY26210.1|3312560_3313829_+	PRD domain-containing protein	NA	NA	NA	NA	NA
AUY26211.1|3313811_3314975_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
AUY26212.1|3315099_3316353_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.5	1.7e-100
AUY26213.1|3316671_3317856_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AUY26214.1|3317892_3318585_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
AUY26215.1|3318694_3319033_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
AUY26216.1|3319156_3320491_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	38.8	7.2e-12
AUY26217.1|3320490_3321222_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AUY27196.1|3321227_3322652_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.4	4.3e-15
AUY26218.1|3323293_3327184_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	1.9e-129
AUY26219.1|3327448_3328906_+	membrane-bound lytic murein transglycosylase MltF	NA	I1VXB7	Halocynthia_phage	47.7	2.5e-10
AUY27197.1|3328902_3329427_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
AUY26220.1|3329486_3330122_-	acid phosphatase AphA	NA	NA	NA	NA	NA
AUY26221.1|3330362_3331202_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AUY26222.1|3331261_3331516_+	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	6.3e-18
AUY26223.1|3331528_3331909_-	holo-ACP synthase	NA	NA	NA	NA	NA
AUY26224.1|3331908_3332640_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AUY26225.1|3332700_3333435_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AUY26226.1|3333442_3334348_-	GTPase Era	NA	NA	NA	NA	NA
AUY26227.1|3334344_3335025_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.9	6.2e-20
AUY26228.1|3335156_3336131_-	signal peptidase I	NA	NA	NA	NA	NA
AUY26229.1|3336140_3337940_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.6	1.9e-23
AUY26230.1|3338144_3338645_-	SoxR reducing system protein RseC	NA	NA	NA	NA	NA
AUY26231.1|3338641_3339598_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
AUY26232.1|3339597_3340248_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
AUY26233.1|3340278_3340854_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.0	1.6e-05
AUY26234.1|3341297_3342917_+	L-aspartate oxidase	NA	NA	NA	NA	NA
AUY27198.1|3342901_3343639_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
AUY26235.1|3343771_3345112_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.6	1.9e-44
AUY26236.1|3345339_3345723_-	autonomous glycyl radical cofactor GrcA	NA	Q56BW7	Escherichia_virus	70.2	8.9e-32
AUY26237.1|3345997_3346675_+	uracil-DNA glycosylase	NA	A0A0A7D9F8	Equid_alphaherpesvirus	50.0	1.0e-54
AUY26238.1|3346714_3347308_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUY27199.1|3347290_3347416_+	inorganic polyphosphate kinase	NA	NA	NA	NA	NA
AUY26239.1|3347430_3348309_+	NAD(+) kinase	NA	NA	NA	NA	NA
AUY26240.1|3348396_3350058_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AUY26241.1|3350244_3350598_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AUY26242.1|3350635_3350923_-	RnfH family protein	NA	NA	NA	NA	NA
AUY26243.1|3350915_3351350_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AUY26244.1|3351509_3351992_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	44.9	1.3e-27
3352355:3352402	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAAT	NA	NA	NA	NA
AUY26245.1|3352522_3352741_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	67.2	9.8e-20
AUY26246.1|3352813_3353911_-	late control protein D	NA	E5G6Q3	Salmonella_phage	77.2	4.5e-153
AUY26247.1|3353907_3354393_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	71.4	4.5e-57
AUY26248.1|3354389_3357029_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	43.3	9.5e-133
AUY27200.1|3357021_3357144_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	84.6	8.5e-13
AUY26249.1|3357158_3357482_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	73.1	4.1e-30
AUY26250.1|3357539_3358055_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	90.1	4.6e-84
AUY26251.1|3358067_3359240_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	3.3e-202
AUY26252.1|3359276_3359909_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	76.8	2.6e-73
AUY26253.1|3359930_3360341_+	hypothetical protein	NA	F1BUU9	Erwinia_phage	100.0	1.4e-51
AUY26254.1|3360336_3360762_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	99.3	6.5e-76
AUY26255.1|3360831_3361305_-|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	99.4	1.8e-90
AUY26256.1|3361784_3362126_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	41.7	1.1e-12
AUY26257.1|3362136_3363312_-|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	65.1	9.8e-130
AUY26258.1|3363308_3363923_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	73.5	4.1e-87
AUY26259.1|3363919_3364840_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	67.9	5.9e-106
AUY26260.1|3364826_3365186_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	62.2	3.5e-38
AUY26261.1|3365182_3365761_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	60.2	7.1e-65
AUY26262.1|3365830_3366277_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	63.5	1.0e-47
AUY26263.1|3366276_3366702_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	74.8	1.3e-55
AUY27201.1|3366664_3366904_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	73.4	4.1e-27
AUY26264.1|3366797_3367226_-	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	57.4	4.5e-32
AUY26265.1|3367146_3367734_-	glycoside hydrolase	NA	E5G6N1	Salmonella_phage	83.9	6.7e-79
AUY26266.1|3367714_3367930_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	64.8	1.3e-19
AUY26267.1|3367934_3368138_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	86.6	1.7e-29
AUY26268.1|3368137_3368602_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	76.6	1.6e-64
AUY26269.1|3368702_3369353_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	80.1	2.4e-90
AUY26270.1|3369356_3370412_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	89.3	9.9e-174
AUY26271.1|3370428_3371262_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	66.8	5.3e-98
AUY26272.1|3371404_3373171_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	89.8	0.0e+00
AUY26273.1|3373170_3374226_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	82.8	9.6e-169
AUY26274.1|3374600_3374834_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	67.5	2.1e-23
AUY26275.1|3374849_3375035_-	hypothetical protein	NA	NA	NA	NA	NA
AUY26276.1|3375182_3377531_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	84.5	0.0e+00
AUY26277.1|3377530_3377755_-	hypothetical protein	NA	F1BUS2	Erwinia_phage	74.3	1.4e-24
AUY26278.1|3377754_3377982_-	DUF2732 domain-containing protein	NA	F1BUS3	Erwinia_phage	94.7	5.4e-29
AUY26279.1|3378051_3378393_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	62.8	5.5e-33
AUY26280.1|3378356_3378548_-	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	77.8	5.4e-14
AUY26281.1|3378555_3379065_-	hypothetical protein	NA	F1BUS6	Erwinia_phage	69.2	4.6e-60
AUY26282.1|3379085_3379340_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	53.8	5.3e-17
AUY26283.1|3379463_3380066_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	51.2	2.2e-53
AUY26284.1|3380067_3381096_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	83.0	8.2e-173
3381209:3381256	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAAT	NA	NA	NA	NA
>prophage 5
CP026378	Pantoea calida strain DSM 22759 chromosome, complete genome	4308453	3749977	3784238	4308453	tRNA,integrase,tail,capsid,portal,plate,head	Erwinia_phage(83.33%)	38	3743126:3743141	3790252:3790267
3743126:3743141	attL	CGGCCAGCGCGCTCAG	NA	NA	NA	NA
AUY26586.1|3749977_3750994_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	2.0e-107
AUY26587.1|3751296_3751512_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AUY26588.1|3753661_3755506_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
AUY26589.1|3755555_3756074_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
AUY26590.1|3756525_3756744_-	transcriptional regulator	NA	F1BUT0	Erwinia_phage	100.0	2.6e-36
AUY26591.1|3756811_3757984_-	hypothetical protein	NA	A0A0M5M5V5	Salmonella_phage	65.7	5.0e-142
AUY26592.1|3757980_3758508_-|tail	phage tail protein	tail	F1BUT6	Erwinia_phage	100.0	8.9e-83
AUY26593.1|3760980_3761115_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	74.4	2.5e-10
AUY26594.1|3761117_3761414_-|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	100.0	2.0e-47
AUY26595.1|3761473_3761986_-|tail	phage major tail tube protein	tail	F1BUU2	Erwinia_phage	100.0	1.9e-93
AUY26596.1|3761998_3763168_-|tail	phage tail protein	tail	F1BUU3	Erwinia_phage	99.5	9.2e-221
AUY26597.1|3763230_3763827_-	DNA-invertase	NA	A0A1S6L009	Salmonella_phage	75.1	5.6e-73
AUY26598.1|3765276_3766428_-|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	83.1	3.4e-151
AUY26599.1|3766424_3767933_-|tail	phage tail protein I	tail	F1BUP3	Erwinia_phage	99.7	3.0e-155
AUY26600.1|3767937_3768288_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	100.0	6.6e-58
AUY26601.1|3768284_3768869_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	100.0	3.4e-107
AUY26602.1|3768938_3769388_-	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	100.0	1.5e-75
AUY26603.1|3769384_3769852_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	100.0	3.0e-82
AUY26604.1|3769929_3770376_-	LysB family transcriptional regulator	NA	F1BUQ1	Erwinia_phage	100.0	8.4e-74
AUY26605.1|3770372_3770882_-	lysozyme	NA	E5G6N1	Salmonella_phage	66.9	6.2e-57
AUY26606.1|3770865_3771090_-	hypothetical protein	NA	F1BUQ4	Erwinia_phage	100.0	1.7e-35
AUY26607.1|3771095_3771299_-|tail	phage tail protein	tail	F1BUQ5	Erwinia_phage	100.0	1.1e-33
AUY26608.1|3771298_3771763_-|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	100.0	1.8e-82
AUY26609.1|3771855_3772524_-	hypothetical protein	NA	F1BUQ7	Erwinia_phage	99.5	7.5e-119
AUY26610.1|3772527_3773607_-|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	100.0	5.5e-204
AUY26611.1|3773657_3774506_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	100.0	3.8e-152
AUY26612.1|3774651_3776415_+	oxidoreductase	NA	F1BUR2	Erwinia_phage	100.0	0.0e+00
AUY26613.1|3776414_3777458_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	100.0	2.2e-205
AUY26614.1|3777952_3778150_-	hypothetical protein	NA	F1BUR9	Erwinia_phage	100.0	8.9e-28
AUY26615.1|3778350_3780603_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	99.9	0.0e+00
AUY26616.1|3780602_3780827_-	hypothetical protein	NA	F1BUS2	Erwinia_phage	100.0	2.7e-36
AUY26617.1|3780826_3781054_-	DUF2732 domain-containing protein	NA	F1BUS3	Erwinia_phage	100.0	2.4e-32
AUY27218.1|3781123_3781411_-	hypothetical protein	NA	F1BUS4	Erwinia_phage	100.0	1.7e-51
AUY27219.1|3781499_3781694_-	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	100.0	1.2e-32
AUY26618.1|3781701_3782211_-	hypothetical protein	NA	F1BUS6	Erwinia_phage	100.0	3.1e-88
AUY26619.1|3782241_3782505_-	DNA-binding protein	NA	F1BUS7	Erwinia_phage	100.0	9.0e-44
AUY26620.1|3782628_3783201_+	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	100.0	4.9e-103
AUY26621.1|3783200_3784238_+|integrase	integrase	integrase	F1BUS9	Erwinia_phage	100.0	5.5e-201
3790252:3790267	attR	CGGCCAGCGCGCTCAG	NA	NA	NA	NA
