The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP014071	Klebsiella quasipneumoniae strain ATCC 700603 chromosome, complete genome	5284722	2151115	2157974	5284722	tRNA	Moumouvirus(16.67%)	9	NA	NA
AVF88181.1|2151115_2152501_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
AVF88182.1|2152546_2152759_-	ribosome-associated protein	NA	NA	NA	NA	NA
AVF88183.1|2152760_2153627_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
AVF88184.1|2153665_2153989_+	hypothetical protein	NA	NA	NA	NA	NA
AVF91095.1|2154208_2155423_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	53.4	4.7e-127
AVF88185.1|2155566_2156292_+	hypothetical protein	NA	NA	NA	NA	NA
AVF88186.1|2156519_2156717_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.4	6.6e-07
AVF88187.1|2156716_2157151_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	57.9	2.9e-31
AVF88188.1|2157164_2157974_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	42.4	3.1e-26
>prophage 2
CP014071	Klebsiella quasipneumoniae strain ATCC 700603 chromosome, complete genome	5284722	2622906	2681478	5284722	tRNA,integrase,plate,portal,protease	Salmonella_phage(40.0%)	60	2622814:2622832	2637632:2637650
2622814:2622832	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
AVF88600.1|2622906_2623959_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	55.3	5.7e-105
AVF88601.1|2624030_2626025_-	hypothetical protein	NA	NA	NA	NA	NA
AVF88602.1|2626049_2626640_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	42.2	3.3e-41
AVF88603.1|2626735_2626957_+	regulator	NA	NA	NA	NA	NA
AVF88604.1|2626989_2627499_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	87.6	2.2e-78
AVF91115.1|2627506_2627692_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	77.0	1.2e-21
AVF88605.1|2627670_2628012_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	83.2	8.7e-47
AVF88606.1|2628079_2628316_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	61.9	3.7e-12
AVF91116.1|2628315_2628522_+	conjugal transfer protein TraR	NA	A0A1S6L007	Salmonella_phage	78.0	1.0e-13
AVF88607.1|2629950_2630136_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	50.0	5.6e-08
AVF88608.1|2630210_2630396_+	hypothetical protein	NA	NA	NA	NA	NA
AVF88609.1|2630420_2631068_+|protease	serine protease	protease	NA	NA	NA	NA
AVF88610.1|2631064_2631511_+	hypothetical protein	NA	NA	NA	NA	NA
AVF88611.1|2631537_2632560_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.1	2.3e-175
AVF88612.1|2633633_2634836_+	SIR2 family protein	NA	NA	NA	NA	NA
AVF88613.1|2634911_2635484_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	2.1e-77
AVF88614.1|2635480_2635843_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.1	1.1e-47
AVF88615.1|2637780_2639466_-	transporter	NA	NA	NA	NA	NA
2637632:2637650	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
AVF88616.1|2639733_2640117_+	hypothetical protein	NA	NA	NA	NA	NA
AVF88617.1|2640123_2640387_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AVF91117.1|2640589_2640877_+	hypothetical protein	NA	NA	NA	NA	NA
AVF88618.1|2640860_2641583_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AVF88619.1|2641697_2642600_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.5	9.1e-35
AVF88620.1|2642688_2643168_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
AVF88621.1|2643516_2644629_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AVF91118.1|2644790_2645924_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AVF88622.1|2645934_2646888_+	putrescine ABC transporter permease	NA	NA	NA	NA	NA
AVF88623.1|2646884_2647730_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AVF88624.1|2647787_2648276_+	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AVF88625.1|2648317_2649445_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	26.5	2.7e-20
AVF88626.1|2649523_2650240_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	6.1e-34
AVF88627.1|2650236_2651709_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	3.9e-27
AVF88628.1|2651792_2652524_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVF88629.1|2652708_2653377_-	arginine transporter permease subunit ArtM	NA	NA	NA	NA	NA
AVF88630.1|2653376_2654093_-	arginine transporter permease subunit ArtQ	NA	NA	NA	NA	NA
AVF91119.1|2654099_2654831_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVF88631.1|2654851_2655580_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	2.7e-29
AVF88632.1|2655806_2656322_-	lipoprotein	NA	NA	NA	NA	NA
AVF88633.1|2656572_2656860_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVF88634.1|2657204_2658344_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AVF88635.1|2658375_2659206_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.5	1.8e-05
AVF88636.1|2659202_2660216_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVF88637.1|2660303_2661746_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
AVF88638.1|2661756_2662758_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AVF91120.1|2662796_2664515_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AVF88639.1|2664666_2665101_+	DoxX family protein	NA	NA	NA	NA	NA
AVF88640.1|2665174_2665357_-	hypothetical protein	NA	NA	NA	NA	NA
AVF88641.1|2665307_2666276_-	NADH oxidoreductase	NA	NA	NA	NA	NA
AVF91121.1|2666286_2667939_-	hydroxylamine reductase	NA	NA	NA	NA	NA
AVF88642.1|2668082_2668982_-	DUF340 domain-containing protein	NA	NA	NA	NA	NA
AVF88643.1|2669096_2669792_-	aquaporin Z	NA	NA	NA	NA	NA
AVF88644.1|2670211_2671870_+	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
AVF88645.1|2672016_2673132_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AVF88646.1|2673128_2675069_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.4e-37
AVF88647.1|2675145_2675367_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AVF88648.1|2675692_2676010_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AVF88649.1|2676040_2678320_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	2.8e-165
AVF88650.1|2678443_2678662_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AVF88651.1|2679012_2679717_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVF88652.1|2679756_2681478_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	32.5	1.7e-13
>prophage 3
CP014071	Klebsiella quasipneumoniae strain ATCC 700603 chromosome, complete genome	5284722	2813892	2849612	5284722	terminase,integrase,tail,plate,portal,capsid	Enterobacteria_phage(48.28%)	45	2809969:2809984	2824161:2824176
2809969:2809984	attL	GTCGGCGCTGTTCTTC	NA	NA	NA	NA
AVF88758.1|2813892_2814900_-|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	52.5	4.5e-99
AVF88759.1|2814987_2815290_-	XRE family transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	61.0	2.6e-26
AVF88760.1|2815384_2815717_+	hypothetical protein	NA	NA	NA	NA	NA
AVF91127.1|2815926_2816106_+	DUF4761 domain-containing protein	NA	NA	NA	NA	NA
AVF88761.1|2816117_2816357_+	hypothetical protein	NA	NA	NA	NA	NA
AVF91128.1|2816359_2816632_+	hypothetical protein	NA	NA	NA	NA	NA
AVF91129.1|2816700_2816925_+	hypothetical protein	NA	NA	NA	NA	NA
AVF88762.1|2816921_2817503_+	3'-5' exoribonuclease	NA	A0A1Q1PW66	Pseudoalteromonas_phage	37.3	9.1e-28
AVF88763.1|2817511_2818480_+	adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	50.8	9.3e-78
AVF91130.1|2818963_2819239_-	hypothetical protein	NA	NA	NA	NA	NA
AVF88764.1|2819339_2821955_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	53.3	4.4e-199
AVF88765.1|2822215_2822902_+	hypothetical protein	NA	NA	NA	NA	NA
AVF88766.1|2823359_2824412_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.0	2.1e-139
2824161:2824176	attR	GAAGAACAGCGCCGAC	NA	NA	NA	NA
AVF88767.1|2824411_2826133_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	65.6	1.4e-222
AVF88768.1|2826292_2827126_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	64.1	5.5e-95
AVF88769.1|2827150_2828200_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	54.8	4.4e-105
AVF88770.1|2828247_2829162_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	74.1	4.4e-85
AVF88771.1|2829264_2829762_+|capsid	capsid assembly protein	capsid	B9A7B7	Serratia_phage	70.3	7.7e-60
AVF88772.1|2829761_2829962_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	66.2	6.7e-15
AVF88773.1|2829952_2830234_+	hypothetical protein	NA	B9A7B8	Serratia_phage	58.4	6.3e-19
AVF88774.1|2830230_2830782_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	40.8	1.7e-28
AVF88775.1|2830778_2831174_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AVF88776.1|2831318_2831777_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	48.7	2.3e-34
AVF88777.1|2831773_2832415_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	48.0	1.2e-44
AVF88778.1|2832414_2832999_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.2	3.0e-63
AVF88779.1|2832995_2833364_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	56.5	2.0e-28
AVF88780.1|2833350_2834250_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	61.2	3.1e-91
AVF88781.1|2834242_2834839_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	42.4	4.3e-41
AVF88782.1|2837215_2837479_+	hypothetical protein	NA	NA	NA	NA	NA
AVF88783.1|2837665_2838847_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	53.1	6.1e-47
AVF88784.1|2838946_2839801_-	hypothetical protein	NA	NA	NA	NA	NA
AVF88785.1|2840074_2840563_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	59.9	2.0e-52
AVF88786.1|2840574_2843511_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	45.1	5.3e-209
AVF91131.1|2843500_2843677_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	69.0	2.3e-11
AVF88787.1|2843673_2843973_-|tail	phage tail protein	tail	B9A7B2	Serratia_phage	77.1	5.3e-32
AVF88788.1|2844027_2844543_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	71.2	2.4e-64
AVF88789.1|2844542_2845724_-|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.8	1.2e-156
AVF88790.1|2845877_2847032_+	hypothetical protein	NA	B9A7A9	Serratia_phage	81.2	3.8e-179
AVF88791.1|2847076_2847325_+	hypothetical protein	NA	NA	NA	NA	NA
AVF88792.1|2847340_2847562_+	hypothetical protein	NA	NA	NA	NA	NA
AVF88793.1|2847601_2847988_-	hypothetical protein	NA	NA	NA	NA	NA
AVF88794.1|2848157_2848385_-	hypothetical protein	NA	NA	NA	NA	NA
AVF88795.1|2848405_2849002_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
AVF88796.1|2849129_2849351_-	hypothetical protein	NA	NA	NA	NA	NA
AVF88797.1|2849438_2849612_+	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 4
CP014071	Klebsiella quasipneumoniae strain ATCC 700603 chromosome, complete genome	5284722	2965906	3003350	5284722	tRNA,terminase,integrase,head,tail,holin,portal,capsid,protease	Klebsiella_phage(40.0%)	50	2955460:2955474	2991622:2991636
2955460:2955474	attL	TGGCGCCGCCCATCA	NA	NA	NA	NA
AVF91140.1|2965906_2967013_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AVF88900.1|2967069_2967528_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AVF88901.1|2967544_2968195_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AVF88902.1|2968435_2969686_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
AVF88903.1|2969798_2970941_-|integrase	integrase	integrase	Q77Z02	Phage_21	81.1	2.5e-170
AVF88904.1|2970930_2971167_-	excisionase	NA	NA	NA	NA	NA
AVF88905.1|2971196_2971469_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	47.1	1.7e-13
AVF88906.1|2971465_2971744_-	hypothetical protein	NA	NA	NA	NA	NA
AVF88907.1|2971736_2971961_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	48.5	7.0e-13
AVF88908.1|2971957_2972440_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	81.2	4.2e-71
AVF88909.1|2972432_2972777_-	hypothetical protein	NA	NA	NA	NA	NA
AVF88910.1|2972904_2973690_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	49.8	4.2e-60
AVF88911.1|2973689_2973989_-	hypothetical protein	NA	NA	NA	NA	NA
AVF88912.1|2974351_2975047_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	3.5e-87
AVF88913.1|2975144_2975387_+	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
AVF88914.1|2975421_2975883_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	6.4e-69
AVF88915.1|2976120_2976333_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	2.2e-16
AVF88916.1|2976289_2977204_+	transcriptional regulator	NA	H2DE83	Erwinia_phage	57.1	1.1e-30
AVF88917.1|2977200_2978010_+	DNA methylase	NA	A0A1C9II58	Salmonella_phage	69.3	1.6e-110
AVF88918.1|2978019_2978397_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	6.7e-48
AVF88919.1|2978409_2979390_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	67.5	7.1e-134
AVF88920.1|2979403_2979982_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	56.7	3.8e-50
AVF88921.1|2980329_2980740_+	hypothetical protein	NA	NA	NA	NA	NA
AVF88922.1|2980736_2981309_+	hypothetical protein	NA	NA	NA	NA	NA
AVF88923.1|2981480_2981792_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.5	1.1e-40
AVF88924.1|2981788_2982328_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	99.4	5.1e-102
AVF88925.1|2982324_2982672_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	70.4	3.5e-35
AVF88926.1|2982668_2982944_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	65.2	9.2e-23
AVF88927.1|2982894_2983086_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	85.7	1.0e-20
AVF88928.1|2983827_2984262_+	hypothetical protein	NA	NA	NA	NA	NA
AVF91141.1|2984384_2984735_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	79.1	2.3e-50
AVF88929.1|2984892_2985390_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.0	1.9e-63
AVF88930.1|2985393_2987145_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.2	5.2e-252
AVF88931.1|2987292_2988519_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	2.5e-208
AVF88932.1|2988511_2989111_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
AVF88933.1|2989120_2990359_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	8.9e-158
AVF88934.1|2990436_2990754_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.9	2.4e-22
AVF88935.1|2990823_2991036_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	74.3	1.1e-15
AVF88936.1|2991037_2991370_+|head,tail	head-tail adaptor protein	head,tail	A0A286S2A2	Klebsiella_phage	99.1	2.0e-56
AVF88937.1|2991362_2991902_+	hypothetical protein	NA	A0A286S249	Klebsiella_phage	95.5	1.1e-91
2991622:2991636	attR	TGATGGGCGGCGCCA	NA	NA	NA	NA
AVF88938.1|2991898_2992264_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	2.3e-61
AVF88939.1|2992320_2992812_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	99.4	5.0e-88
AVF88940.1|2992855_2993209_+|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
AVF88941.1|2993241_2993505_+|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	98.9	6.9e-44
AVF88942.1|2993993_2996417_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	79.9	0.0e+00
AVF88943.1|2996416_2996887_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.7	8.3e-64
AVF88944.1|2996883_2997366_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	90.6	7.2e-79
AVF88945.1|2997376_2997757_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	92.9	1.7e-67
AVF88946.1|2997753_3000822_+	kinase	NA	A0A286S259	Klebsiella_phage	90.9	0.0e+00
AVF88947.1|3000878_3003350_+	hypothetical protein	NA	J7HXC9	Pseudomonas_phage	33.9	2.0e-15
>prophage 5
CP014071	Klebsiella quasipneumoniae strain ATCC 700603 chromosome, complete genome	5284722	3430245	3441131	5284722		Escherichia_phage(87.5%)	9	NA	NA
AVF89337.1|3430245_3430866_-	aldolase	NA	A0A077SK32	Escherichia_phage	94.7	1.0e-109
AVF89338.1|3430858_3432124_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	92.2	1.0e-217
AVF89339.1|3432135_3433038_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	97.7	1.8e-155
AVF89340.1|3433298_3434060_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	98.4	2.0e-131
AVF89341.1|3434080_3434941_-	class A broad-spectrum beta-lactamase OKP-B-6	NA	A0A077SL40	Escherichia_phage	89.2	6.2e-142
AVF91164.1|3435237_3435498_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AVF89342.1|3435584_3436673_+	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	96.7	1.9e-204
AVF89343.1|3436703_3437969_-	MFS transporter	NA	NA	NA	NA	NA
AVF89344.1|3438023_3441131_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
>prophage 6
CP014071	Klebsiella quasipneumoniae strain ATCC 700603 chromosome, complete genome	5284722	4349494	4364739	5284722		Bacillus_phage(18.18%)	12	NA	NA
AVF90167.1|4349494_4350877_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	25.8	4.2e-31
AVF90168.1|4350900_4352316_-	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
AVF90169.1|4352595_4352880_-	hypothetical protein	NA	NA	NA	NA	NA
AVF90170.1|4353390_4354395_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	6.8e-31
AVF90171.1|4355339_4356506_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
AVF90172.1|4356686_4357241_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.8	1.0e-52
AVF90173.1|4357255_4358146_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.2	3.7e-28
AVF90174.1|4358177_4359047_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.3	9.8e-111
AVF90175.1|4359073_4360138_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.6e-105
AVF90176.1|4360296_4361667_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	26.0	8.4e-32
AVF90177.1|4361690_4363106_-	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	30.8	3.1e-53
AVF90178.1|4363332_4364739_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
>prophage 7
CP014071	Klebsiella quasipneumoniae strain ATCC 700603 chromosome, complete genome	5284722	4406731	4413654	5284722		Bacillus_phage(33.33%)	6	NA	NA
AVF90204.1|4406731_4408228_+	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.3	6.6e-30
AVF90205.1|4408224_4408947_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AVF90206.1|4409265_4410627_+	U32 family peptidase	NA	Q6DW11	Phage_TP	94.2	1.5e-206
AVF91219.1|4410872_4411766_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.3	1.8e-14
AVF90207.1|4412006_4412780_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AVF91220.1|4412790_4413654_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 8
CP014071	Klebsiella quasipneumoniae strain ATCC 700603 chromosome, complete genome	5284722	4624174	4713952	5284722	tRNA,terminase,tail,head,portal,holin,capsid,protease	Klebsiella_phage(30.91%)	100	NA	NA
AVF90390.1|4624174_4624987_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AVF90391.1|4624986_4626000_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AVF91228.1|4626063_4627176_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.9	2.1e-20
AVF90392.1|4627310_4628288_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AVF90393.1|4628374_4629550_-	arabinose transporter	NA	NA	NA	NA	NA
AVF90394.1|4629759_4630980_-	beta-ketoacyl-[acyl-carrier-protein] synthase I	NA	NA	NA	NA	NA
AVF91229.1|4631138_4633127_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AVF90395.1|4633188_4633470_-	YfcL family protein	NA	NA	NA	NA	NA
AVF90396.1|4633501_4634050_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AVF90397.1|4634049_4634859_-	hypothetical protein	NA	NA	NA	NA	NA
AVF90398.1|4634858_4635683_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AVF90399.1|4635685_4636771_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.4	1.0e-88
AVF90400.1|4636813_4637746_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVF90401.1|4637913_4638465_+	endonuclease SmrB	NA	NA	NA	NA	NA
AVF90402.1|4638484_4638970_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AVF90403.1|4639179_4641324_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AVF90404.1|4641323_4642634_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AVF90405.1|4642792_4643077_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
AVF90406.1|4643444_4644773_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AVF90407.1|4644831_4645593_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AVF90408.1|4645882_4646812_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	83.7	3.6e-135
AVF90409.1|4648150_4648519_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	49.0	8.6e-24
AVF91230.1|4648475_4648715_-	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.7	1.5e-21
AVF91231.1|4649479_4649902_+	RND transporter	NA	NA	NA	NA	NA
AVF90410.1|4650676_4651126_+	hypothetical protein	NA	NA	NA	NA	NA
AVF90411.1|4651200_4651464_-	hypothetical protein	NA	NA	NA	NA	NA
AVF90412.1|4651466_4653938_-	hypothetical protein	NA	J7HXC9	Pseudomonas_phage	33.9	2.6e-15
AVF90413.1|4653993_4657062_-	kinase	NA	A0A286S259	Klebsiella_phage	90.5	0.0e+00
AVF90414.1|4657058_4657439_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	92.9	1.7e-67
AVF90415.1|4657568_4657838_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
AVF90416.1|4657818_4658187_-	hypothetical protein	NA	NA	NA	NA	NA
AVF90417.1|4658196_4658679_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	89.4	6.1e-78
AVF90418.1|4658675_4659146_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.4	3.7e-64
AVF90419.1|4659145_4661593_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	64.3	2.6e-265
AVF90420.1|4662171_4662435_-|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	95.4	1.1e-41
AVF90421.1|4662467_4662821_-|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
AVF90422.1|4662864_4663356_-|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	99.4	2.5e-87
AVF90423.1|4663412_4663778_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	93.4	7.8e-62
AVF90424.1|4663774_4664314_-	hypothetical protein	NA	A0A286S249	Klebsiella_phage	98.9	1.1e-93
AVF90425.1|4664306_4664639_-|head,tail	head-tail adaptor protein	head,tail	A0A286S2A2	Klebsiella_phage	100.0	3.1e-57
AVF90426.1|4664640_4664838_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	96.9	5.4e-25
AVF90427.1|4664909_4665236_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	72.2	3.6e-42
AVF90428.1|4665235_4665487_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	5.3e-09
AVF90429.1|4665529_4666747_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	81.4	3.9e-182
AVF90430.1|4666756_4667605_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	85.0	4.6e-129
AVF90431.1|4667617_4668925_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	84.6	1.0e-212
AVF90432.1|4668924_4670667_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.6	2.6e-139
AVF90433.1|4670620_4671085_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	3.7e-48
AVF90434.1|4671267_4671609_-	HNH endonuclease	NA	A0A2I6PIG1	Escherichia_phage	73.9	1.0e-47
AVF90435.1|4671666_4671852_-	Eag protein	NA	K7PL40	Enterobacteria_phage	37.7	1.2e-05
AVF90436.1|4671932_4672178_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	98.8	1.4e-35
AVF90437.1|4672320_4672662_-	hypothetical protein	NA	NA	NA	NA	NA
AVF90438.1|4672750_4672948_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	86.0	8.0e-21
AVF90439.1|4672898_4673174_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	46.1	1.0e-13
AVF90440.1|4673170_4673518_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	78.3	1.5e-38
AVF90441.1|4673514_4674054_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	9.7e-101
AVF90442.1|4674050_4674362_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.5	1.1e-40
AVF90443.1|4675759_4676581_+	hypothetical protein	NA	NA	NA	NA	NA
AVF90444.1|4676605_4677091_+	hypothetical protein	NA	NA	NA	NA	NA
AVF90445.1|4677139_4677481_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	2.5e-54
AVF90446.1|4677499_4678480_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.6	4.2e-134
AVF90447.1|4678492_4678870_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	5.1e-48
AVF90448.1|4678879_4679689_-	DNA methylase	NA	A0A1C9II58	Salmonella_phage	69.3	2.0e-110
AVF90449.1|4679685_4680639_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	75.5	2.8e-103
AVF90450.1|4680628_4680808_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	75.0	1.6e-15
AVF90451.1|4681045_4681498_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.2	5.9e-67
AVF90452.1|4681526_4681790_-	Cro/Cl family transcriptional regulator	NA	D0UIL8	Aggregatibacter_phage	46.6	1.8e-12
AVF90453.1|4681891_4682368_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	45.3	2.0e-12
AVF90454.1|4682538_4683693_+	type I restriction endonuclease subunit R	NA	A0A1S5SAB0	Streptococcus_phage	28.2	1.5e-34
AVF90455.1|4684102_4684402_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.6	4.2e-13
AVF90456.1|4684401_4685187_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.8	1.3e-61
AVF90457.1|4685314_4685659_+	hypothetical protein	NA	NA	NA	NA	NA
AVF90458.1|4685651_4686026_+	hypothetical protein	NA	NA	NA	NA	NA
AVF90459.1|4686025_4686241_+	molecular chaperone DnaJ	NA	R9TNC2	Aeromonas_phage	95.8	1.3e-37
AVF90460.1|4686237_4686876_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	63.1	1.1e-47
AVF90461.1|4686883_4687072_+	hypothetical protein	NA	G3CFG7	Escherichia_phage	63.0	2.6e-13
AVF90462.1|4687509_4687770_-	hypothetical protein	NA	NA	NA	NA	NA
AVF90463.1|4687984_4689160_-	DUF4102 domain-containing protein	NA	A0A2R2Z2Y0	Escherichia_phage	85.8	2.8e-201
AVF90464.1|4689793_4690822_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.2	7.7e-06
AVF90465.1|4690837_4691131_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AVF90466.1|4691249_4691732_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AVF91232.1|4692095_4692956_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	8.5e-06
AVF90467.1|4692986_4693895_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	23.8	2.3e-09
AVF90468.1|4694027_4694486_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	39.4	3.6e-11
AVF90469.1|4694482_4695679_+	cyanate transporter	NA	NA	NA	NA	NA
AVF91233.1|4696016_4696088_+	membrane protein YpdK	NA	NA	NA	NA	NA
AVF90470.1|4696157_4697372_-	alanine transaminase	NA	NA	NA	NA	NA
AVF90471.1|4697754_4699452_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.7	2.3e-47
AVF91234.1|4699463_4700201_+	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
AVF90472.1|4700255_4701221_-	glucokinase	NA	NA	NA	NA	NA
AVF91235.1|4701484_4702720_+	ion channel protein	NA	NA	NA	NA	NA
AVF90473.1|4702716_4704378_-	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
AVF90474.1|4704558_4705551_+	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
AVF90475.1|4705681_4706041_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
AVF90476.1|4706098_4707340_-	divalent metal cation transporter	NA	NA	NA	NA	NA
AVF90477.1|4707685_4708888_+	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
AVF90478.1|4708936_4711108_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AVF90479.1|4711729_4712083_+	hypothetical protein	NA	NA	NA	NA	NA
AVF90480.1|4712086_4712479_+	hypothetical protein	NA	NA	NA	NA	NA
AVF90481.1|4712533_4713952_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 9
CP014071	Klebsiella quasipneumoniae strain ATCC 700603 chromosome, complete genome	5284722	4871371	4950422	5284722	tRNA,integrase,tail,head,plate,portal,capsid	Salmonella_phage(71.43%)	85	4915924:4915970	4951173:4951219
AVF90623.1|4871371_4872109_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
AVF90624.1|4872240_4873572_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.6	3.1e-47
AVF90625.1|4873618_4874002_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
AVF90626.1|4874313_4875003_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.6	5.5e-56
AVF90627.1|4875059_4876130_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AVF90628.1|4876333_4876759_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
AVF90629.1|4876828_4877527_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AVF90630.1|4877561_4880213_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AVF90631.1|4880333_4881689_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AVF90632.1|4881730_4882054_+	hypothetical protein	NA	NA	NA	NA	NA
AVF90633.1|4882057_4883356_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
AVF90634.1|4883439_4883697_-	hypothetical protein	NA	NA	NA	NA	NA
AVF90635.1|4889205_4891779_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
AVF90636.1|4891907_4892639_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AVF90637.1|4892635_4893616_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AVF90638.1|4893747_4894485_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AVF90639.1|4894756_4895092_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AVF91240.1|4895198_4895246_+	hypothetical protein	NA	NA	NA	NA	NA
AVF90640.1|4895346_4896507_+	prephenate dehydratase	NA	NA	NA	NA	NA
AVF90641.1|4896503_4897376_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AVF90642.1|4897438_4898560_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AVF90643.1|4898569_4899640_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	1.1e-90
AVF90644.1|4899982_4900492_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AVF90645.1|4900484_4901708_+	diguanylate cyclase	NA	NA	NA	NA	NA
AVF90646.1|4901721_4902204_+	hypothetical protein	NA	NA	NA	NA	NA
AVF90647.1|4902212_4903571_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
AVF90648.1|4903625_4904087_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AVF90649.1|4904206_4904554_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AVF90650.1|4904593_4905361_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AVF90651.1|4905392_4905941_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AVF90652.1|4905959_4906208_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AVF90653.1|4906467_4907832_-	signal recognition particle protein	NA	NA	NA	NA	NA
AVF90654.1|4907995_4908787_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AVF90655.1|4908806_4910093_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AVF90656.1|4910212_4910803_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AVF90657.1|4910927_4911806_+	NAD(+) kinase	NA	NA	NA	NA	NA
AVF90658.1|4911892_4913554_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AVF90659.1|4913700_4914042_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AVF90660.1|4914111_4914402_-	RnfH family protein	NA	NA	NA	NA	NA
AVF90661.1|4914391_4914868_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AVF90662.1|4914978_4915461_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
4915924:4915970	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
AVF90663.1|4916064_4916436_+	hypothetical protein	NA	NA	NA	NA	NA
AVF90664.1|4916493_4916712_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	73.6	1.7e-27
AVF90665.1|4916778_4917876_-	late control protein D	NA	E5G6Q3	Salmonella_phage	84.4	7.9e-174
AVF90666.1|4917872_4918358_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.0	2.0e-57
AVF90667.1|4918354_4920982_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	38.6	8.6e-118
AVF90668.1|4920974_4921094_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AVF90669.1|4921108_4921408_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	2.8e-33
AVF90670.1|4921460_4921976_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AVF90671.1|4921985_4923158_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	92.8	7.3e-210
AVF90672.1|4923307_4924498_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	52.1	1.6e-50
AVF90673.1|4924509_4924806_-	hypothetical protein	NA	NA	NA	NA	NA
AVF90674.1|4927147_4927744_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	56.4	7.5e-54
AVF90675.1|4927736_4928645_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	67.2	1.1e-107
AVF90676.1|4928631_4928994_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	4.4e-49
AVF90677.1|4928990_4929563_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	71.7	1.0e-76
AVF90678.1|4929640_4930531_+	hypothetical protein	NA	E5G6N5	Salmonella_phage	74.2	1.5e-119
AVF90679.1|4930493_4930940_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.5	4.0e-60
AVF90680.1|4930932_4931364_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	88.1	1.7e-68
AVF90681.1|4931326_4931530_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	89.6	2.7e-27
AVF90682.1|4931459_4931888_-	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	82.9	1.5e-56
AVF90683.1|4931884_4932400_-	lysozyme	NA	E5G6N1	Salmonella_phage	75.3	9.0e-72
AVF90684.1|4932380_4932596_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	66.2	2.0e-20
AVF90685.1|4932599_4932803_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AVF90686.1|4932802_4933270_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	58.1	3.7e-48
AVF90687.1|4933368_4934022_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	56.6	1.8e-56
AVF90688.1|4934025_4935174_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	68.8	4.6e-132
AVF90689.1|4935189_4936017_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	57.0	9.1e-74
AVF90690.1|4936166_4938026_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	81.9	2.9e-301
AVF90691.1|4938025_4939078_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	79.3	7.9e-155
AVF90692.1|4939122_4939461_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
AVF91241.1|4939460_4940435_-	hypothetical protein	NA	A4PE73	Ralstonia_virus	42.1	1.6e-53
AVF91242.1|4940888_4941929_+	DUF262 domain-containing protein	NA	A0A193GZU5	Escherichia_phage	28.1	1.0e-05
AVF91243.1|4942635_4942851_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	63.0	5.3e-10
AVF91244.1|4943168_4943357_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	1.8e-25
AVF90693.1|4943540_4945949_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.8	0.0e+00
AVF90694.1|4945929_4946817_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	73.7	2.6e-119
AVF90695.1|4946813_4947041_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	90.7	1.9e-34
AVF90696.1|4947040_4947274_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	88.3	4.3e-29
AVF90697.1|4947341_4947680_-	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
AVF90698.1|4947643_4947844_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	5.9e-19
AVF90699.1|4947851_4948361_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	85.2	1.9e-77
AVF90700.1|4948462_4948636_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.2	6.2e-25
AVF90701.1|4948758_4949388_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
AVF90702.1|4949390_4950422_+|integrase	integrase	integrase	A0A1S6L016	Salmonella_phage	94.1	1.0e-191
4951173:4951219	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 1
CP014072	Klebsiella quasipneumoniae strain ATCC 700603 plasmid unnamed1	76312	26528	53061	76312	integrase,protease,transposase	Escherichia_phage(30.0%)	32	25387:25401	38690:38704
25387:25401	attL	GGGGTCGTCTCAGAA	NA	NA	NA	NA
AVF91281.1|26528_26801_-|transposase	transposase	transposase	NA	NA	NA	NA
AVF91282.1|26739_27753_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVF91348.1|27901_28435_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
AVF91283.1|28514_29303_+	APH(3') family aminoglycoside O-phosphotransferase AphA16	NA	E4ZFP6	Streptococcus_phage	47.2	1.4e-60
AVF91349.1|29426_30272_+	ANT(3'') family aminoglycoside nucleotidyltransferase	NA	NA	NA	NA	NA
AVF91284.1|30301_31129_+	oxacillin-hydrolyzing class D beta-lactamase OXA-2	NA	NA	NA	NA	NA
AVF91285.1|31264_31612_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVF91286.1|31605_32445_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AVF91287.1|32374_32554_-	hypothetical protein	NA	NA	NA	NA	NA
AVF91288.1|32572_33073_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVF91289.1|33414_34179_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AVF91290.1|34220_34397_+	resolvase	NA	NA	NA	NA	NA
AVF91291.1|34416_34629_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AVF91350.1|34591_34711_+	mercury resistance protein	NA	NA	NA	NA	NA
AVF91292.1|34694_34931_-	mercury resistance protein	NA	NA	NA	NA	NA
AVF91293.1|34927_35293_-	transcriptional regulator	NA	NA	NA	NA	NA
AVF91294.1|35310_36996_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
AVF91295.1|37034_37460_-	mercury transport protein MerC	NA	NA	NA	NA	NA
AVF91296.1|37487_37763_-	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AVF91297.1|37778_38144_-	mercuric transport protein	NA	NA	NA	NA	NA
AVF91298.1|38215_38671_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AVF91299.1|40057_41026_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	7.7e-181
38690:38704	attR	TTCTGAGACGACCCC	NA	NA	NA	NA
AVF91300.1|41146_42007_+	class A extended-spectrum beta-lactamase SHV-18	NA	A0A077SL40	Escherichia_phage	98.6	1.9e-154
AVF91301.1|42027_42789_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AVF91302.1|42896_45794_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	2.5e-182
AVF91303.1|45888_46494_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AVF91304.1|47076_49164_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
AVF91305.1|49176_50127_-	DsbC family protein	NA	NA	NA	NA	NA
AVF91306.1|50137_51400_-	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
AVF91307.1|51444_51840_-	lytic transglycosylase	NA	NA	NA	NA	NA
AVF91308.1|51944_52328_-	hypothetical protein	NA	NA	NA	NA	NA
AVF91309.1|52407_53061_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 1
CP014073	Klebsiella quasipneumoniae strain ATCC 700603 plasmid unnamed2, complete sequence	151998	977	8140	151998		uncultured_Caudovirales_phage(57.14%)	10	NA	NA
AVF91354.1|977_1556_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	37.7	3.9e-23
AVF91355.1|1731_2937_+	chromate transporter	NA	NA	NA	NA	NA
AVF91356.1|2947_3253_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AVF91357.1|3381_4080_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.9	3.8e-89
AVF91358.1|4165_4486_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	2.9e-20
AVF91499.1|4530_5820_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	1.7e-167
AVF91359.1|5832_6258_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.1	1.9e-51
AVF91360.1|6371_6650_+	hypothetical protein	NA	NA	NA	NA	NA
AVF91361.1|6980_7274_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	1.4e-48
AVF91362.1|7372_8140_-	ferric citrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
>prophage 2
CP014073	Klebsiella quasipneumoniae strain ATCC 700603 plasmid unnamed2, complete sequence	151998	22802	83193	151998	integrase,transposase	Bacillus_phage(25.0%)	59	15378:15406	60422:60450
15378:15406	attL	GGCTTTGTTGAATAAATCAGATTTCGGGT	NA	NA	NA	NA
AVF91376.1|22802_23603_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	2.1e-51
AVF91501.1|23641_23989_-	hypothetical protein	NA	NA	NA	NA	NA
AVF91377.1|24350_25160_-	hypothetical protein	NA	NA	NA	NA	NA
AVF91378.1|25156_26077_-	hypothetical protein	NA	NA	NA	NA	NA
AVF91379.1|26646_27735_+	transcriptional regulator	NA	NA	NA	NA	NA
AVF91380.1|27745_29119_+	hypothetical protein	NA	NA	NA	NA	NA
AVF91381.1|29303_30632_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AVF91382.1|30639_31215_+	hypothetical protein	NA	NA	NA	NA	NA
AVF91383.1|31680_31911_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AVF91384.1|31907_32324_+	PIN domain nuclease	NA	NA	NA	NA	NA
AVF91385.1|32397_33960_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AVF91386.1|33944_34967_+	DNA helicase UvrD	NA	NA	NA	NA	NA
AVF91502.1|35510_36419_+	HNH endonuclease	NA	NA	NA	NA	NA
AVF91387.1|36604_36955_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	6.0e-19
AVF91388.1|37102_37534_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AVF91389.1|37784_39260_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AVF91390.1|39252_39933_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
AVF91391.1|40122_41508_+	hypothetical protein	NA	NA	NA	NA	NA
AVF91392.1|41536_41890_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVF91393.1|42003_43296_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVF91394.1|43306_46453_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.6	8.0e-62
AVF91395.1|46539_46980_+	hypothetical protein	NA	NA	NA	NA	NA
AVF91396.1|47106_49563_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
AVF91397.1|49603_49801_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AVF91398.1|49834_50572_-	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AVF91399.1|50860_51310_-	copper resistance protein	NA	NA	NA	NA	NA
AVF91400.1|51543_53361_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AVF91401.1|53360_54257_+	copper resistance protein B	NA	NA	NA	NA	NA
AVF91402.1|54296_54677_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AVF91403.1|54681_55611_+	copper resistance protein D	NA	NA	NA	NA	NA
AVF91404.1|55665_56346_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AVF91405.1|56342_57743_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AVF91406.1|57958_58393_+	copper-binding protein	NA	NA	NA	NA	NA
AVF91407.1|59425_60394_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	1.1e-182
AVF91408.1|60844_61813_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	3.8e-172
60422:60450	attR	ACCCGAAATCTGATTTATTCAACAAAGCC	NA	NA	NA	NA
AVF91409.1|62865_63942_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVF91410.1|65380_65809_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVF91411.1|65841_66267_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.1	6.6e-52
AVF91412.1|66279_67569_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.8	3.3e-171
AVF91413.1|67616_69368_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AVF91414.1|69385_69748_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AVF91415.1|69799_70150_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.1e-23
AVF91416.1|70507_70756_+	hypothetical protein	NA	NA	NA	NA	NA
AVF91417.1|70752_71964_+	hypothetical protein	NA	NA	NA	NA	NA
AVF91418.1|72097_72589_+	DNA-binding protein	NA	NA	NA	NA	NA
AVF91419.1|72649_72853_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AVF91420.1|72866_73097_+	hypothetical protein	NA	NA	NA	NA	NA
AVF91421.1|73541_73808_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AVF91422.1|73795_74278_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVF91423.1|74274_74511_+	hypothetical protein	NA	NA	NA	NA	NA
AVF91424.1|74572_75541_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.8	1.6e-183
AVF91425.1|75737_76178_-	VGR-related protein	NA	NA	NA	NA	NA
AVF91426.1|76479_77292_-	ribokinase	NA	NA	NA	NA	NA
AVF91427.1|77304_78279_-	SIS domain-containing protein	NA	NA	NA	NA	NA
AVF91428.1|78283_79069_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVF91429.1|79295_80060_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVF91430.1|80160_80913_-	VOC family protein	NA	NA	NA	NA	NA
AVF91431.1|80909_81434_-	hypothetical protein	NA	NA	NA	NA	NA
AVF91432.1|82488_83193_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	3.4e-138
