The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	0	8513	2485441		Paramecium_bursaria_Chlorella_virus(33.33%)	7	NA	NA
AVG08187.1|1362_1569_+	copper resistance protein CopZ	NA	NA	NA	NA	NA
AVG08188.1|1622_2621_-	lactate dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	32.1	6.3e-37
AVG08189.1|2633_3809_-	N-succinyldiaminopimelate aminotransferase	NA	NA	NA	NA	NA
AVG08190.1|3938_4079_+	hypothetical protein	NA	NA	NA	NA	NA
AVG08191.1|4120_4894_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
AVG08192.1|5492_7301_-	acyltransferase	NA	B5WZU0	Pseudomonas_phage	30.1	1.1e-34
AVG08193.1|7805_8513_-	transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	41.1	2.1e-31
>prophage 2
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	16408	20893	2485441	transposase	Streptococcus_phage(50.0%)	3	NA	NA
AVG08201.1|16408_17608_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.4	3.6e-63
AVG08202.1|18276_18993_-	DNA integration/recombination/inversion protein	NA	NA	NA	NA	NA
AVG08203.1|19198_20893_-|transposase	IS1182-like element ISSep1 family transposase	transposase	A0ZS58	Staphylococcus_virus	77.6	1.1e-243
>prophage 3
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	25178	25997	2485441		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVG08208.1|25178_25997_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	M4QNT1	Ostreococcus_lucimarinus_virus	36.0	2.1e-38
>prophage 4
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	34672	36010	2485441		Klosneuvirus(100.0%)	1	NA	NA
AVG08215.1|34672_36010_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	24.4	1.4e-20
>prophage 5
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	41065	41956	2485441		Prochlorococcus_phage(100.0%)	1	NA	NA
AVG08221.1|41065_41956_+	class I fructose-bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	7.2e-08
>prophage 6
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	45932	111840	2485441	protease,holin,transposase	Vibrio_phage(11.76%)	49	NA	NA
AVG08225.1|45932_48560_-	pyruvate, phosphate dikinase	NA	A0A2I7RQW7	Vibrio_phage	40.5	7.1e-88
AVG08226.1|48922_50503_-	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.0	3.2e-75
AVG08227.1|50820_51267_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AVG08228.1|51294_51513_-	hypothetical protein	NA	NA	NA	NA	NA
AVG08229.1|51957_53133_-	amidohydrolase	NA	NA	NA	NA	NA
AVG08230.1|53449_55168_-|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	33.1	4.5e-59
AVG08231.1|55327_56818_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVG08232.1|57295_57859_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVG08233.1|57908_59531_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	22.6	6.0e-21
AVG08234.1|59953_61252_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AVG08235.1|61614_62151_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	47.4	1.3e-36
AVG08236.1|62147_63998_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	65.7	4.2e-244
AVG08237.1|64315_64621_-	hypothetical protein	NA	NA	NA	NA	NA
AVG08238.1|64973_65573_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	44.6	3.9e-26
AVG08239.1|65588_66767_-	sulfate adenylyltransferase	NA	A0A2P1ELS9	Moumouvirus	31.9	3.2e-48
AVG08240.1|66790_67690_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AVG08241.1|67710_68322_-	precorrin-2 dehydrogenase	NA	NA	NA	NA	NA
AVG08242.1|68408_69197_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
AVG08243.1|69209_70928_-	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
AVG08244.1|70947_72792_-	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
AVG08245.1|73090_73822_-	phosphoadenylyl-sulfate reductase	NA	M4W6M9	Bacillus_phage	23.5	1.1e-09
AVG08246.1|74026_74128_+	hypothetical protein	NA	NA	NA	NA	NA
AVG08247.1|74137_74614_-	glutathione peroxidase	NA	NA	NA	NA	NA
AVG08248.1|74626_75961_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AVG08249.1|75977_76418_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVG08250.1|76637_77387_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AVG08251.1|77392_78718_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVG08252.1|78862_79972_-	5,10-methylene-tetrahydrofolate dehydrogenase	NA	NA	NA	NA	NA
AVG08253.1|79968_81153_-	5,10-methylene-tetrahydrofolate dehydrogenase	NA	NA	NA	NA	NA
AVG08254.1|81282_82875_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	28.6	1.5e-43
AVG10404.1|83396_83984_-	DUF4064 domain-containing protein	NA	NA	NA	NA	NA
AVG08255.1|84090_86103_-	ABC transporter permease	NA	NA	NA	NA	NA
AVG08256.1|86104_86854_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	4.3e-30
AVG10405.1|86964_87861_-	sensor histidine kinase	NA	NA	NA	NA	NA
AVG08257.1|87866_88532_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVG08258.1|88562_88742_-	hypothetical protein	NA	NA	NA	NA	NA
AVG08259.1|89039_90509_+	alkaline phosphatase	NA	NA	NA	NA	NA
AVG08260.1|90631_92176_-	NmrA family protein	NA	NA	NA	NA	NA
AVG10406.1|92366_94376_-	glycosyl transferase family 1	NA	NA	NA	NA	NA
AVG08261.1|94896_94998_-	DUF2648 domain-containing protein	NA	NA	NA	NA	NA
AVG08262.1|95403_96741_-	hypothetical protein	NA	A0A0D3MVF0	Staphylococcus_phage	46.1	5.3e-47
AVG10407.1|97156_97258_-	hypothetical protein	NA	NA	NA	NA	NA
AVG08263.1|97535_98735_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.4	4.7e-63
AVG08264.1|98831_100511_-|transposase	IS1182 family transposase ISSep1	transposase	A0ZS58	Staphylococcus_virus	77.6	1.1e-243
AVG08265.1|103848_105531_-|transposase	IS1182-like element ISSep1 family transposase	transposase	A0ZS58	Staphylococcus_virus	77.6	8.5e-244
AVG08266.1|107353_107965_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	36.4	1.2e-17
AVG08267.1|108060_108507_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVG08268.1|108678_110328_+	pyruvate decarboxylase	NA	NA	NA	NA	NA
AVG08269.1|110673_111840_-	CapA family protein	NA	A0A2H4JG01	uncultured_Caudovirales_phage	49.3	5.7e-106
>prophage 7
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	134899	136867	2485441		Clostridium_phage(100.0%)	1	NA	NA
AVG08285.1|134899_136867_+	CHAP domain-containing protein	NA	A0A0A7RUS8	Clostridium_phage	36.3	4.0e-11
>prophage 8
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	163327	167884	2485441	transposase	Streptococcus_phage(66.67%)	3	NA	NA
AVG08301.1|163327_164527_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.4	3.6e-63
AVG08302.1|164609_166304_-|transposase	IS5/IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	77.9	1.5e-240
AVG08303.1|166684_167884_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.4	4.7e-63
>prophage 9
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	171368	172142	2485441		Planktothrix_phage(100.0%)	1	NA	NA
AVG08307.1|171368_172142_-	phosphonates import ATP-binding protein PhnC	NA	G9BWD6	Planktothrix_phage	37.6	3.5e-27
>prophage 10
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	187049	187685	2485441		Bodo_saltans_virus(100.0%)	1	NA	NA
AVG08320.1|187049_187685_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase	NA	A0A2H4UVM0	Bodo_saltans_virus	27.9	3.3e-15
>prophage 11
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	203158	204751	2485441		Vibrio_phage(100.0%)	1	NA	NA
AVG10409.1|203158_204751_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	21.4	1.6e-18
>prophage 12
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	208512	210917	2485441		Synechococcus_phage(50.0%)	2	NA	NA
AVG08341.1|208512_209466_-	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	E3SJ83	Synechococcus_phage	28.7	2.1e-13
AVG08342.1|209507_210917_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.5	4.1e-34
>prophage 13
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	222234	229437	2485441		Tupanvirus(100.0%)	1	NA	NA
AVG08352.1|222234_229437_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	26.8	3.5e-153
>prophage 14
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	233658	234555	2485441		Lactobacillus_phage(100.0%)	1	NA	NA
AVG08356.1|233658_234555_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.9	4.7e-07
>prophage 15
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	242676	243105	2485441		Bacillus_phage(100.0%)	1	NA	NA
AVG08364.1|242676_243105_-	FosB family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	56.0	8.4e-31
>prophage 16
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	250310	252130	2485441		Bacillus_virus(50.0%)	2	NA	NA
AVG08372.1|250310_250946_-	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	25.6	1.9e-07
AVG08373.1|250942_252130_-	osmoprotectant	NA	Q6GZ03	Mycoplasma_phage	32.9	1.4e-19
>prophage 17
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	259596	267250	2485441		Tetraselmis_virus(25.0%)	6	NA	NA
AVG08380.1|259596_261843_-	formate acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	44.2	8.5e-183
AVG08381.1|262308_263082_-	ABC transporter permease	NA	NA	NA	NA	NA
AVG08382.1|263083_263779_-	lantibiotic ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.7	1.8e-38
AVG08383.1|264490_265681_-	MFS transporter	NA	NA	NA	NA	NA
AVG08384.1|265692_266442_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	26.5	3.3e-14
AVG08385.1|266434_267250_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	1.6e-09
>prophage 18
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	274293	280475	2485441		Staphylococcus_phage(50.0%)	4	NA	NA
AVG08392.1|274293_274983_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	8.5e-25
AVG08393.1|275110_275884_-	diacetyl reductase	NA	NA	NA	NA	NA
AVG08394.1|276052_277429_-	MFS transporter	NA	NA	NA	NA	NA
AVG08395.1|277457_280475_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	57.4	8.7e-199
>prophage 19
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	304152	305004	2485441	protease	Staphylococcus_phage(100.0%)	1	NA	NA
AVG08410.1|304152_305004_-|protease	serine protease	protease	A0A2H4PQP1	Staphylococcus_phage	29.3	6.4e-06
>prophage 20
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	312119	313658	2485441		Enterobacteria_phage(100.0%)	1	NA	NA
AVG08415.1|312119_313658_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	26.6	5.2e-14
>prophage 21
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	318440	319208	2485441		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AVG08419.1|318440_319208_-	short-chain dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.4	1.0e-18
>prophage 22
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	334909	336930	2485441		Staphylococcus_phage(100.0%)	3	NA	NA
AVG08436.1|334909_335224_+	ArsR family transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	59.6	6.2e-31
AVG10415.1|335226_336516_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	81.6	4.3e-187
AVG08437.1|336534_336930_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	84.0	3.2e-61
>prophage 23
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	342723	344172	2485441		Acinetobacter_phage(100.0%)	1	NA	NA
AVG10416.1|342723_344172_-	hypothetical protein	NA	A0A2H5BHF5	Acinetobacter_phage	22.1	4.3e-10
>prophage 24
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	348837	351637	2485441		Staphylococcus_phage(100.0%)	2	NA	NA
AVG08445.1|348837_350088_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	32.1	1.6e-34
AVG08446.1|350080_351637_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	74.5	1.3e-219
>prophage 25
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	359935	365524	2485441	transposase	Staphylococcus_phage(50.0%)	6	NA	NA
AVG08457.1|359935_361063_-	alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	30.9	6.9e-16
AVG08458.1|361560_362058_+	spermidine acetyltransferase	NA	NA	NA	NA	NA
AVG08459.1|362368_363529_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	31.4	1.1e-29
AVG08460.1|363788_364349_-	hypothetical protein	NA	NA	NA	NA	NA
AVG08461.1|364551_365226_+|transposase	IS6-like element IS257 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	99.1	2.0e-127
AVG08462.1|365257_365524_-	replication initiator protein A	NA	A0A0S2MVK1	Bacillus_phage	34.9	5.8e-06
>prophage 26
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	368628	370247	2485441		Streptococcus_phage(50.0%)	2	NA	NA
AVG08465.1|368628_369486_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	32.6	4.2e-29
AVG08466.1|369635_370247_-	transposon DNA-invertase	NA	M9Q1K0	Clostridium_phage	32.8	8.9e-18
>prophage 27
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	375953	387142	2485441	transposase	Staphylococcus_phage(40.0%)	8	NA	NA
AVG08471.1|375953_376301_-	transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	35.8	2.4e-12
AVG08472.1|376319_376937_-	cadmium transporter	NA	NA	NA	NA	NA
AVG08473.1|377709_378048_-	replication protein	NA	NA	NA	NA	NA
AVG08474.1|378825_379500_+|transposase	IS6-like element IS257 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	99.1	2.0e-127
AVG08475.1|380911_381100_-	CsbD family protein	NA	NA	NA	NA	NA
AVG08476.1|382083_382758_+|transposase	IS6-like element IS257 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	99.1	2.0e-127
AVG08477.1|384142_385492_+	recombinase family protein	NA	A0A2H4J388	uncultured_Caudovirales_phage	24.5	3.3e-20
AVG08478.1|385513_387142_+	recombinase RecB	NA	A0A0S2SXR4	Bacillus_phage	34.0	3.2e-46
>prophage 28
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	397552	407653	2485441		Bacillus_phage(40.0%)	8	NA	NA
AVG08488.1|397552_398353_-	MBL fold metallo-hydrolase	NA	A0A2H4J3R0	uncultured_Caudovirales_phage	36.4	2.9e-40
AVG08489.1|398972_399764_-	hypothetical protein	NA	NA	NA	NA	NA
AVG08490.1|399764_401111_-	hypothetical protein	NA	NA	NA	NA	NA
AVG08491.1|401094_402927_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.4	1.6e-30
AVG08492.1|402939_403641_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	39.2	6.0e-42
AVG08493.1|403684_403777_-	hypothetical protein	NA	NA	NA	NA	NA
AVG08494.1|404691_405975_-	adenylosuccinate synthetase	NA	L7Y4J5	Megavirus	34.8	8.0e-69
AVG08495.1|406252_407653_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.9	2.2e-112
>prophage 29
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	414075	423594	2485441	tRNA	Bacillus_virus(50.0%)	5	NA	NA
AVG08502.1|414075_415080_+	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	52.6	2.5e-81
AVG08503.1|415607_416894_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.2	4.1e-89
AVG08504.1|417720_418554_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
AVG08505.1|418944_421626_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.4	3.8e-121
AVG08506.1|421662_423594_-	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	46.0	3.2e-146
>prophage 30
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	433800	439961	2485441		Gordonia_phage(33.33%)	9	NA	NA
AVG08516.1|433800_434640_+	nucleoid occlusion protein	NA	A0A1C9EHY8	Gordonia_phage	33.1	4.7e-09
AVG08517.1|434901_435063_+	hypothetical protein	NA	NA	NA	NA	NA
AVG08518.1|435040_435400_+	DUF3147 domain-containing protein	NA	NA	NA	NA	NA
AVG08519.1|435415_435811_+	DUF3147 domain-containing protein	NA	NA	NA	NA	NA
AVG08520.1|435776_436316_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVG08521.1|436535_437105_+	XRE family transcriptional regulator	NA	D2XQ11	Bacillus_virus	31.8	2.5e-06
AVG08522.1|437292_437922_-	YIP1 family protein	NA	NA	NA	NA	NA
AVG08523.1|438159_439278_+	RND transporter	NA	NA	NA	NA	NA
AVG08524.1|439274_439961_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	3.8e-33
>prophage 31
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	446369	447128	2485441		Planktothrix_phage(100.0%)	1	NA	NA
AVG08530.1|446369_447128_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.2e-34
>prophage 32
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	458160	461992	2485441	transposase	Staphylococcus_phage(50.0%)	5	NA	NA
AVG08537.1|458160_458835_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	98.2	9.9e-127
AVG08538.1|459190_459655_-	damage-inducible protein DinB	NA	NA	NA	NA	NA
AVG08539.1|460130_460361_-	hypothetical protein	NA	NA	NA	NA	NA
AVG08540.1|460511_461150_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
AVG08541.1|461149_461992_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	25.5	4.1e-05
>prophage 33
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	470487	479217	2485441		Pandoravirus(40.0%)	10	NA	NA
AVG08550.1|470487_471663_-	PLP-dependent transferase	NA	A0A0B5JD48	Pandoravirus	25.9	1.8e-14
AVG08551.1|471659_472763_-	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	26.3	1.3e-11
AVG08552.1|473491_474334_+	chromosome partitioning protein ParB	NA	A0A1C9EHW0	Gordonia_phage	29.3	3.2e-10
AVG08553.1|474488_475364_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AVG08554.1|475384_475588_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
AVG08555.1|475599_476697_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
AVG08556.1|476929_477121_-	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	83.3	4.4e-24
AVG08557.1|477194_478004_-	lysozyme	NA	NA	NA	NA	NA
AVG08558.1|478388_478685_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
AVG08559.1|478707_479217_+	single-stranded DNA-binding protein	NA	A0A2H4JCF2	uncultured_Caudovirales_phage	90.5	4.8e-65
>prophage 34
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	484321	485845	2485441		Enterococcus_phage(100.0%)	1	NA	NA
AVG08571.1|484321_485845_-	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.4	7.1e-40
>prophage 35
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	495078	500967	2485441	protease,integrase	Klosneuvirus(20.0%)	6	486571:486588	500585:500602
486571:486588	attL	AAAGTATAAAAAAGCTAT	NA	NA	NA	NA
AVG08582.1|495078_496545_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.8	3.7e-94
AVG08583.1|496711_498253_+	GMP synthase (glutamine-hydrolyzing)	NA	A0A1V0SH76	Hokovirus	32.6	3.6e-23
AVG08584.1|498491_499397_-|protease	CAAX protease	protease	NA	NA	NA	NA
AVG08585.1|499805_499967_-|integrase	integrase	integrase	A0A2I6PEN0	Staphylococcus_phage	60.9	7.8e-06
AVG08586.1|500022_500553_-	hypothetical protein	NA	A0A2H4IYV6	uncultured_Caudovirales_phage	54.1	5.5e-16
AVG08587.1|500565_500967_-	hypothetical protein	NA	Q4ZCB6	Staphylococcus_virus	51.1	2.9e-33
500585:500602	attR	ATAGCTTTTTTATACTTT	NA	NA	NA	NA
>prophage 36
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	505837	506101	2485441		Staphylococcus_virus(100.0%)	1	NA	NA
AVG08593.1|505837_506101_-	hypothetical protein	NA	Q4ZCB7	Staphylococcus_virus	46.2	1.3e-10
>prophage 37
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	516537	522906	2485441		Streptococcus_phage(33.33%)	6	NA	NA
AVG10420.1|516537_517446_+	cysteine synthase family protein	NA	A0A1X9I5F1	Streptococcus_phage	39.1	7.7e-50
AVG08604.1|517438_518584_+	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	NA	NA	NA	NA
AVG08605.1|518830_519856_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	1.4e-31
AVG08606.1|519858_520518_+	ABC transporter permease	NA	NA	NA	NA	NA
AVG08607.1|520561_521407_+	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG08608.1|521931_522906_+	N-acetylmuramoyl-L-alanine amidase	NA	Q6A204	Oenococcus_phage	41.8	6.2e-21
>prophage 38
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	539277	540984	2485441		Streptococcus_virus(100.0%)	1	NA	NA
AVG08620.1|539277_540984_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	41.2	1.1e-54
>prophage 39
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	550068	557527	2485441	tRNA	Streptococcus_phage(50.0%)	9	NA	NA
AVG08625.1|550068_550680_+	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	48.3	4.1e-47
AVG08626.1|550713_551043_+	hypothetical protein	NA	NA	NA	NA	NA
AVG08627.1|551348_552275_+	DNA polymerase III subunit delta'	NA	A0A292GC45	Xanthomonas_phage	31.9	1.8e-06
AVG08628.1|552276_553080_+	signal peptidase II	NA	NA	NA	NA	NA
AVG08629.1|553096_553444_+	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
AVG08630.1|553539_554265_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
AVG08631.1|554257_554506_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
AVG08632.1|554507_555347_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.8	6.0e-57
AVG08633.1|555556_557527_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	32.0	1.3e-94
>prophage 40
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	563790	566255	2485441		Tupanvirus(50.0%)	2	NA	NA
AVG08642.1|563790_565146_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	31.4	4.4e-25
AVG08643.1|565289_566255_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	36.7	2.6e-48
>prophage 41
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	576888	585970	2485441	tRNA	uncultured_virus(20.0%)	8	NA	NA
AVG08653.1|576888_577428_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	1.0e-12
AVG08654.1|577702_579805_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	H8ZJI5	Ostreococcus_tauri_virus	48.8	4.9e-108
AVG08655.1|580059_580941_+	redox-regulated molecular chaperone Hsp33	NA	NA	NA	NA	NA
AVG08656.1|581277_582210_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	63.9	3.2e-107
AVG08657.1|582505_583324_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	30.5	6.8e-21
AVG08658.1|583301_583667_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AVG08659.1|583667_584147_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AVG08660.1|584482_585970_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.8	5.8e-95
>prophage 42
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	597813	602331	2485441	transposase	Streptococcus_phage(100.0%)	4	NA	NA
AVG08661.1|597813_599178_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.7	5.8e-17
AVG08662.1|599274_600162_+	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
AVG10421.1|600164_600722_+	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
AVG08663.1|601131_602331_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.4	4.7e-63
>prophage 43
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	606033	608487	2485441	protease	Escherichia_phage(100.0%)	1	NA	NA
AVG08668.1|606033_608487_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	41.2	1.6e-134
>prophage 44
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	614324	619113	2485441	tRNA	Catovirus(50.0%)	8	NA	NA
AVG08673.1|614324_615725_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.6	9.1e-58
AVG08674.1|615717_616116_+	ribonuclease III	NA	NA	NA	NA	NA
AVG08675.1|616105_616873_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AVG08676.1|616869_617397_+	hypothetical protein	NA	NA	NA	NA	NA
AVG08677.1|617466_618042_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AVG08678.1|618165_618309_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AVG08679.1|618371_618554_+	protein translocase subunit SecE	NA	NA	NA	NA	NA
AVG08680.1|618564_619113_+	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	32.9	6.6e-12
>prophage 45
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	622971	634112	2485441		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
AVG08685.1|622971_626523_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.2	8.0e-50
AVG08686.1|626654_630278_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.7	6.2e-66
AVG08687.1|630605_630866_+	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
AVG08688.1|630956_631370_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
AVG08689.1|631440_631911_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
AVG08690.1|632030_634112_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.6	3.8e-68
>prophage 46
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	638144	639095	2485441		Klosneuvirus(100.0%)	1	NA	NA
AVG08694.1|638144_639095_+	ornithine cyclodeaminase family protein	NA	A0A1V0SL93	Klosneuvirus	29.4	4.0e-17
>prophage 47
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	649487	650150	2485441		Enterococcus_phage(100.0%)	1	NA	NA
AVG08704.1|649487_650150_-	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	33.9	2.3e-19
>prophage 48
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	658947	659900	2485441		Staphylococcus_phage(100.0%)	3	NA	NA
AVG08711.1|658947_659148_-	protein-tyrosine-phosphatase	NA	A0A2H4PQT9	Staphylococcus_phage	70.8	4.8e-21
AVG08712.1|659147_659696_-	hypothetical protein	NA	A0A2H4PQU3	Staphylococcus_phage	71.1	4.9e-68
AVG08713.1|659723_659900_-	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	58.2	4.1e-08
>prophage 49
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	671902	672553	2485441		Harp_seal_herpesvirus(100.0%)	1	NA	NA
AVG08728.1|671902_672553_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	45.0	2.1e-41
>prophage 50
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	684719	690055	2485441		Erysipelothrix_phage(50.0%)	5	NA	NA
AVG08740.1|684719_686087_-	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.2	2.0e-105
AVG08741.1|686055_686478_-	transcriptional regulator	NA	NA	NA	NA	NA
AVG08742.1|686633_687572_+	aldo/keto reductase	NA	NA	NA	NA	NA
AVG08743.1|688188_688665_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVG08744.1|688756_690055_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	30.9	5.5e-25
>prophage 51
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	695084	696107	2485441		Tupanvirus(100.0%)	1	NA	NA
AVG08750.1|695084_696107_+	zinc-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	28.9	5.5e-36
>prophage 52
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	706847	707624	2485441		Mycobacterium_phage(100.0%)	1	NA	NA
AVG08764.1|706847_707624_+	alpha/beta hydrolase	NA	A0A1D8EVD1	Mycobacterium_phage	28.2	8.4e-05
>prophage 53
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	723163	723910	2485441		Indivirus(100.0%)	1	NA	NA
AVG08782.1|723163_723910_-	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.7	4.4e-11
>prophage 54
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	731146	741736	2485441		Streptomyces_phage(20.0%)	10	NA	NA
AVG08790.1|731146_731545_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	2.9e-17
AVG08791.1|731686_731797_+	hypothetical protein	NA	NA	NA	NA	NA
AVG08792.1|731885_732035_+	hypothetical protein	NA	NA	NA	NA	NA
AVG08793.1|732527_734255_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	40.4	9.7e-102
AVG08794.1|734540_735770_+	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
AVG08795.1|736306_737140_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	37.3	1.3e-43
AVG08796.1|737498_738296_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	31.2	9.2e-15
AVG08797.1|738615_739116_+	hypothetical protein	NA	NA	NA	NA	NA
AVG08798.1|739340_740408_+	hypothetical protein	NA	NA	NA	NA	NA
AVG08799.1|740686_741736_+	alpha/beta hydrolase	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	23.3	4.9e-16
>prophage 55
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	745706	746468	2485441		Cedratvirus(100.0%)	1	NA	NA
AVG08804.1|745706_746468_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.7	1.2e-19
>prophage 56
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	756453	756930	2485441		Pandoravirus(100.0%)	1	NA	NA
AVG08813.1|756453_756930_+	cupin	NA	A0A291ATU0	Pandoravirus	37.5	1.7e-16
>prophage 57
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	765962	766529	2485441		Enterococcus_phage(100.0%)	1	NA	NA
AVG08825.1|765962_766529_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	35.2	4.7e-21
>prophage 58
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	769638	773024	2485441		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
AVG08830.1|769638_771333_+	cysteine ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.1	2.2e-18
AVG08831.1|771329_773024_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	24.4	1.2e-14
>prophage 59
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	778125	779499	2485441		Bodo_saltans_virus(100.0%)	1	NA	NA
AVG08837.1|778125_779499_+	deoxyribodipyrimidine photo-lyase	NA	A0A2H4UV63	Bodo_saltans_virus	37.0	1.9e-47
>prophage 60
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	790628	802723	2485441	transposase	Staphylococcus_phage(11.11%)	15	NA	NA
AVG08846.1|790628_791468_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.0	1.2e-60
AVG08847.1|791609_791702_+	hypothetical protein	NA	NA	NA	NA	NA
AVG08848.1|791670_792777_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	43.2	6.3e-62
AVG08849.1|792846_793812_-	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.6	1.8e-17
AVG08850.1|793901_794591_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-33
AVG08851.1|794565_795039_-	DoxX family protein	NA	NA	NA	NA	NA
AVG08852.1|795089_795527_-	hypothetical protein	NA	NA	NA	NA	NA
AVG08853.1|795932_796031_+	hypothetical protein	NA	NA	NA	NA	NA
AVG08854.1|796657_797857_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.4	4.7e-63
AVG08855.1|798187_798787_-	hypothetical protein	NA	NA	NA	NA	NA
AVG08856.1|798888_799602_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	44.8	1.6e-55
AVG08857.1|799602_800022_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
AVG08858.1|800026_800698_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	55.7	4.1e-64
AVG08859.1|800994_801582_+	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	42.4	5.7e-38
AVG08860.1|801571_802723_+	anthranilate synthase component I family protein	NA	A0A0B5J984	Pandoravirus	39.6	7.5e-26
>prophage 61
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	805881	819494	2485441	transposase	Streptococcus_phage(28.57%)	10	NA	NA
AVG08865.1|805881_807822_+	lipoteichoic acid synthase	NA	W6LM83	Streptococcus_phage	38.5	3.0e-107
AVG08866.1|808497_809697_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.4	4.7e-63
AVG08867.1|809899_809998_+	hypothetical protein	NA	NA	NA	NA	NA
AVG08868.1|810274_811090_-	ZIP family metal transporter	NA	NA	NA	NA	NA
AVG08869.1|811217_813101_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.2	2.6e-55
AVG10429.1|813111_814893_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	37.1	1.0e-77
AVG08870.1|815092_816067_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	6.0e-24
AVG08871.1|816059_817574_+	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
AVG08872.1|817776_818832_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	27.1	9.3e-23
AVG08873.1|818954_819494_+	5'(3')-deoxyribonucleotidase	NA	A0A0A0PKY7	Bacillus_phage	40.7	1.1e-30
>prophage 62
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	824146	834580	2485441		uncultured_Caudovirales_phage(66.67%)	10	NA	NA
AVG08876.1|824146_825652_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	34.0	5.5e-61
AVG08877.1|825935_826436_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	70.1	1.1e-50
AVG08878.1|826449_827325_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AVG08879.1|828079_828478_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	100.0	2.0e-71
AVG08880.1|828440_830546_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	100.0	0.0e+00
AVG08881.1|830664_831633_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	100.0	3.9e-185
AVG08882.1|831607_831871_+	hypothetical protein	NA	A0A2H4IYB4	uncultured_Caudovirales_phage	100.0	5.5e-17
AVG08883.1|831886_832861_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	99.4	5.0e-164
AVG08884.1|832844_833804_+	iron ABC transporter permease	NA	A0A2H4J116	uncultured_Caudovirales_phage	100.0	4.1e-17
AVG08885.1|833800_834580_+	iron ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.6	5.1e-18
>prophage 63
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	846013	849072	2485441		Streptococcus_phage(100.0%)	3	NA	NA
AVG08897.1|846013_846655_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	48.3	2.1e-38
AVG08898.1|846799_847666_+	DegV family protein	NA	NA	NA	NA	NA
AVG08899.1|847989_849072_+	DNA/RNA helicase	NA	A0A1X9I5S6	Streptococcus_phage	37.0	6.8e-45
>prophage 64
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	855220	856021	2485441		Staphylococcus_phage(100.0%)	1	NA	NA
AVG08904.1|855220_856021_+	CHAP domain-containing protein	NA	A0A173GBC8	Staphylococcus_phage	44.6	5.6e-12
>prophage 65
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	859759	862594	2485441		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVG08908.1|859759_862594_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	58.2	0.0e+00
>prophage 66
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	866729	871726	2485441	protease	Streptococcus_phage(40.0%)	5	NA	NA
AVG08913.1|866729_867662_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	48.6	4.2e-83
AVG08914.1|867837_868746_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	33.6	3.6e-07
AVG08915.1|868745_869741_+	hypothetical protein	NA	A1IMD5	Streptococcus_phage	39.8	2.6e-51
AVG08916.1|869869_870814_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	2.4e-54
AVG08917.1|871141_871726_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	54.7	3.1e-52
>prophage 67
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	881359	891634	2485441		Staphylococcus_phage(33.33%)	11	NA	NA
AVG08927.1|881359_882664_+	enolase	NA	W6LP63	Streptococcus_phage	80.3	4.3e-195
AVG08928.1|882829_883288_+	hypothetical protein	NA	NA	NA	NA	NA
AVG08929.1|883356_883590_+	protein-export membrane protein SecG	NA	NA	NA	NA	NA
AVG08930.1|883890_884631_+	carboxylesterase	NA	NA	NA	NA	NA
AVG08931.1|884665_887044_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.6	8.1e-91
AVG08932.1|887068_887539_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	88.5	1.4e-71
AVG08933.1|888090_888765_-	hypothetical protein	NA	NA	NA	NA	NA
AVG08934.1|888777_889275_-	recombinase	NA	A0A0A8WF08	Clostridium_phage	35.9	5.4e-13
AVG10432.1|889374_889554_+	hypothetical protein	NA	NA	NA	NA	NA
AVG08935.1|889697_890240_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	54.5	1.8e-25
AVG08936.1|891400_891634_-	hypothetical protein	NA	Q4ZCB8	Staphylococcus_virus	64.9	1.0e-22
>prophage 68
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	897048	901554	2485441		Indivirus(33.33%)	6	NA	NA
AVG08943.1|897048_897990_+	cation transporter	NA	A0A1V0SED0	Indivirus	33.6	1.1e-11
AVG08944.1|898387_898471_-	epsilon family phenol-soluble modulin	NA	NA	NA	NA	NA
AVG08945.1|899355_899556_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.2	2.0e-19
AVG08946.1|900176_900401_-	hypothetical protein	NA	NA	NA	NA	NA
AVG08947.1|900424_900709_-	hypothetical protein	NA	NA	NA	NA	NA
AVG08948.1|900807_901554_-	hypothetical protein	NA	W5R8K6	Staphylococcus_phage	42.0	1.1e-38
>prophage 69
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	907257	912366	2485441		Streptococcus_phage(66.67%)	9	NA	NA
AVG08959.1|907257_907974_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	30.2	9.8e-16
AVG08960.1|908054_908597_+	nitroreductase	NA	NA	NA	NA	NA
AVG08961.1|908779_909103_-	thioredoxin	NA	NA	NA	NA	NA
AVG08962.1|909245_909599_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	45.9	1.6e-19
AVG08963.1|909772_910153_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
AVG08964.1|910306_910399_+	hypothetical protein	NA	NA	NA	NA	NA
AVG08965.1|910412_910799_+	topiosmerase	NA	NA	NA	NA	NA
AVG08966.1|910791_911088_+	thioredoxin	NA	NA	NA	NA	NA
AVG08967.1|911340_912366_+	methionine import ATP-binding protein MetN 1	NA	G9BWD6	Planktothrix_phage	37.9	1.8e-26
>prophage 70
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	915928	919401	2485441		Brazilian_cedratvirus(50.0%)	3	NA	NA
AVG08973.1|915928_916690_+	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	8.5e-10
AVG08974.1|916784_918092_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AVG08975.1|918159_919401_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.0	4.1e-110
>prophage 71
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	924172	925021	2485441		Golden_Marseillevirus(100.0%)	1	NA	NA
AVG08980.1|924172_925021_+	DUF72 domain-containing protein	NA	A0A1D6Y809	Golden_Marseillevirus	25.9	5.4e-13
>prophage 72
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	932083	934752	2485441		Tupanvirus(50.0%)	2	NA	NA
AVG08990.1|932083_933541_+	D-alanine--poly(phosphoribitol) ligase subunit 1	NA	A0A2K9L3I8	Tupanvirus	27.5	9.5e-42
AVG08991.1|933537_934752_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	28.0	4.5e-21
>prophage 73
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	939002	942641	2485441		Lake_Baikal_phage(50.0%)	3	NA	NA
AVG08998.1|939002_939362_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	1.2e-14
AVG10434.1|939631_940840_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AVG08999.1|941159_942641_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	34.5	6.3e-49
>prophage 74
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	945925	947620	2485441	transposase	Staphylococcus_virus(100.0%)	1	NA	NA
AVG09003.1|945925_947620_-|transposase	IS5/IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	77.9	1.5e-240
>prophage 75
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	955455	956049	2485441		Aureococcus_anophage(100.0%)	1	NA	NA
AVG09013.1|955455_956049_+	peptidylprolyl isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	6.6e-26
>prophage 76
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	959238	964725	2485441	transposase	Streptococcus_phage(33.33%)	4	NA	NA
AVG09016.1|959238_960438_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.4	3.6e-63
AVG09017.1|960940_962131_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.4	7.3e-32
AVG09018.1|962239_963484_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
AVG09019.1|963675_964725_-	glycerophosphodiester phosphodiesterase	NA	A0A173GBD0	Staphylococcus_phage	39.2	2.5e-36
>prophage 77
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	974731	978406	2485441		Bacillus_phage(100.0%)	1	NA	NA
AVG09027.1|974731_978406_+	helicase-exonuclease AddAB subunit AddA	NA	S5M596	Bacillus_phage	22.1	6.8e-20
>prophage 78
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	983493	1080614	2485441	protease,tail,tRNA,transposase,terminase,integrase,portal,head,holin,capsid	Bacillus_phage(27.91%)	99	979574:979593	1086834:1086853
979574:979593	attL	AACTTGCTTTGTCTGTAGAA	NA	NA	NA	NA
AVG09033.1|983493_985317_+	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	30.7	9.5e-31
AVG09034.1|985525_988135_+	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.0	1.6e-119
AVG09035.1|988415_989615_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.4	4.7e-63
AVG09036.1|989873_990068_-	DUF2929 domain-containing protein	NA	NA	NA	NA	NA
AVG09037.1|990349_991291_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
AVG09038.1|991302_992547_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AVG09039.1|992617_992989_-	DUF3899 domain-containing protein	NA	NA	NA	NA	NA
AVG09040.1|993230_994157_+	ABC transporter permease	NA	NA	NA	NA	NA
AVG09041.1|994156_995227_+	ABC transporter permease	NA	NA	NA	NA	NA
AVG09042.1|995241_996321_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	2.4e-18
AVG09043.1|996313_997252_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	2.7e-21
AVG09044.1|997278_998922_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG09045.1|998979_999969_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AVG09046.1|1000259_1000655_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AVG09047.1|1001009_1001732_+	adaptor protein MecA	NA	NA	NA	NA	NA
AVG09048.1|1001821_1002808_+	transcription factor	NA	NA	NA	NA	NA
AVG09049.1|1002858_1004667_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	26.9	3.7e-51
AVG09050.1|1005130_1005928_-	DsbA family protein	NA	NA	NA	NA	NA
AVG10435.1|1005950_1006316_-	globin	NA	NA	NA	NA	NA
AVG09051.1|1006397_1006988_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AVG09052.1|1007271_1007619_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09053.1|1007635_1008271_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AVG09054.1|1008284_1009094_+	NAD(+) kinase	NA	NA	NA	NA	NA
AVG09055.1|1009090_1009945_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AVG09056.1|1009969_1011355_+	magnesium transporter	NA	NA	NA	NA	NA
AVG09057.1|1011364_1013209_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AVG09058.1|1013920_1014544_+	DUF443 domain-containing protein	NA	NA	NA	NA	NA
AVG09059.1|1014604_1014868_+	type II secretion protein	NA	A0A1X9I6T6	Streptococcus_phage	40.0	1.2e-08
AVG09060.1|1015140_1015344_-	hypothetical protein	NA	A0A0N7GFG6	Staphylococcus_phage	74.3	1.1e-07
AVG09061.1|1015374_1015608_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09062.1|1016002_1017202_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.4	3.6e-63
AVG09063.1|1017505_1017976_+	hypothetical protein	NA	E3SJC5	Synechococcus_phage	39.7	9.9e-25
AVG09064.1|1017984_1018362_+	glucose-6-phosphate 1-dehydrogenase	NA	NA	NA	NA	NA
AVG10436.1|1018726_1020739_+	daunorubicin resistance protein DrrC	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	36.1	7.6e-106
AVG09065.1|1022069_1022285_+	recombinase	NA	NA	NA	NA	NA
AVG09066.1|1022358_1022730_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AVG09067.1|1022951_1023722_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AVG09068.1|1024119_1025205_-	AI-2E family transporter	NA	NA	NA	NA	NA
AVG09069.1|1025430_1026186_+	esterase family protein	NA	NA	NA	NA	NA
AVG09070.1|1026339_1026849_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09071.1|1027112_1028306_-	MFS transporter	NA	NA	NA	NA	NA
AVG09072.1|1028283_1029459_-	diacylglycerol beta-glucosyltransferase	NA	NA	NA	NA	NA
AVG09073.1|1029979_1031464_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
AVG09074.1|1031453_1031699_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09075.1|1031702_1033265_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	26.9	1.7e-36
AVG09076.1|1033573_1034380_+	hypothetical protein	NA	S5MAL1	Bacillus_phage	37.7	3.9e-29
AVG09077.1|1034590_1036348_+|protease	serine protease	protease	W5SAB9	Pithovirus	24.3	4.6e-06
AVG09078.1|1036365_1037724_+	Ktr system potassium uptake protein D	NA	NA	NA	NA	NA
AVG09079.1|1037817_1039368_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AVG09080.1|1039470_1040073_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVG09081.1|1040078_1040264_-	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
AVG09082.1|1040468_1041455_+	lipoate--protein ligase	NA	NA	NA	NA	NA
AVG09083.1|1041532_1041751_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
AVG09084.1|1041843_1041939_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09085.1|1041965_1042541_+	competence protein ComK	NA	NA	NA	NA	NA
AVG10437.1|1043062_1043605_-|integrase	site-specific integrase	integrase	A0A2H4JGN1	uncultured_Caudovirales_phage	61.9	7.3e-56
AVG09086.1|1044191_1044857_-	hypothetical protein	NA	NA	NA	NA	NA
AVG09087.1|1044869_1045244_-	hypothetical protein	NA	NA	NA	NA	NA
AVG09088.1|1045399_1045735_-	XRE family transcriptional regulator	NA	A0A2I6PEN2	Staphylococcus_phage	58.9	1.4e-28
AVG09089.1|1045895_1046087_+	XRE family transcriptional regulator	NA	A0A2I6PEL6	Staphylococcus_phage	65.1	9.5e-19
AVG09090.1|1046140_1046449_+	DUF771 domain-containing protein	NA	Q4ZC28	Staphylococcus_virus	37.4	7.7e-10
AVG09091.1|1046519_1047065_-	hypothetical protein	NA	NA	NA	NA	NA
AVG09092.1|1047163_1047358_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09093.1|1047505_1048774_+	helicase SNF2	NA	A0A1B1P7L4	Bacillus_phage	57.6	4.1e-134
AVG09094.1|1048751_1049048_+	nuclease	NA	A0A1B1P7M6	Bacillus_phage	57.1	3.1e-24
AVG09095.1|1049047_1050859_+	NTP-binding protein	NA	A0A1B1P7N0	Bacillus_phage	58.0	1.7e-165
AVG09096.1|1050877_1051084_+	hypothetical protein	NA	A0A1B1P7N6	Bacillus_phage	52.4	1.9e-09
AVG09097.1|1051135_1051618_+	DUF669 domain-containing protein	NA	A0A2H4J1S8	uncultured_Caudovirales_phage	38.4	8.9e-21
AVG09098.1|1051667_1053386_+	hypothetical protein	NA	A0A1B1P7M5	Bacillus_phage	63.3	2.9e-207
AVG09099.1|1053402_1053753_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09100.1|1053783_1054002_+	DUF3310 domain-containing protein	NA	Q4ZC12	Staphylococcus_virus	77.1	3.2e-26
AVG09101.1|1054008_1054740_+	hypothetical protein	NA	H9A0T0	Staphylococcus_phage	49.6	2.1e-61
AVG09102.1|1054804_1055125_+	hypothetical protein	NA	A0A2H4J2H9	uncultured_Caudovirales_phage	81.6	4.6e-42
AVG09103.1|1055322_1055619_-	hypothetical protein	NA	A0A1W6JPR4	Staphylococcus_phage	41.5	7.9e-12
AVG09104.1|1055686_1055932_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09105.1|1056010_1056205_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09106.1|1056234_1058106_+	DNA primase	NA	A0A1B1P7L5	Bacillus_phage	58.5	3.6e-211
AVG09107.1|1058427_1058919_+	RNA polymerase subunit sigma-70	NA	A0A0K2CNQ1	Brevibacillus_phage	28.4	5.7e-07
AVG09108.1|1059974_1060265_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	42.2	2.5e-18
AVG09109.1|1060584_1060923_+|terminase	terminase	terminase	D2XR14	Bacillus_phage	38.2	1.0e-10
AVG09110.1|1060906_1062541_+|terminase	terminase large subunit	terminase	A0A0U4B089	Bacillus_phage	56.4	6.9e-182
AVG09111.1|1062556_1063693_+|portal	phage portal protein	portal	A0A0U4IIQ9	Bacillus_phage	43.8	4.0e-88
AVG09112.1|1063692_1064424_+|protease	Clp protease ClpP	protease	A0A2H4J8Y7	uncultured_Caudovirales_phage	42.0	1.1e-41
AVG09113.1|1064448_1065606_+|capsid	phage major capsid protein	capsid	A0A0U4JIF4	Bacillus_phage	52.0	7.4e-98
AVG09114.1|1065632_1065941_+	hypothetical protein	NA	A0A2H4JF26	uncultured_Caudovirales_phage	38.0	5.9e-10
AVG09115.1|1065912_1066242_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AVG09116.1|1066241_1066580_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09117.1|1066579_1067017_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09118.1|1067022_1067727_+|tail	phage tail protein	tail	NA	NA	NA	NA
AVG09119.1|1067750_1068095_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09120.1|1068148_1068361_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09121.1|1068424_1072606_+|tail	phage tail tape measure protein	tail	A0A2P0ZLF1	Lactobacillus_phage	42.6	7.4e-63
AVG09122.1|1072608_1073379_+|tail	phage tail protein	tail	NA	NA	NA	NA
AVG09123.1|1073375_1076831_+	hypothetical protein	NA	M1PRQ3	Streptococcus_phage	24.0	1.3e-20
AVG09124.1|1076851_1077262_+	hypothetical protein	NA	A0A0K2FLF1	Brevibacillus_phage	36.0	1.6e-07
AVG09125.1|1077298_1077580_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09126.1|1077581_1077968_+|holin	holin	holin	D7RWK5	Brochothrix_phage	33.9	2.1e-12
AVG09127.1|1078020_1078941_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JNM6	Staphylococcus_phage	64.0	3.7e-68
AVG09128.1|1078937_1080614_-|transposase	IS1182-like element ISSep1 family transposase	transposase	A0ZS58	Staphylococcus_virus	77.6	1.4e-243
1086834:1086853	attR	AACTTGCTTTGTCTGTAGAA	NA	NA	NA	NA
>prophage 79
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1085636	1085852	2485441		Enterococcus_phage(100.0%)	1	NA	NA
AVG09134.1|1085636_1085852_-	NINE protein	NA	A0A060AN66	Enterococcus_phage	40.4	1.6e-06
>prophage 80
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1096222	1100230	2485441		Staphylococcus_phage(100.0%)	1	NA	NA
AVG09146.1|1096222_1100230_-	bifunctional autolysin	NA	A0A1J0MFI1	Staphylococcus_phage	49.2	2.6e-57
>prophage 81
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1104029	1105232	2485441		Mycobacterium_phage(100.0%)	1	NA	NA
AVG09150.1|1104029_1105232_+	methicillin resistance protein FmtA	NA	G8IDB2	Mycobacterium_phage	22.8	1.4e-06
>prophage 82
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1111703	1126335	2485441		Synechococcus_phage(22.22%)	14	NA	NA
AVG09157.1|1111703_1112564_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.2	1.4e-37
AVG09158.1|1112768_1113251_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.3	5.2e-21
AVG09159.1|1113237_1114365_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AVG09160.1|1114365_1115070_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	H8ZMN3	Synechococcus_phage	42.5	1.6e-47
AVG09161.1|1115069_1115330_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AVG09162.1|1115331_1116003_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AVG09163.1|1115995_1118185_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.4	8.7e-140
AVG09164.1|1118163_1119648_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.9	9.4e-45
AVG09165.1|1119640_1120672_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.4	2.1e-64
AVG09166.1|1120671_1121238_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.0	4.7e-29
AVG09167.1|1121254_1122733_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	51.1	4.9e-78
AVG09168.1|1122758_1124000_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AVG09169.1|1124132_1124972_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AVG09170.1|1124931_1126335_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.8	8.1e-14
>prophage 83
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1131517	1132690	2485441		Streptococcus_phage(100.0%)	1	NA	NA
AVG09175.1|1131517_1132690_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.5	2.9e-73
>prophage 84
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1142540	1143092	2485441		Synechococcus_phage(100.0%)	1	NA	NA
AVG09185.1|1142540_1143092_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	44.8	4.9e-15
>prophage 85
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1147601	1151372	2485441		Erysipelothrix_phage(50.0%)	4	NA	NA
AVG09190.1|1147601_1149008_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.3	3.8e-48
AVG09191.1|1149309_1149588_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09192.1|1149726_1150266_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVG09193.1|1150277_1151372_+	spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	43.0	2.4e-37
>prophage 86
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1160259	1163574	2485441	transposase	Erysipelothrix_phage(50.0%)	2	NA	NA
AVG09203.1|1160259_1162107_+	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	42.2	3.4e-20
AVG09204.1|1162374_1163574_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.4	3.6e-63
>prophage 87
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1176392	1179286	2485441		Enterococcus_phage(50.0%)	6	NA	NA
AVG09215.1|1176392_1177319_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	42.2	1.8e-09
AVG09216.1|1177348_1177468_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09217.1|1177539_1177791_+	DUF2129 domain-containing protein	NA	NA	NA	NA	NA
AVG09218.1|1177800_1178190_-	hypothetical protein	NA	NA	NA	NA	NA
AVG09219.1|1178256_1178799_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
AVG09220.1|1178800_1179286_+	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.5	1.1e-26
>prophage 88
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1186128	1187187	2485441	tRNA	Orpheovirus(100.0%)	1	NA	NA
AVG09227.1|1186128_1187187_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	3.6e-30
>prophage 89
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1191690	1196331	2485441		Bodo_saltans_virus(33.33%)	3	NA	NA
AVG09232.1|1191690_1193400_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	23.0	4.0e-15
AVG09233.1|1193409_1195758_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	39.8	1.4e-13
AVG09234.1|1196016_1196331_+	thiol reductase thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	47.6	2.3e-25
>prophage 90
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1202935	1203523	2485441		Bodo_saltans_virus(100.0%)	1	NA	NA
AVG09240.1|1202935_1203523_+	non-canonical purine NTP pyrophosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	26.9	1.6e-08
>prophage 91
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1223936	1226687	2485441	tRNA	Orpheovirus(100.0%)	1	NA	NA
AVG09263.1|1223936_1226687_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	27.4	4.7e-90
>prophage 92
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1231278	1235889	2485441		Enterobacteria_phage(33.33%)	4	NA	NA
AVG09269.1|1231278_1232586_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	34.9	5.2e-55
AVG09270.1|1232611_1233493_+	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	31.3	2.3e-30
AVG09271.1|1233510_1234788_+	dihydroorotase	NA	NA	NA	NA	NA
AVG09272.1|1234788_1235889_+	carbamoyl-phosphate synthase small chain	NA	R4TGJ8	Halovirus	36.0	5.1e-64
>prophage 93
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1239782	1240394	2485441		Pandoravirus(100.0%)	1	NA	NA
AVG09275.1|1239782_1240394_+	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	32.8	6.8e-26
>prophage 94
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1243599	1250526	2485441	tRNA	Abalone_herpesvirus(25.0%)	7	NA	NA
AVG09279.1|1243599_1244223_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	35.3	4.2e-23
AVG09280.1|1244222_1244435_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AVG09281.1|1244972_1246172_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.0	5.6e-40
AVG09282.1|1246171_1248580_+	primosomal protein N'	NA	NA	NA	NA	NA
AVG09283.1|1248687_1248891_-	NINE protein	NA	A0A060AN66	Enterococcus_phage	44.4	1.2e-08
AVG09284.1|1249112_1249601_+	peptide deformylase-like protein	NA	NA	NA	NA	NA
AVG09285.1|1249593_1250526_+|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	30.3	4.3e-11
>prophage 95
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1253673	1255677	2485441		Moumouvirus(100.0%)	1	NA	NA
AVG09289.1|1253673_1255677_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	M1PCM5	Moumouvirus	35.7	1.8e-22
>prophage 96
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1265692	1267676	2485441		Trichoplusia_ni_ascovirus(33.33%)	3	NA	NA
AVG09300.1|1265692_1266427_+	beta-ketoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.7	2.2e-18
AVG09301.1|1266590_1266824_+	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
AVG09302.1|1266938_1267676_+	ribonuclease 3	NA	G8DDA3	Micromonas_pusilla_virus	31.8	4.5e-24
>prophage 97
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1283780	1284551	2485441		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
AVG09315.1|1283780_1284551_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	41.2	3.3e-25
>prophage 98
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1288615	1295150	2485441	tRNA	Indivirus(33.33%)	5	NA	NA
AVG09319.1|1288615_1290685_+	DNA topoisomerase 1	NA	A0A1V0SCS0	Indivirus	39.3	1.5e-104
AVG09320.1|1290709_1292017_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
AVG09321.1|1292241_1293132_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.3	4.2e-24
AVG09322.1|1293135_1293678_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AVG09323.1|1293746_1295150_+	HslU--HslV peptidase ATPase subunit	NA	A0A1B2IDZ7	Erwinia_phage	25.3	2.9e-27
>prophage 99
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1299778	1300549	2485441		Flavobacterium_phage(100.0%)	1	NA	NA
AVG09329.1|1299778_1300549_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.0	6.6e-26
>prophage 100
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1304826	1316508	2485441	tRNA	Streptococcus_phage(33.33%)	9	NA	NA
AVG10440.1|1304826_1309137_+	PolC-type DNA polymerase III	NA	A0A1X9I5C8	Streptococcus_phage	40.1	8.5e-22
AVG09333.1|1309315_1309783_+	ribosome maturation factor	NA	NA	NA	NA	NA
AVG09334.1|1309803_1311027_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AVG09335.1|1311044_1311329_+	DUF448 domain-containing protein	NA	NA	NA	NA	NA
AVG09336.1|1311328_1311646_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09337.1|1311650_1313813_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.3	3.5e-24
AVG09338.1|1314115_1314466_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
AVG09339.1|1314603_1315521_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AVG09340.1|1315536_1316508_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	32.1	6.0e-08
>prophage 101
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1321440	1327141	2485441		Mycobacterium_phage(33.33%)	4	NA	NA
AVG09344.1|1321440_1323834_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.7	4.3e-84
AVG09345.1|1323836_1324550_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVG10441.1|1324670_1325852_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	28.9	3.0e-38
AVG09346.1|1325851_1327141_+	insulinase family protein	NA	M1NN74	Moumouvirus	24.2	7.9e-16
>prophage 102
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1331606	1332656	2485441		Bacillus_phage(100.0%)	1	NA	NA
AVG09352.1|1331606_1332656_+	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	68.8	3.2e-124
>prophage 103
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1339028	1339646	2485441		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVG09358.1|1339028_1339646_+	hypothetical protein	NA	A0A2H4J3M4	uncultured_Caudovirales_phage	44.6	1.9e-39
>prophage 104
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1342962	1347536	2485441		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
AVG09363.1|1342962_1345584_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.3	3.8e-41
AVG09364.1|1345598_1347536_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.6	1.1e-61
>prophage 105
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1355358	1355835	2485441		Fowlpox_virus(100.0%)	1	NA	NA
AVG09372.1|1355358_1355835_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	43.7	1.1e-26
>prophage 106
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1360838	1364755	2485441	head,integrase	Bacillus_phage(33.33%)	6	1353236:1353250	1365053:1365067
1353236:1353250	attL	CATTTTAATAGCATG	NA	NA	NA	NA
AVG09377.1|1360838_1361084_-|integrase	integrase	integrase	A0A1B1P8I7	Bacillus_phage	66.0	6.1e-10
AVG09378.1|1361528_1362875_+|head	phage head morphogenesis protein	head	A0A1J0MFV1	Staphylococcus_phage	57.5	9.1e-140
AVG09379.1|1362880_1363072_+	LSM domain protein	NA	NA	NA	NA	NA
AVG09380.1|1363248_1363626_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
AVG09381.1|1363632_1363821_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09382.1|1364071_1364755_-	hypothetical protein	NA	A0A2H4J5B8	uncultured_Caudovirales_phage	50.0	2.4e-11
1365053:1365067	attR	CATTTTAATAGCATG	NA	NA	NA	NA
>prophage 107
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1368059	1374459	2485441	transposase	Anomala_cuprea_entomopoxvirus(33.33%)	7	NA	NA
AVG09386.1|1368059_1368944_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	6.4e-25
AVG09387.1|1368940_1369672_+	ABC transporter permease	NA	NA	NA	NA	NA
AVG09388.1|1369671_1370766_+	sensor histidine kinase	NA	NA	NA	NA	NA
AVG09389.1|1370762_1371365_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVG09390.1|1371533_1371722_-	hypothetical protein	NA	NA	NA	NA	NA
AVG09391.1|1371877_1372423_+	thermonuclease	NA	A0A1P8CWK6	Bacillus_phage	47.7	2.8e-23
AVG09392.1|1373259_1374459_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.4	4.7e-63
>prophage 108
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1384931	1390264	2485441		Tupanvirus(25.0%)	6	NA	NA
AVG09402.1|1384931_1386446_+	catalase	NA	A0A2K9L0T1	Tupanvirus	42.8	7.5e-90
AVG09403.1|1386535_1386685_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AVG09404.1|1386850_1387120_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
AVG09405.1|1387273_1388251_+	guanosine monophosphate reductase	NA	Q4ZCY7	Staphylococcus_virus	89.2	5.2e-169
AVG09406.1|1388264_1389290_+	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	35.9	1.5e-17
AVG09407.1|1389643_1390264_-	LexA repressor	NA	A0A1B2APZ1	Phage_Wrath	63.8	7.7e-17
>prophage 109
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1394498	1395623	2485441		Staphylococcus_phage(100.0%)	1	NA	NA
AVG09413.1|1394498_1395623_+	exonuclease sbcCD subunit D	NA	Q4Z9B9	Staphylococcus_phage	25.0	1.0e-11
>prophage 110
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1399335	1400976	2485441		Vibrio_phage(100.0%)	1	NA	NA
AVG09416.1|1399335_1400976_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.2	1.6e-21
>prophage 111
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1406094	1410494	2485441		Bacillus_virus(100.0%)	2	NA	NA
AVG09421.1|1406094_1408095_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.4	5.9e-119
AVG09422.1|1408091_1410494_+	DNA topoisomerase 4 subunit A	NA	G3M9Z5	Bacillus_virus	33.8	1.3e-104
>prophage 112
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1420048	1421311	2485441		Bacillus_phage(100.0%)	1	NA	NA
AVG09430.1|1420048_1421311_+	DNA repair protein	NA	O64031	Bacillus_phage	45.0	1.5e-96
>prophage 113
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1424532	1426097	2485441		Acinetobacter_phage(100.0%)	2	NA	NA
AVG09433.1|1424532_1425099_+	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	34.7	1.3e-23
AVG09434.1|1425101_1426097_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	31.1	3.7e-29
>prophage 114
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1435108	1442581	2485441		Tupanvirus(25.0%)	8	NA	NA
AVG09444.1|1435108_1435798_-	peptide ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	27.9	3.0e-14
AVG09445.1|1435800_1436577_-	ABC transporter ATP-binding protein	NA	A0A2H4UUX5	Bodo_saltans_virus	23.9	4.0e-07
AVG09446.1|1436539_1437394_-	ABC transporter permease	NA	NA	NA	NA	NA
AVG09447.1|1437383_1438403_-	ABC transporter permease	NA	NA	NA	NA	NA
AVG09448.1|1438563_1438899_-	hypothetical protein	NA	NA	NA	NA	NA
AVG09449.1|1439146_1440958_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	46.1	3.8e-149
AVG09450.1|1441051_1441699_-	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
AVG09451.1|1441705_1442581_-	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.1	2.4e-16
>prophage 115
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1447406	1449014	2485441		Klosneuvirus(100.0%)	1	NA	NA
AVG09456.1|1447406_1449014_+	ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	25.5	9.5e-51
>prophage 116
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1456623	1461576	2485441		Yellowstone_lake_phycodnavirus(33.33%)	7	NA	NA
AVG09464.1|1456623_1457889_+	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	24.3	5.8e-11
AVG09465.1|1458437_1458650_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09466.1|1458639_1458840_-	cold-shock protein CspA	NA	Q9AZD3	Lactococcus_phage	64.6	2.5e-17
AVG09467.1|1459020_1459329_-	DUF1033 domain-containing protein	NA	NA	NA	NA	NA
AVG09468.1|1459487_1459757_+	acylphosphatase	NA	NA	NA	NA	NA
AVG09469.1|1459796_1460423_+	5-bromo-4-chloroindolyl phosphate hydrolase	NA	NA	NA	NA	NA
AVG09470.1|1460445_1461576_+	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	25.8	2.5e-29
>prophage 117
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1465083	1465875	2485441		Halovirus(100.0%)	1	NA	NA
AVG09473.1|1465083_1465875_-	MoxR family ATPase	NA	R4TG24	Halovirus	28.5	1.4e-10
>prophage 118
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1473489	1474149	2485441		Bacillus_phage(100.0%)	1	NA	NA
AVG09481.1|1473489_1474149_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.0	1.1e-34
>prophage 119
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1481228	1496060	2485441		Staphylococcus_phage(37.5%)	20	NA	NA
AVG09488.1|1481228_1482320_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.6	2.6e-20
AVG09489.1|1482670_1483285_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AVG09490.1|1483297_1484371_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AVG09491.1|1484388_1484892_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVG09492.1|1484927_1485080_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09493.1|1485226_1486702_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.6	1.4e-24
AVG09494.1|1487046_1487271_-	YozE family protein	NA	NA	NA	NA	NA
AVG09495.1|1487270_1487771_-	glucose-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AVG09496.1|1487783_1488212_-	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AVG09497.1|1488208_1488733_-	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AVG09498.1|1488835_1489684_-	fatty acid-binding protein DegV	NA	A0A0N9SI50	Staphylococcus_phage	98.4	1.5e-63
AVG09499.1|1489693_1490179_-	trimethoprim-resistant dihydrofolate reductase DfrC	NA	A0A0N9S8H6	Staphylococcus_phage	98.1	9.1e-90
AVG09500.1|1490220_1491177_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	100.0	1.1e-190
AVG09501.1|1491490_1492153_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	1.6e-28
AVG09502.1|1492168_1493218_-	ABC transporter permease	NA	NA	NA	NA	NA
AVG09503.1|1493429_1493867_-	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
AVG09504.1|1493918_1494179_-	scaffolding protein	NA	NA	NA	NA	NA
AVG09505.1|1494190_1494385_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
AVG09506.1|1494635_1495340_+	hypothetical protein	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	26.0	8.4e-12
AVG09507.1|1495664_1496060_+	ribonuclease H	NA	A0A076FI68	Aureococcus_anophage	26.7	7.3e-05
>prophage 120
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1534672	1536553	2485441		Bacillus_phage(100.0%)	3	NA	NA
AVG09513.1|1534672_1535239_-	DUF1273 domain-containing protein	NA	U5J9F7	Bacillus_phage	22.5	1.6e-05
AVG09514.1|1535250_1535583_-	DUF1798 domain-containing protein	NA	NA	NA	NA	NA
AVG09515.1|1535926_1536553_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	34.3	5.0e-24
>prophage 121
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1539959	1547045	2485441	tRNA	Temperate_phage(25.0%)	5	NA	NA
AVG09519.1|1539959_1540646_-	DNA replication protein DnaD	NA	Q938N2	Temperate_phage	36.5	1.5e-08
AVG09520.1|1540738_1542031_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	3.5e-56
AVG09521.1|1542151_1544860_-	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	31.5	1.1e-43
AVG09522.1|1544884_1545856_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
AVG09523.1|1545842_1547045_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	40.3	2.7e-34
>prophage 122
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1555916	1559505	2485441		Anguillid_herpesvirus(33.33%)	5	NA	NA
AVG09533.1|1555916_1556396_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	42.1	4.0e-29
AVG09534.1|1556505_1557525_-	heptaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.4	3.2e-12
AVG09535.1|1557466_1558192_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
AVG09536.1|1558184_1558763_-	heptaprenyl pyrophosphate synthase subunit A	NA	NA	NA	NA	NA
AVG09537.1|1559232_1559505_-	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
>prophage 123
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1568446	1580965	2485441		Bacillus_phage(42.86%)	15	NA	NA
AVG09545.1|1568446_1569826_-	ATP-dependent DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	33.5	2.9e-56
AVG09546.1|1569812_1570775_-	hypothetical protein	NA	NA	NA	NA	NA
AVG09547.1|1570883_1571132_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	52.0	6.8e-17
AVG09548.1|1571223_1571328_-	hypothetical protein	NA	NA	NA	NA	NA
AVG09549.1|1571536_1572076_-	ECF transporter S component	NA	NA	NA	NA	NA
AVG09550.1|1572667_1574434_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	33.7	1.2e-33
AVG09551.1|1574417_1575143_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	42.2	8.3e-47
AVG09552.1|1575276_1576014_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
AVG09553.1|1576006_1576549_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.5	2.3e-09
AVG09554.1|1576541_1577342_-	segregation/condensation protein A	NA	NA	NA	NA	NA
AVG09555.1|1577370_1577895_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
AVG09556.1|1577947_1578835_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.4	3.9e-38
AVG09557.1|1578877_1579327_-	transcriptional repressor	NA	NA	NA	NA	NA
AVG09558.1|1579431_1579974_-	ADP-ribose pyrophosphatase	NA	NA	NA	NA	NA
AVG09559.1|1580056_1580965_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	33.9	2.6e-05
>prophage 124
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1584315	1585800	2485441		Cyanophage(100.0%)	1	NA	NA
AVG09563.1|1584315_1585800_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.4	6.9e-80
>prophage 125
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1588969	1590376	2485441		Synechococcus_phage(100.0%)	1	NA	NA
AVG09566.1|1588969_1590376_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	A0A222YX62	Synechococcus_phage	29.8	2.2e-27
>prophage 126
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1596910	1603470	2485441		Erysipelothrix_phage(33.33%)	6	NA	NA
AVG09573.1|1596910_1598332_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.4	6.0e-41
AVG09574.1|1598591_1600268_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AVG09575.1|1600283_1600736_-	arginine repressor	NA	NA	NA	NA	NA
AVG09576.1|1601050_1601932_-	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	27.2	4.4e-10
AVG09577.1|1601909_1602140_-	exodeoxyribonuclease 7 small subunit	NA	NA	NA	NA	NA
AVG09578.1|1602132_1603470_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	35.7	1.3e-42
>prophage 127
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1615537	1618385	2485441		Prochlorococcus_phage(100.0%)	2	NA	NA
AVG09592.1|1615537_1617046_-	glycine dehydrogenase subunit 2	NA	E3ST28	Prochlorococcus_phage	42.0	6.3e-81
AVG09593.1|1617038_1618385_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	37.6	1.2e-62
>prophage 128
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1623917	1624541	2485441		Streptococcus_phage(100.0%)	1	NA	NA
AVG09602.1|1623917_1624541_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	39.3	7.7e-33
>prophage 129
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1630976	1645035	2485441	tRNA	Bacillus_thuringiensis_phage(14.29%)	13	NA	NA
AVG09611.1|1630976_1631576_-	superoxide dismutase [Mn/Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	55.2	2.4e-60
AVG09612.1|1631988_1632408_-	transcriptional repressor	NA	NA	NA	NA	NA
AVG09613.1|1632410_1633259_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AVG09614.1|1633292_1634084_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	7.7e-22
AVG09615.1|1634292_1635183_-	endonuclease	NA	A0A2H4UU70	Bodo_saltans_virus	33.2	2.3e-22
AVG09616.1|1635192_1636539_-	ATP-dependent helicase	NA	A0A1V0SBR7	Catovirus	33.7	2.9e-53
AVG09617.1|1636573_1637674_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AVG09618.1|1637663_1638353_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
AVG09619.1|1638507_1639614_-	RNA polymerase sigma factor SigA	NA	F4YCU2	Synechococcus_phage	37.6	1.1e-37
AVG09620.1|1639884_1641681_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.8	3.9e-53
AVG09621.1|1641854_1642673_-	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AVG09622.1|1642684_1643308_-	transcriptional regulator	NA	NA	NA	NA	NA
AVG09623.1|1643643_1645035_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	29.0	3.2e-47
>prophage 130
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1648080	1649028	2485441		Erwinia_phage(100.0%)	1	NA	NA
AVG09629.1|1648080_1649028_-	PhoH family protein	NA	W8D063	Erwinia_phage	49.0	8.9e-49
>prophage 131
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1655922	1659018	2485441		Catovirus(50.0%)	2	NA	NA
AVG09637.1|1655922_1657044_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.2	1.4e-29
AVG09638.1|1657188_1659018_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.7	3.6e-139
>prophage 132
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1662054	1668240	2485441		Streptococcus_phage(33.33%)	5	NA	NA
AVG09642.1|1662054_1663878_-	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	23.5	2.6e-20
AVG09643.1|1664170_1664422_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AVG09644.1|1664539_1665514_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AVG09645.1|1665558_1667775_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	30.4	9.1e-28
AVG09646.1|1667778_1668240_-	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	57.1	7.9e-35
>prophage 133
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1680991	1717924	2485441	protease,tRNA,transposase	uncultured_Mediterranean_phage(23.53%)	31	NA	NA
AVG09662.1|1680991_1681474_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	6.4e-19
AVG09663.1|1681771_1682248_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
AVG09664.1|1682278_1682902_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	40.5	8.2e-35
AVG09665.1|1682901_1684170_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	31.9	5.2e-36
AVG09666.1|1684187_1685111_-|protease	collagenase-like protease	protease	NA	NA	NA	NA
AVG09667.1|1685113_1685749_-	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	29.3	7.4e-07
AVG09668.1|1686177_1686486_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
AVG09669.1|1686500_1686929_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AVG09670.1|1686930_1687191_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
AVG09671.1|1687254_1689885_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.2	6.7e-62
AVG09672.1|1690213_1692646_-	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	26.6	1.1e-47
AVG09673.1|1692647_1693316_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AVG09674.1|1693478_1694597_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AVG09675.1|1694596_1695739_-	cysteine desulfurase	NA	A0A141ZJV0	Faustovirus	28.0	1.5e-26
AVG09676.1|1695981_1696977_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AVG09677.1|1697176_1697320_-	hypothetical protein	NA	NA	NA	NA	NA
AVG09678.1|1697505_1697928_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AVG09679.1|1698004_1699285_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	51.1	2.4e-105
AVG09680.1|1699477_1700254_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
AVG09681.1|1700809_1702576_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	22.4	3.4e-17
AVG09682.1|1702578_1703853_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AVG09683.1|1704224_1705100_-	cell wall amidase	NA	A0A0N9SGH1	Paenibacillus_phage	32.4	6.2e-12
AVG09684.1|1705096_1705549_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AVG09685.1|1705562_1707752_-	GTP pyrophosphokinase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	38.0	4.1e-12
AVG09686.1|1708272_1708791_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	2.1e-28
AVG09687.1|1708809_1711083_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.6	2.3e-66
AVG09688.1|1711826_1714118_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	36.6	7.0e-31
AVG09689.1|1714456_1714717_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	44.3	5.7e-06
AVG09690.1|1714732_1715872_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.4	1.3e-83
AVG09691.1|1715892_1716957_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AVG09692.1|1716919_1717924_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
>prophage 134
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1727239	1729870	2485441	tRNA	Catovirus(100.0%)	1	NA	NA
AVG09707.1|1727239_1729870_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.9	7.5e-154
>prophage 135
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1739310	1750803	2485441	protease,tRNA	Bacillus_virus(20.0%)	10	NA	NA
AVG09717.1|1739310_1740573_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.7	7.7e-141
AVG09718.1|1740859_1742161_-	trigger factor	NA	NA	NA	NA	NA
AVG09719.1|1742321_1743245_-	hypothetical protein	NA	NA	NA	NA	NA
AVG09720.1|1743261_1743873_-	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	34.4	8.1e-19
AVG09721.1|1744290_1744647_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVG09722.1|1744698_1744899_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVG09723.1|1744926_1745454_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.8	1.4e-11
AVG09724.1|1745661_1747164_-	amino acid permease	NA	NA	NA	NA	NA
AVG09725.1|1747592_1749530_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.7	3.9e-115
AVG09726.1|1749882_1750803_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	31.2	3.4e-29
>prophage 136
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1755659	1763464	2485441		Bacillus_virus(20.0%)	5	NA	NA
AVG09731.1|1755659_1756532_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.3	1.2e-44
AVG09732.1|1756547_1759259_-	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	33.4	1.1e-46
AVG09733.1|1759472_1761170_-	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	36.7	6.1e-32
AVG09734.1|1761169_1761880_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	1.4e-06
AVG09735.1|1762195_1763464_-	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	55.6	9.2e-09
>prophage 137
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1766714	1768472	2485441		Staphylococcus_phage(100.0%)	1	NA	NA
AVG09738.1|1766714_1768472_-	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	84.4	2.7e-35
>prophage 138
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1773074	1776272	2485441		Streptomyces_phage(100.0%)	1	NA	NA
AVG09743.1|1773074_1776272_-	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	31.0	2.0e-129
>prophage 139
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1793900	1798040	2485441		Only_Syngen_Nebraska_virus(50.0%)	4	NA	NA
AVG09761.1|1793900_1794647_-	glycerophosphodiester phosphodiesterase	NA	A0A1J0F961	Only_Syngen_Nebraska_virus	31.6	3.4e-19
AVG09762.1|1794724_1795165_+	SACOL1771 family peroxiredoxin	NA	NA	NA	NA	NA
AVG09763.1|1795291_1796455_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
AVG09764.1|1796444_1798040_+	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	63.6	8.7e-73
>prophage 140
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1801924	1804619	2485441	protease,tRNA	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AVG09768.1|1801924_1803163_+|protease	serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	27.9	1.8e-09
AVG09769.1|1803353_1804619_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.9	9.6e-83
>prophage 141
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1814076	1819080	2485441		Mycobacterium_phage(50.0%)	3	NA	NA
AVG09777.1|1814076_1817586_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	46.4	1.0e-81
AVG09778.1|1817606_1818203_-	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
AVG09779.1|1818225_1819080_-	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	85.4	2.8e-62
>prophage 142
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1828658	1878307	2485441	integrase,tRNA,transposase	Staphylococcus_phage(81.82%)	42	1821525:1821541	1881116:1881132
1821525:1821541	attL	TACTCATTAAGCTCAAT	NA	NA	NA	NA
AVG09790.1|1828658_1829921_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	76.0	1.8e-41
AVG09791.1|1830292_1841371_-	YSIRK signal domain/LPXTG anchor domain surface protein	NA	A0A2H4PQU6	Staphylococcus_phage	25.6	5.4e-28
AVG09792.1|1841775_1842087_-	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	71.8	4.1e-35
AVG09793.1|1842112_1844557_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	87.4	0.0e+00
AVG09794.1|1844818_1846033_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	83.7	4.6e-183
AVG09795.1|1846139_1847093_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	84.7	3.3e-67
AVG09796.1|1847089_1847653_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	66.5	1.9e-67
AVG09797.1|1847824_1849024_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.4	3.6e-63
AVG09798.1|1849448_1849850_-	transcriptional regulator	NA	NA	NA	NA	NA
AVG09799.1|1850339_1851167_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVG09800.1|1851409_1852411_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	70.0	1.5e-131
AVG09801.1|1852458_1852920_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	84.2	1.2e-59
AVG09802.1|1852932_1854114_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	75.3	1.8e-176
AVG09803.1|1854126_1854759_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	77.1	5.5e-87
AVG09804.1|1854765_1855809_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	66.5	3.4e-134
AVG09805.1|1856245_1857739_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	65.6	2.5e-13
AVG09806.1|1858077_1858929_-	autolysin	NA	A0A1J0MFB0	Staphylococcus_phage	35.6	1.0e-32
AVG09807.1|1859306_1859522_-	hypothetical protein	NA	NA	NA	NA	NA
AVG09808.1|1859554_1859674_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09809.1|1859729_1860209_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4PQT5	Staphylococcus_phage	42.3	2.7e-25
AVG09810.1|1860214_1860658_+	competence protein ComK	NA	NA	NA	NA	NA
AVG09811.1|1860644_1861088_-	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	42.9	3.1e-20
AVG09812.1|1861227_1861941_-	transaldolase	NA	M1PR54	Cyanophage	37.4	4.1e-22
AVG09813.1|1862217_1862526_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09814.1|1862564_1862930_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	57.0	4.1e-34
AVG09815.1|1862926_1863280_+	camphor resistance protein CrcB	NA	A0A2H4PQQ7	Staphylococcus_phage	32.5	8.5e-05
AVG09816.1|1864046_1864883_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	68.6	6.1e-110
AVG09817.1|1865062_1865971_-	hypothetical protein	NA	A0A2H4PQQ8	Staphylococcus_phage	80.6	1.8e-102
AVG09818.1|1866073_1867273_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	85.4	4.1e-192
AVG09819.1|1867642_1869235_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	83.2	2.7e-268
AVG09820.1|1869465_1870251_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	71.3	2.0e-99
AVG09821.1|1870237_1870714_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	58.7	1.5e-44
AVG09822.1|1870772_1871024_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	81.9	1.9e-35
AVG09823.1|1871020_1872022_-	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	50.2	6.9e-92
AVG09824.1|1872011_1873436_-	2-succinylbenzoate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	63.9	6.6e-173
AVG09825.1|1874445_1874592_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09826.1|1874686_1875352_+	hypothetical protein	NA	A0A2H4J5B8	uncultured_Caudovirales_phage	41.8	7.0e-08
AVG09827.1|1875513_1875801_+	hypothetical protein	NA	A0A2H4JGN1	uncultured_Caudovirales_phage	50.0	5.5e-18
AVG09828.1|1876090_1876246_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09829.1|1876327_1877062_+	hypothetical protein	NA	NA	NA	NA	NA
AVG09830.1|1877441_1877654_-	hypothetical protein	NA	A0A2H4JCA1	uncultured_Caudovirales_phage	72.9	7.3e-20
AVG09831.1|1877812_1878307_+|integrase	site-specific integrase	integrase	B7T092	Staphylococcus_virus	76.1	3.8e-67
1881116:1881132	attR	TACTCATTAAGCTCAAT	NA	NA	NA	NA
>prophage 143
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1887114	1887855	2485441		Staphylococcus_phage(100.0%)	1	NA	NA
AVG09840.1|1887114_1887855_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	7.0e-25
>prophage 144
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1896523	1899611	2485441		Streptococcus_phage(50.0%)	4	NA	NA
AVG09849.1|1896523_1896868_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	30.6	5.8e-06
AVG09850.1|1896940_1898071_-	DUF445 domain-containing protein	NA	NA	NA	NA	NA
AVG09851.1|1898252_1898717_-	transcriptional regulator	NA	NA	NA	NA	NA
AVG09852.1|1898987_1899611_-	DNA-binding response regulator	NA	A0A1V0SGR9	Hokovirus	28.2	5.2e-05
>prophage 145
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1907629	1912173	2485441	protease	Planktothrix_phage(50.0%)	4	NA	NA
AVG09861.1|1907629_1908358_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.5	2.8e-34
AVG09862.1|1908344_1909802_-	glutamate ABC transporter permease	NA	NA	NA	NA	NA
AVG09863.1|1910040_1911099_-	PTS transporter subunit IIC	NA	NA	NA	NA	NA
AVG09864.1|1911324_1912173_-|protease	serine protease	protease	A0A2H4PQN3	Staphylococcus_phage	31.9	3.5e-20
>prophage 146
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1925568	1929239	2485441		Bacillus_phage(50.0%)	3	NA	NA
AVG09870.1|1925568_1927305_-	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.4	1.3e-48
AVG09871.1|1927546_1928089_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
AVG09872.1|1928195_1929239_-	A/G-specific adenine glycosylase	NA	G3CB03	Aeropyrum_pernix_spindle-shaped_virus	28.9	2.1e-22
>prophage 147
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1942551	1943181	2485441		Bacillus_phage(100.0%)	1	NA	NA
AVG09888.1|1942551_1943181_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	27.4	1.1e-05
>prophage 148
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1951467	1956519	2485441		Staphylococcus_phage(33.33%)	5	NA	NA
AVG09898.1|1951467_1952022_+	DNA polymerase III subunit epsilon	NA	B5WZL1	Staphylococcus_phage	42.0	2.3e-33
AVG09899.1|1952052_1953123_-	DNA polymerase IV	NA	NA	NA	NA	NA
AVG09900.1|1953432_1953981_-	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
AVG09901.1|1954118_1955537_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	41.8	1.2e-102
AVG09902.1|1955568_1956519_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.1	1.8e-17
>prophage 149
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1963413	1973903	2485441		Bacillus_virus(40.0%)	9	NA	NA
AVG09908.1|1963413_1965411_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	37.3	1.2e-111
AVG09909.1|1965414_1967604_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.1	1.0e-132
AVG09910.1|1967600_1968293_-	geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
AVG09911.1|1968616_1968919_-	hypothetical protein	NA	NA	NA	NA	NA
AVG09912.1|1969043_1970339_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.6	2.1e-16
AVG09913.1|1970750_1970942_-	NETI motif-containing protein	NA	NA	NA	NA	NA
AVG09914.1|1970913_1971540_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
AVG09915.1|1971613_1972441_-	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	51.2	7.2e-63
AVG09916.1|1972433_1973903_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	46.2	4.1e-109
>prophage 150
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1984739	1986308	2485441		Salmonella_phage(50.0%)	2	NA	NA
AVG09927.1|1984739_1985585_+	penicillin-hydrolyzing class A beta-lactamase BlaZ	NA	A0A1B0VBP7	Salmonella_phage	34.3	3.4e-31
AVG09928.1|1985888_1986308_+	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	53.5	3.1e-30
>prophage 151
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1990165	1991317	2485441	transposase	Streptococcus_pyogenes_phage(100.0%)	1	NA	NA
AVG09931.1|1990165_1991317_-|transposase	transposase	transposase	P97010	Streptococcus_pyogenes_phage	31.6	1.8e-11
>prophage 152
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	1997073	1999521	2485441		Staphylococcus_phage(50.0%)	3	NA	NA
AVG09938.1|1997073_1997946_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	34.3	1.7e-25
AVG09939.1|1997966_1998626_-	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
AVG09940.1|1998606_1999521_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.7	2.1e-18
>prophage 153
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2004029	2005989	2485441		uncultured_virus(100.0%)	2	NA	NA
AVG09944.1|2004029_2005649_-	molecular chaperone GroEL	NA	A0A240F779	uncultured_virus	54.0	4.4e-157
AVG09945.1|2005704_2005989_-	co-chaperone GroES	NA	A0A221S386	uncultured_virus	43.0	1.5e-12
>prophage 154
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2012263	2018085	2485441		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
AVG09952.1|2012263_2012980_+	DNA-binding response regulator	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	33.9	1.1e-27
AVG09953.1|2013047_2014007_-	carbohydrate kinase	NA	NA	NA	NA	NA
AVG09954.1|2014013_2015486_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.7	2.1e-20
AVG09955.1|2015651_2015744_-	hypothetical protein	NA	NA	NA	NA	NA
AVG09956.1|2015745_2016699_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AVG09957.1|2016834_2018085_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	29.7	9.7e-35
>prophage 155
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2021337	2026335	2485441	tRNA	Bodo_saltans_virus(33.33%)	3	NA	NA
AVG09962.1|2021337_2023272_+	ABC transporter ATP-binding protein	NA	A0A2H4UUX5	Bodo_saltans_virus	26.9	3.4e-47
AVG09963.1|2023613_2025230_+	DNA mismatch repair protein MutS	NA	A0A1B1IS82	uncultured_Mediterranean_phage	26.5	2.5e-19
AVG09964.1|2025312_2026335_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	39.9	9.9e-62
>prophage 156
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2030044	2034709	2485441		Micromonas_sp._RCC1109_virus(100.0%)	4	NA	NA
AVG09969.1|2030044_2031796_+	acetolactate synthase, large subunit, biosynthetic type	NA	E5EQ70	Micromonas_sp._RCC1109_virus	30.9	3.0e-66
AVG09970.1|2031795_2032029_+	acetolactate synthase	NA	NA	NA	NA	NA
AVG09971.1|2032146_2033151_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AVG09972.1|2033173_2034709_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	29.2	1.7e-12
>prophage 157
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2048193	2051555	2485441		Bacillus_phage(50.0%)	5	NA	NA
AVG09979.1|2048193_2048964_-	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.7	4.1e-20
AVG09980.1|2048938_2049418_-	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
AVG09981.1|2049419_2049746_-	anti-anti-sigma factor	NA	NA	NA	NA	NA
AVG09982.1|2049845_2050847_-	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
AVG09983.1|2051192_2051555_-	mRNA interferase MazF	NA	Q332J9	Clostridium_botulinum_C_phage	33.6	6.5e-08
>prophage 158
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2056145	2057675	2485441		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVG09990.1|2056145_2057675_-	ATP-dependent helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.2	9.9e-58
>prophage 159
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2064744	2065398	2485441		Moumouvirus(100.0%)	1	NA	NA
AVG09998.1|2064744_2065398_+	HD domain-containing protein	NA	H2ED17	Moumouvirus	30.6	1.0e-11
>prophage 160
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2070723	2071119	2485441		Listeria_phage(100.0%)	1	NA	NA
AVG10004.1|2070723_2071119_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	35.0	1.1e-16
>prophage 161
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2081302	2089148	2485441		Catovirus(25.0%)	10	NA	NA
AVG10018.1|2081302_2082451_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	28.8	2.6e-26
AVG10019.1|2082472_2083102_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AVG10020.1|2083130_2084369_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.0	1.8e-102
AVG10021.1|2084393_2084918_-	TIGR01440 family protein	NA	NA	NA	NA	NA
AVG10022.1|2085027_2085447_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AVG10023.1|2085443_2086487_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	37.9	7.3e-44
AVG10024.1|2086462_2086600_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10025.1|2086649_2087486_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVG10026.1|2087472_2088549_-	peptide chain release factor 1	NA	NA	NA	NA	NA
AVG10027.1|2088548_2089148_-	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.4	4.3e-33
>prophage 162
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2093166	2094366	2485441	transposase	Streptococcus_phage(100.0%)	1	NA	NA
AVG10031.1|2093166_2094366_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.4	3.6e-63
>prophage 163
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2098290	2099898	2485441		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
AVG10035.1|2098290_2099898_-	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	4.4e-149
>prophage 164
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2108675	2112159	2485441		Geobacillus_virus(50.0%)	4	NA	NA
AVG10045.1|2108675_2109977_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.6	1.2e-133
AVG10046.1|2110009_2110672_-	2-deoxyribose-5-phosphate aldolase	NA	NA	NA	NA	NA
AVG10047.1|2110878_2111589_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
AVG10048.1|2111712_2112159_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	44.5	1.1e-28
>prophage 165
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2117519	2118491	2485441		Indivirus(100.0%)	1	NA	NA
AVG10057.1|2117519_2118491_+	cation transporter	NA	A0A1V0SED0	Indivirus	27.3	3.5e-24
>prophage 166
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2122423	2124229	2485441		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVG10061.1|2122423_2124229_-	glutamine--fructose-6-phosphate aminotransferase	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	40.3	1.7e-101
>prophage 167
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2144391	2145357	2485441		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVG10075.1|2144391_2145357_-	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	29.3	2.9e-15
>prophage 168
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2168181	2173564	2485441	tRNA	Orpheovirus(33.33%)	7	NA	NA
AVG10097.1|2168181_2168922_+	NAD-dependent protein deacetylase	NA	A0A2I2L319	Orpheovirus	30.8	1.8e-17
AVG10098.1|2169184_2169583_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
AVG10099.1|2169596_2170034_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
AVG10100.1|2170294_2171098_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AVG10101.1|2171101_2171908_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
AVG10102.1|2171897_2172758_-	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	22.1	4.3e-10
AVG10103.1|2172754_2173564_-	energy-coupling factor transporter ATPase	NA	G3M9Y6	Bacillus_virus	27.0	4.2e-15
>prophage 169
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2188624	2189959	2485441		Moraxella_phage(100.0%)	1	NA	NA
AVG10134.1|2188624_2189959_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.2	8.7e-50
>prophage 170
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2196254	2199410	2485441		Leptospira_phage(100.0%)	1	NA	NA
AVG10141.1|2196254_2199410_-	AcrB/AcrD/AcrF family protein	NA	S5VTK5	Leptospira_phage	22.8	1.4e-66
>prophage 171
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2204625	2205825	2485441	transposase	Streptococcus_phage(100.0%)	1	NA	NA
AVG10145.1|2204625_2205825_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.4	4.7e-63
>prophage 172
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2213172	2213793	2485441		Bacillus_virus(100.0%)	1	NA	NA
AVG10156.1|2213172_2213793_-	molybdenum ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.6	1.4e-21
>prophage 173
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2237731	2241109	2485441		Catovirus(50.0%)	3	NA	NA
AVG10184.1|2237731_2238685_+	hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	31.0	1.2e-32
AVG10185.1|2238825_2239950_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10186.1|2240332_2241109_-	autolysin	NA	H9A0W8	Staphylococcus_phage	39.4	8.4e-37
>prophage 174
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2262540	2263422	2485441		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AVG10208.1|2262540_2263422_-	NAD(P)-dependent dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	43.8	9.8e-58
>prophage 175
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2287054	2288266	2485441		Salmonella_phage(100.0%)	1	NA	NA
AVG10233.1|2287054_2288266_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	28.2	2.1e-34
>prophage 176
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2291802	2294329	2485441		Planktothrix_phage(50.0%)	3	NA	NA
AVG10238.1|2291802_2292471_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	4.2e-37
AVG10239.1|2292470_2293523_-	heme ABC transporter permease	NA	NA	NA	NA	NA
AVG10240.1|2293654_2294329_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	47.9	2.2e-54
>prophage 177
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2303519	2305685	2485441		Catovirus(100.0%)	1	NA	NA
AVG10247.1|2303519_2305685_-	CDP-glycerol:glycerophosphate glycerophosphotransferase	NA	A0A1V0SAH6	Catovirus	38.7	4.3e-06
>prophage 178
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2327623	2388658	2485441	protease,holin,transposase	Streptococcus_phage(22.22%)	51	NA	NA
AVG10271.1|2327623_2329177_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	4.4e-21
AVG10272.1|2331454_2332654_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.4	3.6e-63
AVG10273.1|2332841_2334410_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10274.1|2334589_2335525_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
AVG10275.1|2335515_2335830_-	nitrite reductase (NAD(P)H) small subunit	NA	NA	NA	NA	NA
AVG10276.1|2335832_2338238_-	nitrite reductase large subunit	NA	NA	NA	NA	NA
AVG10277.1|2339515_2340235_-	sirohydrochlorin chelatase	NA	NA	NA	NA	NA
AVG10278.1|2340224_2340332_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10279.1|2340484_2341960_+	nickel ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG10280.1|2342177_2342714_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVG10281.1|2343156_2343978_-	formate/nitrite transporter	NA	NA	NA	NA	NA
AVG10282.1|2344212_2344683_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
AVG10283.1|2344964_2345561_-	glutaredoxin	NA	NA	NA	NA	NA
AVG10284.1|2345584_2345953_-	cystatin-like fold lipoprotein	NA	NA	NA	NA	NA
AVG10285.1|2346306_2347554_+	aminoacyltransferase	NA	NA	NA	NA	NA
AVG10286.1|2348239_2348971_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	2.7e-29
AVG10287.1|2348967_2349687_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVG10288.1|2349667_2350456_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG10289.1|2350670_2350775_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10290.1|2350960_2351647_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVG10291.1|2351922_2352810_-	cation transporter	NA	NA	NA	NA	NA
AVG10292.1|2353094_2353481_-	GtrA family protein	NA	NA	NA	NA	NA
AVG10293.1|2353501_2354974_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10294.1|2355257_2356409_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.5	1.7e-49
AVG10295.1|2356439_2357141_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10296.1|2357401_2358604_+	MFS transporter	NA	NA	NA	NA	NA
AVG10297.1|2358910_2359519_+	hypothetical protein	NA	NA	NA	NA	NA
AVG10298.1|2359581_2360391_-	phosphohydrolase	NA	NA	NA	NA	NA
AVG10299.1|2360708_2362085_+	amino acid permease	NA	NA	NA	NA	NA
AVG10300.1|2362232_2364062_-	APC family permease	NA	NA	NA	NA	NA
AVG10301.1|2364348_2365866_+	serine hydrolase FLP	NA	A0A2P1K0A5	Mycobacterium_phage	23.0	6.1e-07
AVG10302.1|2366026_2366863_+	lipoprotein	NA	NA	NA	NA	NA
AVG10303.1|2366985_2367918_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AVG10304.1|2368341_2369742_-	MFS transporter	NA	NA	NA	NA	NA
AVG10305.1|2370165_2371941_+	sensor protein LytS	NA	Q9EYF3	Enterobacteria_phage	30.9	2.6e-65
AVG10306.1|2371921_2372680_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVG10307.1|2372814_2373273_+|holin	antiholin-like protein LrgA	holin	NA	NA	NA	NA
AVG10308.1|2373276_2373978_+|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
AVG10309.1|2374159_2374855_-	ABC transporter permease	NA	NA	NA	NA	NA
AVG10456.1|2374854_2375748_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG10310.1|2375815_2376451_-	ABC transporter permease	NA	NA	NA	NA	NA
AVG10311.1|2376453_2377710_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	53.8	2.7e-21
AVG10312.1|2378199_2379252_+	butanediol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	20.9	4.5e-09
AVG10313.1|2379851_2381531_+	APC family permease	NA	NA	NA	NA	NA
AVG10314.1|2381835_2383203_+	carboxylesterase/lipase family protein	NA	NA	NA	NA	NA
AVG10315.1|2383285_2384464_-	MFS transporter	NA	NA	NA	NA	NA
AVG10316.1|2384602_2385379_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AVG10317.1|2385371_2386043_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	36.0	2.0e-18
AVG10318.1|2386145_2386898_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVG10457.1|2387040_2387307_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVG10319.1|2387839_2388658_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 179
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2392491	2393310	2485441		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
AVG10324.1|2392491_2393310_-	SDR family NAD(P)-dependent oxidoreductase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	26.7	2.2e-11
>prophage 180
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2398895	2408654	2485441		Bacillus_phage(50.0%)	7	NA	NA
AVG10328.1|2398895_2399588_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A0K0KVL6	Prochlorococcus_phage	27.6	9.2e-11
AVG10329.1|2400357_2400549_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10330.1|2400699_2403558_-	DUF3427 domain-containing protein	NA	Q5YA94	Bacillus_phage	26.3	1.2e-24
AVG10331.1|2403559_2403967_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AVG10332.1|2404225_2405716_-	glycosyl transferase family 1	NA	NA	NA	NA	NA
AVG10333.1|2405933_2407574_+	phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	38.3	1.5e-96
AVG10334.1|2407787_2408654_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	51.9	1.7e-78
>prophage 181
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2441118	2442111	2485441		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVG10361.1|2441118_2442111_+	D-lactate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	30.7	2.3e-39
>prophage 182
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2451922	2453122	2485441	transposase	Streptococcus_phage(100.0%)	1	NA	NA
AVG10371.1|2451922_2453122_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.4	4.7e-63
>prophage 183
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2461221	2468124	2485441	protease	Acanthamoeba_polyphaga_mimivirus(33.33%)	7	NA	NA
AVG10381.1|2461221_2462202_-	alpha/beta hydrolase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	23.7	2.4e-12
AVG10382.1|2462284_2463148_-	YitT family protein	NA	NA	NA	NA	NA
AVG10383.1|2463315_2463642_-	thioredoxin	NA	NA	NA	NA	NA
AVG10384.1|2463864_2464917_+	alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.7	1.9e-15
AVG10385.1|2464981_2465749_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVG10386.1|2465810_2466077_-	hypothetical protein	NA	NA	NA	NA	NA
AVG10387.1|2466096_2468124_-	PTS glucose transporter subunit IICBA	NA	A0A2I7SAJ6	Vibrio_phage	43.3	2.1e-07
>prophage 184
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2476536	2477055	2485441		Streptococcus_phage(100.0%)	1	NA	NA
AVG10396.1|2476536_2477055_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	38.5	2.5e-21
>prophage 185
CP014132	Staphylococcus epidermidis strain FDAARGOS_161 chromosome, complete genome	2485441	2482772	2483642	2485441		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AVG10402.1|2482772_2483642_-	KR domain-containing protein	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	41.4	2.5e-50
>prophage 1
CP014130	Staphylococcus epidermidis strain FDAARGOS_161 plasmid unnamed1, complete sequence	21267	0	12857	21267	transposase	Cyanophage(16.67%)	11	NA	NA
AVG08159.1|855_2316_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	36.1	2.3e-72
AVG08160.1|2425_3100_-|transposase	IS6 family transposase IS257-1	transposase	A0A0N9RU54	Staphylococcus_phage	98.2	3.8e-126
AVG08161.1|3573_5040_+	ABC-F type ribosomal protection protein Msr(A)	NA	A0A2I4R674	Erysipelothrix_phage	37.9	3.9e-67
AVG08162.1|5138_6038_+	Mph(C) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AVG08163.1|6523_7132_+	transposon DNA-invertase	NA	I1ZBD6	Salisaeta_icosahedral_phage	31.1	3.7e-16
AVG08164.1|7341_7902_-	transcriptional regulator	NA	NA	NA	NA	NA
AVG08165.1|8085_9630_+	QacA/B family quaternary ammonium compound efflux MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	25.3	2.8e-31
AVG08166.1|9834_10395_+	hypothetical protein	NA	NA	NA	NA	NA
AVG08167.1|10470_10593_+	hypothetical protein	NA	NA	NA	NA	NA
AVG08168.1|10714_11482_-	DUF536 domain-containing protein	NA	NA	NA	NA	NA
AVG08169.1|11921_12857_+	replication protein	NA	Q9MCM7	Streptococcus_virus	47.1	1.5e-19
>prophage 2
CP014130	Staphylococcus epidermidis strain FDAARGOS_161 plasmid unnamed1, complete sequence	21267	16645	17320	21267	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
AVG08173.1|16645_17320_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	89.7	1.1e-117
