The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	0	5536	5266746		Acinetobacter_phage(33.33%)	4	NA	NA
AVI64387.1|414_2040_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.9	5.2e-65
AVI64388.1|2065_2305_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64389.1|2340_3486_-	3-beta hydroxysteroid dehydrogenase	NA	Q5YFR2	Singapore_grouper_iridovirus	26.0	2.2e-17
AVI64390.1|3679_5536_-	peptide synthase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.8e-06
>prophage 2
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	10319	12296	5266746	holin	Vibrio_phage(100.0%)	1	NA	NA
AVI64397.1|10319_12296_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.3	1.5e-29
>prophage 3
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	17899	18718	5266746		Indivirus(100.0%)	1	NA	NA
AVI64403.1|17899_18718_-	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.9	7.8e-17
>prophage 4
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	32174	33131	5266746		Bacillus_virus(100.0%)	1	NA	NA
AVI64416.1|32174_33131_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	4.3e-19
>prophage 5
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	44431	54255	5266746		Bacillus_virus(20.0%)	6	NA	NA
AVI64425.1|44431_45460_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	29.0	1.9e-12
AVI64426.1|45637_48232_+	FAD-linked oxidase	NA	S4VRT3	Pandoravirus	33.9	2.7e-23
AVI64427.1|48338_49238_+	EamA family transporter	NA	NA	NA	NA	NA
AVI64428.1|49335_49860_+	lipocalin	NA	A0A1W6JNX6	Morganella_phage	50.6	4.6e-47
AVI64429.1|50045_51638_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.1	6.1e-58
AVI64430.1|52020_54255_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.6	2.6e-91
>prophage 6
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	75787	77709	5266746		Bacillus_phage(50.0%)	2	NA	NA
AVI64451.1|75787_76696_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	43.1	1.2e-53
AVI64452.1|76695_77709_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.4	1.5e-89
>prophage 7
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	86823	94904	5266746		Escherichia_phage(33.33%)	5	NA	NA
AVI64460.1|86823_87948_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D8EQE2	Escherichia_phage	28.8	3.1e-24
AVI64461.1|87954_88719_-	phosphatase	NA	NA	NA	NA	NA
AVI64462.1|88769_91991_-	helicase	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	29.1	1.3e-43
AVI64463.1|92253_94128_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
AVI64464.1|94694_94904_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	67.6	3.0e-18
>prophage 8
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	98163	103901	5266746	tRNA	Paramecium_bursaria_Chlorella_virus(33.33%)	3	NA	NA
AVI64467.1|98163_99603_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A7IXR9	Paramecium_bursaria_Chlorella_virus	26.0	1.4e-05
AVI64468.1|99644_103118_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	35.4	3.8e-190
AVI64469.1|103268_103901_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	40.1	8.6e-24
>prophage 9
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	114169	114997	5266746		Flavobacterium_phage(100.0%)	1	NA	NA
AVI64478.1|114169_114997_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	37.8	2.0e-20
>prophage 10
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	124980	127494	5266746		Synechococcus_phage(50.0%)	2	NA	NA
AVI68588.1|124980_125847_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	36.3	5.5e-13
AVI64487.1|126012_127494_-	PTS glucose transporter subunit IIBC	NA	A0A2I7SAJ6	Vibrio_phage	43.7	1.6e-07
>prophage 11
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	136716	140710	5266746		Vibrio_phage(50.0%)	3	NA	NA
AVI64500.1|136716_137574_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	36.6	4.1e-37
AVI64501.1|137656_138598_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVI64502.1|138721_140710_+	MBL fold metallo-hydrolase	NA	M1I0S7	Paramecium_bursaria_Chlorella_virus	39.0	1.8e-112
>prophage 12
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	143898	151995	5266746		Paenibacillus_phage(100.0%)	1	NA	NA
AVI64505.1|143898_151995_+	beta-ketoacyl synthase	NA	D0R7J2	Paenibacillus_phage	32.5	2.9e-15
>prophage 13
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	162878	164558	5266746		Catovirus(100.0%)	1	NA	NA
AVI64511.1|162878_164558_+	hypothetical protein	NA	A0A1V0SBJ0	Catovirus	25.1	8.5e-10
>prophage 14
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	175237	176782	5266746		Cyanophage(100.0%)	1	NA	NA
AVI64519.1|175237_176782_+	tryptophan halogenase	NA	M4SQD7	Cyanophage	30.9	4.1e-51
>prophage 15
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	189300	190974	5266746		Bordetella_phage(100.0%)	1	NA	NA
AVI64526.1|189300_190974_-	diguanylate cyclase	NA	A0A2D0WBV8	Bordetella_phage	47.1	1.5e-06
>prophage 16
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	194972	195458	5266746		Molluscum_contagiosum_virus(100.0%)	1	NA	NA
AVI64531.1|194972_195458_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	35.9	3.1e-13
>prophage 17
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	200393	204823	5266746		Bacillus_phage(66.67%)	4	NA	NA
AVI64534.1|200393_201692_-	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.0	2.2e-26
AVI64535.1|201772_202462_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	38.9	7.4e-37
AVI64536.1|202648_203614_-	porin	NA	NA	NA	NA	NA
AVI64537.1|203908_204823_+	recombination-associated protein RdgC	NA	A0A088C419	Shewanella_sp._phage	58.1	1.8e-86
>prophage 18
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	209253	213050	5266746		Bacillus_phage(50.0%)	3	NA	NA
AVI64540.1|209253_210810_+	deoxycytidylate deaminase	NA	A0A127AWB9	Bacillus_phage	36.7	1.0e-17
AVI64541.1|210866_212222_+	LOG family protein	NA	NA	NA	NA	NA
AVI64542.1|212243_213050_+	flap endonuclease Xni	NA	L7TSA2	Rhizobium_phage	29.5	5.9e-17
>prophage 19
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	239710	240889	5266746		Pseudomonas_phage(100.0%)	1	NA	NA
AVI64563.1|239710_240889_+	ATPase	NA	A0A1Y0SVM5	Pseudomonas_phage	30.2	1.8e-35
>prophage 20
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	250358	254954	5266746		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	2	NA	NA
AVI64572.1|250358_251777_-	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.4	1.5e-55
AVI64573.1|251906_254954_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	37.5	3.2e-23
>prophage 21
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	258261	260796	5266746		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AVI64576.1|258261_260796_-	glycogen phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	1.8e-16
>prophage 22
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	268366	334931	5266746	holin,integrase,portal,transposase	Vibrio_phage(22.22%)	50	252144:252161	332421:332438
252144:252161	attL	AAAAGATTGATCAATTTT	NA	NA	NA	NA
AVI64578.1|268366_268996_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	34.9	4.7e-14
AVI64579.1|269083_269560_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVI64580.1|269662_270367_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64581.1|270381_271599_-|holin	choline transporter	holin	NA	NA	NA	NA
AVI64582.1|271970_273656_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	28.4	1.4e-49
AVI64583.1|273665_275129_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVI64584.1|276326_277475_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
AVI64585.1|278324_278690_+	cytoplasmic protein	NA	NA	NA	NA	NA
AVI64586.1|278978_279185_+	hypothetical protein	NA	NA	NA	NA	NA
AVI68595.1|279265_279634_-	acyl-CoA thioesterase	NA	A0A292GK23	Xanthomonas_phage	55.6	1.1e-31
AVI64587.1|280168_281494_-	isocitrate lyase	NA	NA	NA	NA	NA
AVI64588.1|281634_283284_-	malate synthase A	NA	NA	NA	NA	NA
AVI64589.1|284123_286589_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AVI64590.1|286681_288451_-|portal	portal protein	portal	NA	NA	NA	NA
AVI64591.1|288782_290516_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AVI64592.1|290579_290792_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64593.1|290850_291642_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68596.1|292070_292562_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AVI64594.1|292651_292984_-	RnfH family protein	NA	NA	NA	NA	NA
AVI64595.1|292973_293411_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AVI64596.1|293689_294181_+	SsrA-binding protein	NA	NA	NA	NA	NA
AVI64597.1|294876_296124_+|integrase	integrase	integrase	A0A1V0E8G8	Vibrio_phage	49.9	1.2e-114
AVI64598.1|296425_296677_+	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
AVI64599.1|297422_300953_-	DNA helicase	NA	NA	NA	NA	NA
AVI64600.1|301407_301656_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVI64601.1|301852_302044_+	hypothetical protein	NA	NA	NA	NA	NA
AVI64602.1|302168_302489_+	hypothetical protein	NA	NA	NA	NA	NA
AVI64603.1|302663_303560_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64604.1|303654_305193_-	DNA methyltransferase	NA	NA	NA	NA	NA
AVI64605.1|305465_306341_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64606.1|306337_308092_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AVI64607.1|308091_309861_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	38.1	6.2e-11
AVI64608.1|309857_312707_-	restriction endonuclease subunit R	NA	NA	NA	NA	NA
AVI64609.1|313184_313385_-	transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	55.9	1.8e-12
AVI68597.1|313910_314372_+	hypothetical protein	NA	NA	NA	NA	NA
AVI64610.1|314419_314782_+	hypothetical protein	NA	NA	NA	NA	NA
AVI64611.1|315450_315864_+	hypothetical protein	NA	NA	NA	NA	NA
AVI68598.1|315986_316547_+|integrase	site-specific integrase	integrase	A0A141E0P1	Streptococcus_phage	34.6	6.1e-21
AVI64612.1|316641_317028_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64613.1|317103_317766_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64614.1|317921_318764_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64615.1|318784_319123_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64616.1|319169_319874_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64617.1|319873_325549_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64618.1|325524_326931_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64619.1|327355_328015_-|transposase	transposase	transposase	NA	NA	NA	NA
AVI64620.1|328391_329765_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64621.1|329911_330526_+	hypothetical protein	NA	NA	NA	NA	NA
AVI64622.1|330872_332111_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.8e-49
AVI64623.1|332210_334931_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	33.9	1.6e-21
332421:332438	attR	AAAAGATTGATCAATTTT	NA	NA	NA	NA
>prophage 23
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	348209	349778	5266746		Salmonella_phage(100.0%)	1	NA	NA
AVI64635.1|348209_349778_-	chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	49.7	4.2e-35
>prophage 24
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	372257	373553	5266746		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVI64652.1|372257_373553_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	34.8	1.3e-26
>prophage 25
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	378386	379478	5266746		Klebsiella_phage(100.0%)	1	NA	NA
AVI64657.1|378386_379478_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	47.5	2.3e-80
>prophage 26
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	389551	395967	5266746		Tupanvirus(33.33%)	7	NA	NA
AVI64670.1|389551_390232_-	ribonuclease 3	NA	A0A2K9L8W0	Tupanvirus	30.8	9.6e-21
AVI64671.1|390233_391151_-	signal peptidase I	NA	NA	NA	NA	NA
AVI64672.1|391334_393125_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.6	2.9e-24
AVI64673.1|393291_393765_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AVI64674.1|393775_394708_-	MucB/RseB	NA	NA	NA	NA	NA
AVI64675.1|394720_395347_-	anti-sigma factor	NA	NA	NA	NA	NA
AVI64676.1|395388_395967_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	24.7	3.7e-05
>prophage 27
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	399966	405991	5266746		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
AVI64682.1|399966_401136_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.0	1.8e-91
AVI64683.1|401253_402048_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	68.9	7.6e-110
AVI64684.1|402044_402854_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AVI64685.1|402896_403697_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64686.1|403756_405991_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	27.3	4.9e-13
>prophage 28
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	423855	425262	5266746		Arthrobacter_phage(100.0%)	1	NA	NA
AVI64701.1|423855_425262_+	peptidase M23	NA	V5R8R0	Arthrobacter_phage	45.6	1.5e-12
>prophage 29
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	428659	432820	5266746		Lake_Baikal_phage(50.0%)	3	NA	NA
AVI64706.1|428659_429010_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	52.3	1.6e-27
AVI64707.1|429002_429806_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64708.1|431800_432820_+	aspartate carbamoyltransferase	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	35.6	3.5e-43
>prophage 30
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	437377	440480	5266746		Burkholderia_phage(50.0%)	2	NA	NA
AVI64712.1|437377_439051_-	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	26.5	8.7e-07
AVI64713.1|439229_440480_+	multifunctional CCA addition/repair protein	NA	S5MVS8	Sinorhizobium_phage	48.5	2.8e-90
>prophage 31
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	445269	460703	5266746	integrase,tRNA	Moraxella_phage(12.5%)	15	451235:451281	458293:458339
AVI64720.1|445269_446286_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	60.3	1.7e-114
AVI64721.1|446501_446717_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVI64722.1|446723_447167_+|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	46.9	4.2e-25
AVI64723.1|447250_448975_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	32.0	2.7e-43
AVI64724.1|449110_450949_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.1	4.1e-34
451235:451281	attL	GACTCATAATCGTTAGGTCCACGGTTCAAGTCCGTGAGGGGCCACCA	NA	NA	NA	NA
AVI64725.1|451451_451814_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	66.7	9.3e-39
AVI64726.1|451861_452284_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64727.1|453062_453392_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64728.1|453491_454640_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64729.1|454639_455557_-	hypothetical protein	NA	A0A1W6JPG0	Morganella_phage	35.7	9.9e-37
AVI64730.1|455549_455918_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64731.1|455910_456117_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AVI64732.1|456200_456797_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68601.1|456786_458100_-|integrase	integrase	integrase	A0A248SL35	Klebsiella_phage	31.2	3.5e-43
AVI64733.1|458582_460703_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.6	6.0e-21
458293:458339	attR	GACTCATAATCGTTAGGTCCACGGTTCAAGTCCGTGAGGGGCCACCA	NA	NA	NA	NA
>prophage 32
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	465501	466779	5266746		Klosneuvirus(100.0%)	1	NA	NA
AVI64737.1|465501_466779_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.7	1.1e-28
>prophage 33
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	471573	472710	5266746		Bacillus_virus(100.0%)	1	NA	NA
AVI64742.1|471573_472710_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.6	1.4e-27
>prophage 34
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	481257	481671	5266746		Sinorhizobium_phage(100.0%)	1	NA	NA
AVI64750.1|481257_481671_-	septal ring lytic transglycosylase RlpA family lipoprotein	NA	A0A0F6SJ38	Sinorhizobium_phage	44.4	3.0e-17
>prophage 35
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	498930	500418	5266746		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVI64763.1|498930_500418_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.4	1.0e-30
>prophage 36
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	503677	505201	5266746		Synechococcus_phage(100.0%)	1	NA	NA
AVI64767.1|503677_505201_-	tryptophan halogenase	NA	A0A1Z1LWL6	Synechococcus_phage	31.1	7.8e-55
>prophage 37
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	521120	524911	5266746	tRNA	Megavirus(50.0%)	2	NA	NA
AVI64783.1|521120_523943_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.1	1.2e-80
AVI64784.1|523975_524911_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SD03	Indivirus	32.8	3.5e-05
>prophage 38
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	535773	536730	5266746		Cyanophage(100.0%)	1	NA	NA
AVI64792.1|535773_536730_+	transaldolase	NA	A0A1D7SEQ4	Cyanophage	30.5	4.7e-13
>prophage 39
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	543346	545871	5266746		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVI64799.1|543346_545110_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.5	1.2e-30
AVI64800.1|545379_545871_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.7	1.9e-18
>prophage 40
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	568929	571503	5266746		Enterobacteria_phage(100.0%)	1	NA	NA
AVI64813.1|568929_571503_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.1	1.9e-122
>prophage 41
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	575062	576688	5266746		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVI64817.1|575062_576688_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.6	7.6e-24
>prophage 42
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	586490	590587	5266746		Bacillus_phage(66.67%)	5	NA	NA
AVI64830.1|586490_587204_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.0	4.2e-35
AVI64831.1|587215_588484_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.2	3.0e-15
AVI64832.1|588595_588901_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
AVI64833.1|589077_589614_+	hypothetical protein	NA	NA	NA	NA	NA
AVI64834.1|589708_590587_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	42.0	4.7e-52
>prophage 43
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	593712	597504	5266746		Planktothrix_phage(50.0%)	3	NA	NA
AVI64838.1|593712_594843_+	sulfate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.1e-32
AVI64839.1|595221_595857_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64840.1|595992_597504_-	ATPase	NA	U5XGM6	Phormidium_phage	38.5	2.3e-67
>prophage 44
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	606513	607467	5266746		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
AVI64847.1|606513_607467_-	glycerate dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	32.8	2.0e-24
>prophage 45
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	617021	621316	5266746		Bordetella_phage(33.33%)	4	NA	NA
AVI64858.1|617021_617846_+	bis(5'-nucleosyl)-tetraphosphatase	NA	A0A291L9W7	Bordetella_phage	48.4	8.7e-08
AVI64859.1|617943_619965_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	2.0e-26
AVI64860.1|620200_620614_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64861.1|620833_621316_-	type 3 dihydrofolate reductase	NA	A0A1Q2U372	Vibrio_phage	45.8	2.3e-29
>prophage 46
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	624815	631958	5266746		Indivirus(33.33%)	7	NA	NA
AVI64867.1|624815_625811_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	24.8	8.9e-07
AVI68605.1|625893_626550_-	uracil-DNA glycosylase	NA	A0A0B4Q626	Equid_gammaherpesvirus	44.0	1.1e-48
AVI64868.1|626746_627310_+	pilin	NA	NA	NA	NA	NA
AVI64869.1|627384_627705_+	hypothetical protein	NA	NA	NA	NA	NA
AVI64870.1|627797_628412_-	lysine transporter LysE	NA	NA	NA	NA	NA
AVI64871.1|628688_629240_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AVI64872.1|629381_631958_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	22.5	8.7e-14
>prophage 47
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	635950	639594	5266746		Staphylococcus_phage(50.0%)	2	NA	NA
AVI64874.1|635950_637552_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	7.0e-30
AVI64875.1|637689_639594_-	ABC transporter permease	NA	W8CYL7	Bacillus_phage	30.7	1.6e-60
>prophage 48
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	647787	656026	5266746		Anomala_cuprea_entomopoxvirus(33.33%)	8	NA	NA
AVI64883.1|647787_648627_+	heme ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.8	1.6e-09
AVI64884.1|648741_649086_+	hypothetical protein	NA	NA	NA	NA	NA
AVI68608.1|649132_649453_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64885.1|649803_649902_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64886.1|650266_651805_-	peptidase M17	NA	Q6GYZ8	Mycoplasma_phage	29.6	3.1e-19
AVI64887.1|652024_653485_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
AVI64888.1|653729_654284_+	hypothetical protein	NA	NA	NA	NA	NA
AVI64889.1|654379_656026_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.9	7.2e-30
>prophage 49
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	673008	673623	5266746		Tokyovirus(100.0%)	1	NA	NA
AVI64905.1|673008_673623_-	2OG-Fe(II) oxygenase	NA	A0A146JHL3	Tokyovirus	37.6	2.7e-22
>prophage 50
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	678334	679633	5266746		Pandoravirus(100.0%)	1	NA	NA
AVI64907.1|678334_679633_-	O-acetylhomoserine aminocarboxypropyltransferase	NA	A0A0B5JD48	Pandoravirus	25.2	5.4e-12
>prophage 51
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	687825	689457	5266746		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVI64915.1|687825_689457_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.0	4.7e-21
>prophage 52
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	709640	711116	5266746		Tupanvirus(100.0%)	1	NA	NA
AVI64931.1|709640_711116_-	catalase	NA	A0A2K9L0T1	Tupanvirus	46.9	8.9e-96
>prophage 53
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	718273	727739	5266746		Caulobacter_phage(33.33%)	6	NA	NA
AVI68611.1|718273_718831_+	peptide deformylase	NA	K4JRM9	Caulobacter_phage	34.5	2.2e-15
AVI64938.1|718830_720234_+	hypothetical protein	NA	NA	NA	NA	NA
AVI64939.1|720291_720897_+	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
AVI64940.1|721153_723787_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	29.6	5.9e-50
AVI64941.1|724284_726177_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
AVI64942.1|726311_727739_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	37.4	7.4e-23
>prophage 54
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	740404	744373	5266746	transposase,tRNA	Paenibacillus_phage(50.0%)	3	NA	NA
AVI64950.1|740404_741163_-|transposase	IS5 family transposase ISSod6	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.4	7.9e-16
AVI64951.1|742186_742627_+	hypothetical protein	NA	NA	NA	NA	NA
AVI64952.1|742870_744373_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	38.9	3.1e-88
>prophage 55
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	753596	754769	5266746		Erysipelothrix_phage(100.0%)	1	NA	NA
AVI64956.1|753596_754769_-	23S rRNA (uracil(747)-C(5))-methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	29.0	3.3e-21
>prophage 56
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	761129	768595	5266746		Lactobacillus_phage(33.33%)	5	NA	NA
AVI64965.1|761129_762923_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	35.3	3.5e-62
AVI64966.1|763181_764171_+	2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	44.2	1.5e-62
AVI64967.1|764239_764977_+	dienelactone hydrolase	NA	NA	NA	NA	NA
AVI68614.1|765151_765556_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64968.1|765880_768595_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	25.9	7.0e-38
>prophage 57
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	771872	780552	5266746		Mycoplasma_phage(25.0%)	8	NA	NA
AVI64973.1|771872_773408_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.9	1.8e-51
AVI64974.1|773765_774335_+	peroxiredoxin	NA	NA	NA	NA	NA
AVI64975.1|774496_776068_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	30.9	2.4e-38
AVI64976.1|776135_776576_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVI64977.1|776610_776940_-	hypothetical protein	NA	NA	NA	NA	NA
AVI64978.1|776963_778688_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.6	1.2e-54
AVI64979.1|778782_779508_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AVI64980.1|779649_780552_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.3	3.3e-29
>prophage 58
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	783566	784826	5266746		Klosneuvirus(100.0%)	1	NA	NA
AVI64983.1|783566_784826_+	ATP-dependent RNA helicase SrmB	NA	A0A1V0SIR5	Klosneuvirus	31.9	1.8e-49
>prophage 59
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	806520	811270	5266746		Staphylococcus_phage(50.0%)	3	NA	NA
AVI64997.1|806520_807672_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	64.0	1.9e-130
AVI68615.1|807828_808314_+	hypothetical protein	NA	NA	NA	NA	NA
AVI64998.1|808855_811270_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	36.4	4.3e-15
>prophage 60
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	840648	849381	5266746		Bacillus_phage(25.0%)	8	NA	NA
AVI65026.1|840648_841353_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	39.2	5.8e-37
AVI65027.1|841354_841744_-	DUF3019 domain-containing protein	NA	NA	NA	NA	NA
AVI68617.1|841753_842593_-	structural protein MipA	NA	NA	NA	NA	NA
AVI65028.1|842872_844573_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.7	8.3e-21
AVI68618.1|844920_846270_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	41.1	6.2e-88
AVI65029.1|846335_846782_+	Fe-S metabolism protein SufE	NA	NA	NA	NA	NA
AVI68619.1|846964_848125_+	peptidase M19	NA	NA	NA	NA	NA
AVI65030.1|848208_849381_+	ATP-binding protein	NA	A0A077SLJ9	Escherichia_phage	38.3	8.7e-70
>prophage 61
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	852729	855222	5266746	protease	Microbacterium_phage(50.0%)	2	NA	NA
AVI65032.1|852729_853104_-	helicase	NA	A6N235	Microbacterium_phage	37.8	2.1e-09
AVI65033.1|853305_855222_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	26.3	8.4e-22
>prophage 62
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	861577	863250	5266746		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
AVI65037.1|861577_862516_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.1	1.2e-21
AVI65038.1|862719_863250_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	32.3	3.5e-10
>prophage 63
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	870161	870746	5266746		Catovirus(100.0%)	1	NA	NA
AVI65046.1|870161_870746_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	28.8	1.0e-07
>prophage 64
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	875656	880650	5266746		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
AVI65053.1|875656_876970_+	ammonia channel protein	NA	H8ZJB2	Ostreococcus_tauri_virus	34.6	1.3e-45
AVI65054.1|877059_878580_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AVI65055.1|878740_879613_-	multidrug transporter	NA	NA	NA	NA	NA
AVI65056.1|879801_880650_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	44.1	5.0e-51
>prophage 65
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	884815	885907	5266746		Pseudomonas_phage(100.0%)	1	NA	NA
AVI65062.1|884815_885907_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	39.2	3.9e-08
>prophage 66
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	889038	892048	5266746		Tupanvirus(50.0%)	2	NA	NA
AVI65066.1|889038_889986_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	1.9e-43
AVI65067.1|890185_892048_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.6	1.6e-33
>prophage 67
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	896275	905991	5266746		Cafeteria_roenbergensis_virus(33.33%)	8	NA	NA
AVI65072.1|896275_898360_+	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	33.5	1.1e-94
AVI65073.1|898565_899351_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AVI65074.1|899524_899932_+	cell wall assembly protein	NA	NA	NA	NA	NA
AVI65075.1|899962_900463_+	hypothetical protein	NA	NA	NA	NA	NA
AVI65076.1|900591_903177_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.4	1.4e-51
AVI65077.1|903419_903959_+	hypothetical protein	NA	NA	NA	NA	NA
AVI65078.1|904110_905385_+	hypothetical protein	NA	NA	NA	NA	NA
AVI65079.1|905520_905991_+	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	45.3	4.4e-33
>prophage 68
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	909227	911150	5266746		Bacillus_phage(100.0%)	1	NA	NA
AVI65083.1|909227_911150_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.6	2.0e-18
>prophage 69
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	934162	937919	5266746		Pandoravirus(66.67%)	4	NA	NA
AVI65101.1|934162_935080_+	lipase	NA	A0A0B5J003	Pandoravirus	30.2	4.3e-16
AVI65102.1|935163_935943_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AVI65103.1|936158_936629_-	cupin	NA	A0A291ATU0	Pandoravirus	38.2	1.7e-16
AVI65104.1|937010_937919_+	deoxycytidine triphosphate deaminase	NA	A0A127AWB9	Bacillus_phage	33.9	3.3e-16
>prophage 70
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	946843	948040	5266746	tRNA	Klosneuvirus(100.0%)	1	NA	NA
AVI65114.1|946843_948040_-|tRNA	threonine--tRNA ligase	tRNA	A0A1V0SKZ9	Klosneuvirus	36.6	5.5e-80
>prophage 71
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	958355	961244	5266746		Prochlorococcus_phage(100.0%)	1	NA	NA
AVI65121.1|958355_961244_-	glycine dehydrogenase (aminomethyl-transferring)	NA	E3SN07	Prochlorococcus_phage	51.4	1.1e-264
>prophage 72
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	976378	977458	5266746		Bacillus_virus(100.0%)	1	NA	NA
AVI65136.1|976378_977458_-	ABC transporter	NA	G3M9Y6	Bacillus_virus	35.4	1.3e-27
>prophage 73
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	986151	993196	5266746		Bacillus_phage(33.33%)	6	NA	NA
AVI65147.1|986151_987948_-	metal ABC transporter permease	NA	W8CYL7	Bacillus_phage	27.9	1.6e-43
AVI65148.1|988420_988597_+	hypothetical protein	NA	NA	NA	NA	NA
AVI65149.1|988700_989756_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	47.2	6.2e-83
AVI65150.1|990107_991301_-	hypothetical protein	NA	NA	NA	NA	NA
AVI65151.1|991428_991767_-	hypothetical protein	NA	NA	NA	NA	NA
AVI65152.1|991945_993196_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	36.2	2.7e-53
>prophage 74
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1007722	1008715	5266746		Klosneuvirus(100.0%)	1	NA	NA
AVI65165.1|1007722_1008715_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	36.1	1.1e-44
>prophage 75
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1037064	1039614	5266746		Saudi_moumouvirus(100.0%)	1	NA	NA
AVI68628.1|1037064_1039614_-	ATP-dependent helicase HrpB	NA	A0A1S5V1F0	Saudi_moumouvirus	26.2	2.1e-36
>prophage 76
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1050821	1053259	5266746		Klosneuvirus(50.0%)	2	NA	NA
AVI65196.1|1050821_1052039_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.2	2.0e-21
AVI65197.1|1052347_1053259_-	alpha/beta hydrolase	NA	A0A2P1EM31	Moumouvirus	27.9	1.4e-14
>prophage 77
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1057324	1058526	5266746	protease	Acinetobacter_phage(50.0%)	2	NA	NA
AVI65200.1|1057324_1057909_-	anthranilate/aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	7.4e-54
AVI65201.1|1058088_1058526_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.5	1.3e-23
>prophage 78
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1066812	1070194	5266746		Wolbachia_phage(50.0%)	2	NA	NA
AVI65211.1|1066812_1068726_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	39.9	5.2e-56
AVI65212.1|1068739_1070194_-	N-acetylmuramoyl-L-alanine amidase	NA	M1HNA7	Bacillus_virus	24.1	3.1e-16
>prophage 79
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1074376	1074922	5266746		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVI65216.1|1074376_1074922_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	2.9e-28
>prophage 80
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1083394	1100043	5266746	protease	Salmonella_phage(20.0%)	9	NA	NA
AVI65222.1|1083394_1084969_-	chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	55.5	8.4e-44
AVI65223.1|1085230_1085422_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
AVI65224.1|1085677_1086334_-	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
AVI65225.1|1086436_1086778_-	hypothetical protein	NA	NA	NA	NA	NA
AVI65226.1|1087027_1088836_+	serine/threonine protein kinase	NA	Q06KB7	Anticarsia_gemmatalis_multiple_nucleopolyhedrovirus	27.2	1.0e-08
AVI65227.1|1088856_1091265_-|protease	metalloprotease	protease	NA	NA	NA	NA
AVI65228.1|1091403_1095120_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	34.4	4.4e-67
AVI65229.1|1095335_1096730_-	ribonuclease	NA	A0A2I7SAD7	Vibrio_phage	43.7	4.9e-104
AVI65230.1|1097136_1100043_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	40.4	6.8e-23
>prophage 81
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1103553	1104528	5266746		Bacillus_phage(100.0%)	1	NA	NA
AVI65234.1|1103553_1104528_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.3	1.5e-19
>prophage 82
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1122399	1130067	5266746		Bacillus_thuringiensis_phage(25.0%)	8	NA	NA
AVI65253.1|1122399_1123197_+	two-component system response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	1.9e-07
AVI65254.1|1123356_1123629_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	52.8	8.0e-19
AVI65255.1|1123608_1123923_-	hypothetical protein	NA	NA	NA	NA	NA
AVI65256.1|1123921_1124614_+	hypothetical protein	NA	NA	NA	NA	NA
AVI65257.1|1124673_1125579_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D8KN85	Synechococcus_phage	37.1	4.8e-36
AVI65258.1|1125757_1127473_-	GGDEF domain-containing response regulator	NA	NA	NA	NA	NA
AVI65259.1|1127482_1127917_-	two-component system response regulator	NA	NA	NA	NA	NA
AVI65260.1|1127913_1130067_-	histidine kinase	NA	A0A1V0S925	Catovirus	26.8	8.6e-07
>prophage 83
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1144216	1147441	5266746		Leptospira_phage(100.0%)	1	NA	NA
AVI65274.1|1144216_1147441_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	23.4	8.5e-67
>prophage 84
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1155676	1156435	5266746	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
AVI65285.1|1155676_1156435_-|transposase	IS5 family transposase ISSod6	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.4	7.9e-16
>prophage 85
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1165942	1171697	5266746		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
AVI65293.1|1165942_1168057_-	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.1	1.3e-55
AVI65294.1|1168282_1169566_-	CadC family transcriptional regulator	NA	NA	NA	NA	NA
AVI65295.1|1169787_1170660_-	copper ABC transporter permease	NA	NA	NA	NA	NA
AVI65296.1|1170656_1171697_-	ABC transporter	NA	A0A2H4PQG7	Staphylococcus_phage	33.3	1.1e-23
>prophage 86
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1181567	1182146	5266746		Shewanella_sp._phage(100.0%)	1	NA	NA
AVI65306.1|1181567_1182146_+	SAM-dependent methyltransferase	NA	A0A088C537	Shewanella_sp._phage	42.4	3.1e-36
>prophage 87
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1191940	1194109	5266746		Bacillus_phage(100.0%)	1	NA	NA
AVI65316.1|1191940_1194109_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	4.3e-115
>prophage 88
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1199433	1200930	5266746		Klebsiella_phage(100.0%)	1	NA	NA
AVI65324.1|1199433_1200930_+	ATP-binding protein	NA	A0A248XCZ8	Klebsiella_phage	46.5	3.1e-88
>prophage 89
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1210352	1212465	5266746		Bacillus_virus(50.0%)	3	NA	NA
AVI65333.1|1210352_1211330_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.2	4.8e-13
AVI65334.1|1211472_1211808_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AVI65335.1|1212042_1212465_+	thiol disulfide reductase thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	33.3	6.2e-10
>prophage 90
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1219785	1221384	5266746		Prochlorococcus_phage(100.0%)	1	NA	NA
AVI65342.1|1219785_1221384_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.6	2.6e-69
>prophage 91
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1227465	1230045	5266746		Bacillus_virus(100.0%)	1	NA	NA
AVI65347.1|1227465_1230045_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	28.8	3.0e-14
>prophage 92
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1243194	1254198	5266746		Cafeteria_roenbergensis_virus(25.0%)	4	NA	NA
AVI65354.1|1243194_1245237_-	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	33.0	5.2e-86
AVI68634.1|1245465_1247679_-	patatin	NA	A0A1V0SFX9	Hokovirus	28.0	1.8e-07
AVI68635.1|1247897_1252370_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	36.9	7.0e-27
AVI65355.1|1252770_1254198_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.5	6.2e-46
>prophage 93
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1261118	1261682	5266746		Agrobacterium_phage(100.0%)	1	NA	NA
AVI65360.1|1261118_1261682_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A223VZK2	Agrobacterium_phage	30.3	1.0e-07
>prophage 94
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1274007	1275803	5266746		Catovirus(50.0%)	2	NA	NA
AVI65373.1|1274007_1275324_-	ATP-dependent RNA helicase RhlB	NA	A0A1V0SBR7	Catovirus	30.4	8.9e-47
AVI65374.1|1275476_1275803_+	thiol reductase thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	45.7	2.4e-17
>prophage 95
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1296581	1300325	5266746		Gordonia_phage(50.0%)	4	NA	NA
AVI65394.1|1296581_1297493_-	tyrosine recombinase XerC	NA	A0A166YH27	Gordonia_phage	31.7	1.1e-14
AVI65395.1|1297550_1298180_-	hypothetical protein	NA	NA	NA	NA	NA
AVI65396.1|1298176_1299004_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
AVI65397.1|1299080_1300325_-	diaminopimelate decarboxylase	NA	M1HHL1	Acanthocystis_turfacea_Chlorella_virus	26.0	3.1e-17
>prophage 96
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1321302	1323480	5266746		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVI65406.1|1321302_1323480_+	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.2	2.7e-24
>prophage 97
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1333184	1335197	5266746		Bacillus_phage(100.0%)	1	NA	NA
AVI65412.1|1333184_1335197_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	39.6	6.4e-121
>prophage 98
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1353755	1355414	5266746		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVI65430.1|1353755_1355414_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	33.3	1.5e-62
>prophage 99
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1360956	1362741	5266746		Bacillus_phage(100.0%)	1	NA	NA
AVI68639.1|1360956_1362741_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.7	5.1e-13
>prophage 100
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1377499	1382038	5266746		Bacillus_phage(100.0%)	1	NA	NA
AVI65446.1|1377499_1382038_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.7	9.6e-16
>prophage 101
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1385583	1387038	5266746		Microcystis_phage(100.0%)	1	NA	NA
AVI65449.1|1385583_1387038_-	hypothetical protein	NA	A0A075BSJ0	Microcystis_phage	36.6	5.6e-50
>prophage 102
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1391374	1393751	5266746		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
AVI65456.1|1391374_1392229_-	universal stress protein UspA	NA	A0A2H4J154	uncultured_Caudovirales_phage	49.3	4.1e-69
AVI65457.1|1392260_1393751_-	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	81.6	2.1e-222
>prophage 103
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1397752	1408449	5266746		uncultured_Caudovirales_phage(57.14%)	7	NA	NA
AVI65461.1|1397752_1398100_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.5	1.1e-31
AVI65462.1|1398457_1399741_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.4	1.4e-169
AVI65463.1|1399819_1400263_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.8	4.0e-44
AVI68641.1|1400280_1400982_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	76.1	3.0e-94
AVI65464.1|1401140_1404248_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.7	1.2e-20
AVI65465.1|1404536_1405793_-	response regulator	NA	W8CYM9	Bacillus_phage	27.3	8.0e-05
AVI65466.1|1405779_1408449_-	hypothetical protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	29.2	1.9e-16
>prophage 104
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1413618	1413969	5266746		Vibrio_phage(100.0%)	1	NA	NA
AVI65471.1|1413618_1413969_-	hypothetical protein	NA	A0A2I7S9Z5	Vibrio_phage	42.5	2.3e-10
>prophage 105
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1424737	1427137	5266746		Pseudomonas_phage(100.0%)	1	NA	NA
AVI65480.1|1424737_1427137_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.5e-100
>prophage 106
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1434534	1438392	5266746		Streptococcus_phage(50.0%)	4	NA	NA
AVI65489.1|1434534_1435377_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	41.0	1.4e-45
AVI65490.1|1435465_1437367_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
AVI65491.1|1437363_1437690_+	YraN family protein	NA	NA	NA	NA	NA
AVI65492.1|1437798_1438392_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	33.8	1.1e-15
>prophage 107
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1444236	1445076	5266746		Vibrio_phage(100.0%)	1	NA	NA
AVI65501.1|1444236_1445076_-	DNA adenine methylase	NA	A0A1S6L1V5	Vibrio_phage	48.0	8.1e-70
>prophage 108
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1465497	1466772	5266746		Pseudomonas_phage(100.0%)	1	NA	NA
AVI65517.1|1465497_1466772_-	damage-inducible protein CinA	NA	B5TK85	Pseudomonas_phage	39.3	2.9e-18
>prophage 109
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1489461	1491045	5266746		Salmonella_phage(100.0%)	1	NA	NA
AVI65531.1|1489461_1491045_+	chemotaxis protein	NA	A0A1B0VAH3	Salmonella_phage	34.5	1.6e-05
>prophage 110
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1498068	1500069	5266746		Acinetobacter_phage(100.0%)	1	NA	NA
AVI65537.1|1498068_1500069_-	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	34.6	3.4e-13
>prophage 111
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1507634	1510441	5266746		Moumouvirus(50.0%)	2	NA	NA
AVI65544.1|1507634_1509113_-	peptidase M16	NA	A0A2P1EL85	Moumouvirus	19.5	3.8e-14
AVI65545.1|1509109_1510441_-	peptidase M16	NA	L7RBE7	Acanthamoeba_polyphaga_moumouvirus	25.8	5.5e-20
>prophage 112
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1514196	1519012	5266746	transposase	Paenibacillus_phage(50.0%)	4	NA	NA
AVI65550.1|1514196_1514955_-|transposase	IS5 family transposase ISSod6	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.4	7.9e-16
AVI65551.1|1515459_1516122_-	methyltransferase	NA	NA	NA	NA	NA
AVI68646.1|1516227_1516566_-	hypothetical protein	NA	NA	NA	NA	NA
AVI65552.1|1516891_1519012_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	38.0	1.9e-19
>prophage 113
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1523072	1524944	5266746		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVI65558.1|1523072_1524944_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	55.0	4.5e-20
>prophage 114
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1544155	1547755	5266746		Hokovirus(100.0%)	1	NA	NA
AVI65578.1|1544155_1547755_+	histidine kinase	NA	A0A1V0SGX0	Hokovirus	31.5	1.2e-42
>prophage 115
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1571159	1573921	5266746		Salicola_phage(50.0%)	3	NA	NA
AVI65599.1|1571159_1572017_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.8	3.4e-47
AVI65600.1|1572242_1573208_-	cell division protein FtsX	NA	NA	NA	NA	NA
AVI65601.1|1573204_1573921_-	cell division ATP-binding protein FtsE	NA	A0A285PWH2	Cedratvirus	32.4	1.3e-15
>prophage 116
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1589825	1594496	5266746		Shigella_phage(50.0%)	4	NA	NA
AVI65614.1|1589825_1590446_+	repressor LexA	NA	Q8SBE8	Shigella_phage	42.2	2.2e-11
AVI65615.1|1590442_1590955_+	cell division protein	NA	NA	NA	NA	NA
AVI65616.1|1591358_1592894_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
AVI65617.1|1592903_1594496_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	38.8	2.5e-11
>prophage 117
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1605507	1610195	5266746		Lactobacillus_phage(50.0%)	4	NA	NA
AVI65629.1|1605507_1607256_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	28.8	1.9e-68
AVI65630.1|1607348_1608113_-	porin	NA	NA	NA	NA	NA
AVI65631.1|1608286_1609531_-	ATPase	NA	NA	NA	NA	NA
AVI65632.1|1609517_1610195_-	two-component system response regulator	NA	W8CYM9	Bacillus_phage	29.8	5.2e-19
>prophage 118
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1619046	1631390	5266746		Bacillus_phage(57.14%)	12	NA	NA
AVI65639.1|1619046_1619772_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	1.7e-31
AVI65640.1|1619814_1621131_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.1	3.5e-11
AVI65641.1|1621259_1623230_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.4	2.3e-14
AVI65642.1|1623267_1624560_-	hypothetical protein	NA	NA	NA	NA	NA
AVI65643.1|1624646_1625315_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	32.7	1.4e-24
AVI65644.1|1625286_1626552_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AVI65645.1|1626706_1627096_+	hypothetical protein	NA	NA	NA	NA	NA
AVI65646.1|1627167_1627641_-	peroxiredoxin	NA	M1I839	Pelagibacter_phage	47.4	5.5e-23
AVI65647.1|1627721_1628666_-	hypothetical protein	NA	NA	NA	NA	NA
AVI65648.1|1629032_1629335_+	peptidase M4	NA	NA	NA	NA	NA
AVI65649.1|1629337_1630033_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	1.4e-06
AVI65650.1|1630025_1631390_+	ATP-binding protein	NA	W8CYF6	Bacillus_phage	23.9	2.0e-09
>prophage 119
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1637073	1642384	5266746		Bacillus_virus(100.0%)	3	NA	NA
AVI65657.1|1637073_1638138_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.6	5.2e-29
AVI65658.1|1638162_1638639_-	cytoplasmic protein	NA	NA	NA	NA	NA
AVI65659.1|1638736_1642384_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	38.6	1.1e-25
>prophage 120
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1655500	1656148	5266746		Cedratvirus(100.0%)	1	NA	NA
AVI65670.1|1655500_1656148_-	antibiotic acetyltransferase	NA	A0A285PXQ2	Cedratvirus	33.3	3.3e-18
>prophage 121
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1660661	1661417	5266746		Bacillus_phage(100.0%)	1	NA	NA
AVI65674.1|1660661_1661417_-	lytic transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	58.6	4.6e-32
>prophage 122
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1683956	1686353	5266746		Streptococcus_phage(100.0%)	2	NA	NA
AVI65694.1|1683956_1685057_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	36.1	3.3e-47
AVI65695.1|1685105_1686353_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.5	4.2e-99
>prophage 123
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1690704	1696879	5266746		Leptospira_phage(50.0%)	5	NA	NA
AVI65699.1|1690704_1693872_+	acriflavin resistance protein	NA	S5VTK5	Leptospira_phage	23.4	5.2e-61
AVI65700.1|1693864_1694233_+	hypothetical protein	NA	NA	NA	NA	NA
AVI65701.1|1694229_1695819_+	peptidase	NA	NA	NA	NA	NA
AVI65702.1|1695815_1696142_+	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
AVI65703.1|1696459_1696879_-	peptide-binding protein	NA	A0A1L5C2A2	Pseudoalteromonas_phage	40.2	1.3e-15
>prophage 124
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1709731	1714603	5266746		Planktothrix_phage(50.0%)	4	NA	NA
AVI65713.1|1709731_1711102_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	29.5	7.4e-12
AVI65714.1|1711617_1712976_+	isochorismate synthase	NA	NA	NA	NA	NA
AVI65715.1|1712997_1713738_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVI65716.1|1713943_1714603_+	hypothetical protein	NA	A0A2I7SAW6	Vibrio_phage	59.7	1.6e-60
>prophage 125
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1720854	1721565	5266746		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVI65722.1|1720854_1721565_+	ABC transporter	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.6	6.3e-15
>prophage 126
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1725570	1728516	5266746		Bacillus_phage(50.0%)	3	NA	NA
AVI65727.1|1725570_1726386_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	29.9	4.8e-19
AVI65728.1|1726458_1727934_-	hypothetical protein	NA	NA	NA	NA	NA
AVI65729.1|1728024_1728516_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.3	2.6e-28
>prophage 127
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1738002	1745400	5266746	protease	Emiliania_huxleyi_virus(33.33%)	6	NA	NA
AVI65738.1|1738002_1739196_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.6	2.3e-38
AVI65739.1|1739218_1740244_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	1.2e-19
AVI65740.1|1740345_1740651_+	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
AVI65741.1|1740647_1741493_+|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
AVI65742.1|1741581_1742244_-	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AVI65743.1|1742631_1745400_+	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	32.3	1.4e-70
>prophage 128
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1784648	1787691	5266746		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVI65769.1|1784648_1785470_-	hypothetical protein	NA	A0A2H4J8H9	uncultured_Caudovirales_phage	44.4	7.5e-20
AVI65770.1|1785861_1787691_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	45.5	1.1e-138
>prophage 129
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1791105	1792470	5266746		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVI65773.1|1791105_1792470_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.0	2.9e-32
>prophage 130
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1799816	1801493	5266746		Leptospira_phage(50.0%)	2	NA	NA
AVI65783.1|1799816_1800695_-	chromosome partitioning protein ParB	NA	S5WII0	Leptospira_phage	36.7	3.1e-11
AVI65784.1|1800704_1801493_-	cobalamin biosynthesis protein CobQ	NA	Q8JL10	Natrialba_phage	36.4	1.9e-20
>prophage 131
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1810062	1817465	5266746		Staphylococcus_phage(33.33%)	7	NA	NA
AVI65790.1|1810062_1810317_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	59.7	8.2e-18
AVI65791.1|1810283_1810640_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AVI65792.1|1810655_1810793_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AVI65793.1|1811238_1812627_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AVI65794.1|1812646_1813747_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	33.2	4.2e-50
AVI65795.1|1813948_1815031_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AVI65796.1|1815047_1817465_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.7	1.4e-111
>prophage 132
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1831003	1831249	5266746		Dickeya_phage(100.0%)	1	NA	NA
AVI65809.1|1831003_1831249_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	86.1	8.0e-10
>prophage 133
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1838012	1838627	5266746		Streptococcus_phage(100.0%)	1	NA	NA
AVI65814.1|1838012_1838627_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	34.4	6.0e-22
>prophage 134
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1846046	1944808	5266746	integrase,transposase,protease,tRNA	Prochlorococcus_phage(12.5%)	64	1908790:1908814	1968808:1968832
AVI65822.1|1846046_1847003_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	42.4	9.1e-09
AVI65823.1|1847011_1847599_-	peptide deformylase	NA	NA	NA	NA	NA
AVI65824.1|1847649_1848780_+	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
AVI65825.1|1848791_1849880_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	33.9	1.5e-31
AVI65826.1|1849882_1850356_+	hypothetical protein	NA	NA	NA	NA	NA
AVI68657.1|1850475_1851039_+	hypothetical protein	NA	NA	NA	NA	NA
AVI65827.1|1851186_1851753_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AVI68658.1|1851778_1852687_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
AVI65828.1|1852720_1853158_-	globin	NA	NA	NA	NA	NA
AVI65829.1|1853310_1854159_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AVI65830.1|1854164_1854440_+	hypothetical protein	NA	NA	NA	NA	NA
AVI65831.1|1854574_1855123_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AVI65832.1|1861188_1861443_+	hypothetical protein	NA	NA	NA	NA	NA
AVI65833.1|1861465_1861921_+	BadM/Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AVI65834.1|1861895_1862651_-	hypothetical protein	NA	NA	NA	NA	NA
AVI65835.1|1862660_1863869_-|protease	carboxyl-terminal protease	protease	A0A0R6PIZ1	Moraxella_phage	32.5	1.8e-14
AVI65836.1|1863901_1865035_-	peptidase M23	NA	NA	NA	NA	NA
AVI65837.1|1865045_1866590_-	phosphoglycerate mutase (2,3-diphosphoglycerate-independent)	NA	NA	NA	NA	NA
AVI68659.1|1866857_1867292_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AVI65838.1|1867587_1868073_+	protein-export protein SecB	NA	NA	NA	NA	NA
AVI65839.1|1868077_1869094_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AVI65840.1|1869287_1870472_+	aminoacetone oxidase family FAD-binding enzyme	NA	NA	NA	NA	NA
AVI65841.1|1870605_1871454_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
AVI65842.1|1871420_1873559_+|transposase	transposase	transposase	NA	NA	NA	NA
AVI65843.1|1873555_1874974_+|transposase	transposase	transposase	NA	NA	NA	NA
AVI65844.1|1875075_1876638_+|transposase	transposase	transposase	NA	NA	NA	NA
AVI65845.1|1878778_1879306_+	hypothetical protein	NA	NA	NA	NA	NA
AVI65846.1|1880334_1880706_+	hypothetical protein	NA	NA	NA	NA	NA
AVI68660.1|1880971_1882339_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
AVI65847.1|1884903_1885146_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AVI65848.1|1885345_1885981_+	serine recombinase	NA	NA	NA	NA	NA
AVI65849.1|1886135_1887032_+	hypothetical protein	NA	NA	NA	NA	NA
AVI65850.1|1887068_1887332_+	hypothetical protein	NA	NA	NA	NA	NA
AVI65851.1|1888748_1888940_-	hypothetical protein	NA	NA	NA	NA	NA
AVI65852.1|1889001_1889274_+	chromosome segregation protein ParM	NA	NA	NA	NA	NA
AVI65853.1|1889286_1890762_+	hypothetical protein	NA	NA	NA	NA	NA
AVI68661.1|1890891_1891494_+	hypothetical protein	NA	NA	NA	NA	NA
AVI65854.1|1891548_1892232_+	hypothetical protein	NA	NA	NA	NA	NA
AVI65855.1|1892294_1892660_+	hypothetical protein	NA	A0A2H4JHE6	uncultured_Caudovirales_phage	42.0	6.8e-05
AVI65856.1|1893048_1894041_+	abortive phage infection protein	NA	NA	NA	NA	NA
AVI65857.1|1894087_1894309_+	hypothetical protein	NA	NA	NA	NA	NA
AVI65858.1|1894847_1898411_+	hypothetical protein	NA	NA	NA	NA	NA
AVI65859.1|1898700_1899330_-	resolvase	NA	NA	NA	NA	NA
AVI65860.1|1899937_1901830_+	hypothetical protein	NA	NA	NA	NA	NA
AVI65861.1|1902305_1902908_+	hypothetical protein	NA	NA	NA	NA	NA
AVI65862.1|1903317_1903950_-	cytochrome C552	NA	NA	NA	NA	NA
AVI65863.1|1903960_1905217_-	oxidase	NA	NA	NA	NA	NA
AVI65864.1|1905268_1906381_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AVI65865.1|1906930_1907071_-	hypothetical protein	NA	NA	NA	NA	NA
AVI65866.1|1908224_1908638_-	hypothetical protein	NA	NA	NA	NA	NA
1908790:1908814	attL	TCGTCAACTTTGCGACAGAACCGAT	NA	NA	NA	NA
AVI65867.1|1908876_1912584_-	Insecticidal toxin complex protein TcaB (toxin complex protein)	NA	NA	NA	NA	NA
AVI65868.1|1912621_1915879_-	toxin	NA	NA	NA	NA	NA
AVI65869.1|1918085_1921343_+	toxin	NA	NA	NA	NA	NA
AVI65870.1|1921380_1924482_+	Insecticidal toxin complex protein TcaB (toxin complex protein)	NA	NA	NA	NA	NA
AVI65871.1|1924529_1925126_+	hypothetical protein	NA	NA	NA	NA	NA
AVI65872.1|1925196_1929477_+	virulence protein	NA	NA	NA	NA	NA
AVI68662.1|1934458_1936090_+	cytotoxic necrotizing factor	NA	NA	NA	NA	NA
AVI65873.1|1936737_1937925_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	74.5	1.3e-76
AVI65874.1|1938015_1939230_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	54.4	2.3e-121
AVI65875.1|1939846_1940971_+	hypothetical protein	NA	J9Q803	Salmonella_phage	27.3	2.2e-22
AVI65876.1|1941264_1941624_+	hypothetical protein	NA	NA	NA	NA	NA
AVI68663.1|1941976_1942579_+	hypothetical protein	NA	NA	NA	NA	NA
AVI65877.1|1942832_1943921_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVI65878.1|1943917_1944808_-|integrase	integrase	integrase	S5W9T9	Leptospira_phage	29.9	4.6e-23
1968808:1968832	attR	ATCGGTTCTGTCGCAAAGTTGACGA	NA	NA	NA	NA
>prophage 135
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1947985	1967444	5266746		Tupanvirus(66.67%)	3	NA	NA
AVI65882.1|1947985_1959142_+	hypothetical protein	NA	A0A2K9KZV5	Tupanvirus	24.9	1.3e-85
AVI65883.1|1959151_1961017_+	asparagine synthase (glutamine-hydrolyzing)	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	26.6	1.7e-35
AVI65884.1|1961063_1967444_+	hypothetical protein	NA	A0A2K9KZV5	Tupanvirus	27.0	1.7e-90
>prophage 136
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1975299	1983302	5266746		Tupanvirus(100.0%)	2	NA	NA
AVI65890.1|1975299_1978602_+	hypothetical protein	NA	A0A2K9L3I8	Tupanvirus	33.4	2.2e-49
AVI65891.1|1978598_1983302_+	hypothetical protein	NA	A0A2K9L3I8	Tupanvirus	27.4	2.1e-53
>prophage 137
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	1986967	1992385	5266746		Tupanvirus(50.0%)	4	NA	NA
AVI65894.1|1986967_1990117_+	hypothetical protein	NA	A0A2K9KZV5	Tupanvirus	34.6	1.1e-79
AVI65895.1|1990113_1990872_+	putative thioesterase	NA	NA	NA	NA	NA
AVI65896.1|1990909_1991344_+	hypothetical protein	NA	NA	NA	NA	NA
AVI65897.1|1991386_1992385_+	hypothetical protein	NA	A0A076FFT9	Aureococcus_anophage	29.7	4.1e-12
>prophage 138
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2006674	2007139	5266746		Clostridium_phage(100.0%)	1	NA	NA
AVI65909.1|2006674_2007139_+	peptidase P60	NA	A0A0A8WIF2	Clostridium_phage	38.8	2.6e-09
>prophage 139
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2020929	2025458	5266746		Staphylococcus_phage(50.0%)	3	NA	NA
AVI65920.1|2020929_2021664_-	ABC transporter	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	4.7e-21
AVI65921.1|2021667_2023308_-	transporter	NA	NA	NA	NA	NA
AVI65922.1|2023649_2025458_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.1	2.1e-38
>prophage 140
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2045162	2046704	5266746		Catovirus(100.0%)	1	NA	NA
AVI65942.1|2045162_2046704_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.3	9.6e-85
>prophage 141
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2054370	2056410	5266746		Tupanvirus(100.0%)	1	NA	NA
AVI68668.1|2054370_2056410_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	33.8	9.0e-14
>prophage 142
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2080856	2081627	5266746		Klosneuvirus(100.0%)	1	NA	NA
AVI65973.1|2080856_2081627_-	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SIK8	Klosneuvirus	29.8	3.4e-14
>prophage 143
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2087495	2091343	5266746		Staphylococcus_phage(50.0%)	3	NA	NA
AVI65977.1|2087495_2088149_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	42.7	2.8e-41
AVI65978.1|2088749_2090885_+	oligopeptidase B	NA	NA	NA	NA	NA
AVI65979.1|2090896_2091343_+	hypothetical protein	NA	A0A0C5AS36	Spodoptera_frugiperda_granulovirus	51.9	1.3e-10
>prophage 144
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2104151	2110490	5266746		Staphylococcus_phage(50.0%)	5	NA	NA
AVI65989.1|2104151_2105693_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.9	1.4e-139
AVI65990.1|2105891_2106752_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
AVI65991.1|2106766_2107165_-	RNA-binding protein	NA	NA	NA	NA	NA
AVI65992.1|2107418_2108348_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
AVI65993.1|2108372_2110490_+	type II secretion system protein GspD	NA	O80264	Vibrio_phage	30.3	2.2e-31
>prophage 145
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2125192	2141310	5266746	tail	Arthrobacter_phage(66.67%)	4	NA	NA
AVI66010.1|2125192_2125723_+|tail	phage tail protein	tail	A0A222ZFV4	Arthrobacter_phage	36.7	2.9e-17
AVI66011.1|2125734_2126274_+|tail	phage tail protein	tail	A0A222ZG41	Arthrobacter_phage	32.6	1.6e-15
AVI66012.1|2126344_2127205_+	sulfotransferase family protein	NA	NA	NA	NA	NA
AVI66013.1|2127201_2141310_+	adhesin	NA	A0A2D1GMQ7	Marinobacter_phage	27.4	8.7e-07
>prophage 146
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2149905	2151012	5266746		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AVI66021.1|2149905_2151012_-	acyl-CoA desaturase	NA	F2NZ38	Diadromus_pulchellus_ascovirus	32.9	5.2e-32
>prophage 147
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2162812	2165665	5266746		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AVI66028.1|2162812_2163763_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	36.0	6.4e-31
AVI66029.1|2164480_2165665_+	elongation factor Tu	NA	A0A2H4UVR3	Bodo_saltans_virus	24.4	4.4e-13
>prophage 148
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2169553	2182425	5266746		Tetraselmis_virus(25.0%)	6	NA	NA
AVI66036.1|2169553_2173585_+	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	25.7	2.0e-20
AVI66037.1|2173669_2177887_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.3	6.1e-65
AVI66038.1|2178066_2178441_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
AVI66039.1|2178522_2178993_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
AVI66040.1|2179071_2181168_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.6	3.7e-55
AVI66041.1|2181240_2182425_+	elongation factor Tu	NA	A0A2H4UVR3	Bodo_saltans_virus	24.4	4.4e-13
>prophage 149
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2199720	2200371	5266746		Pithovirus(100.0%)	1	NA	NA
AVI66073.1|2199720_2200371_-	heme ABC transporter ATP-binding protein CcmA	NA	W5SAS9	Pithovirus	31.8	3.2e-13
>prophage 150
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2223773	2225294	5266746		Tupanvirus(100.0%)	1	NA	NA
AVI66092.1|2223773_2225294_+	catalase	NA	A0A2K9L0T1	Tupanvirus	39.3	3.5e-103
>prophage 151
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2228605	2229292	5266746		Bacillus_phage(100.0%)	1	NA	NA
AVI66095.1|2228605_2229292_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.4	5.3e-35
>prophage 152
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2233849	2234896	5266746		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AVI66101.1|2233849_2234896_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.0	1.8e-05
>prophage 153
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2240147	2242103	5266746		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVI66107.1|2240147_2242103_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.1	6.4e-25
>prophage 154
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2246868	2251546	5266746		Bacillus_phage(50.0%)	4	NA	NA
AVI66112.1|2246868_2248329_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.4	9.6e-26
AVI66113.1|2248464_2249160_+	molybdenum cofactor sulfurase	NA	NA	NA	NA	NA
AVI66114.1|2249196_2249553_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
AVI66115.1|2249629_2251546_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.2	3.5e-28
>prophage 155
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2257753	2262323	5266746		Bacillus_virus(50.0%)	2	NA	NA
AVI66123.1|2257753_2258857_+	ABC transporter	NA	G3M9Y6	Bacillus_virus	32.7	8.8e-24
AVI66124.1|2258897_2262323_-	two-component system sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	27.6	3.7e-36
>prophage 156
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2270314	2274219	5266746		Bacillus_phage(100.0%)	4	NA	NA
AVI66132.1|2270314_2270992_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	39.4	8.6e-30
AVI66133.1|2271041_2272298_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AVI66134.1|2272330_2273023_+	TIGR01621 family pseudouridine synthase	NA	NA	NA	NA	NA
AVI66135.1|2273049_2274219_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.7	7.4e-21
>prophage 157
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2324520	2326095	5266746		Catovirus(100.0%)	1	NA	NA
AVI66187.1|2324520_2326095_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	32.0	7.6e-53
>prophage 158
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2339931	2345342	5266746		Catovirus(33.33%)	5	NA	NA
AVI66201.1|2339931_2341596_-	AMP-dependent synthetase	NA	A0A1V0SBX8	Catovirus	28.4	2.5e-46
AVI66202.1|2341824_2342208_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AVI66203.1|2342233_2344339_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	35.8	2.7e-13
AVI66204.1|2344381_2344660_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AVI66205.1|2344718_2345342_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	36.0	5.2e-21
>prophage 159
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2351102	2354270	5266746		Synechococcus_phage(100.0%)	1	NA	NA
AVI66208.1|2351102_2354270_+	restriction endonuclease subunit R	NA	G8EY40	Synechococcus_phage	31.0	1.3e-27
>prophage 160
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2361551	2362202	5266746		Vibrio_phage(100.0%)	1	NA	NA
AVI66216.1|2361551_2362202_-	GTP cyclohydrolase I FolE	NA	A0A140B3H5	Vibrio_phage	54.4	1.0e-56
>prophage 161
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2365223	2366902	5266746		Xanthomonas_phage(50.0%)	2	NA	NA
AVI66219.1|2365223_2365682_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	62.2	5.6e-49
AVI66220.1|2365678_2366902_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.4	8.3e-39
>prophage 162
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2372451	2374275	5266746		Tupanvirus(100.0%)	1	NA	NA
AVI66228.1|2372451_2374275_+	DNA helicase RecQ	NA	A0A2K9L021	Tupanvirus	36.5	1.3e-85
>prophage 163
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2403717	2404617	5266746		Planktothrix_phage(100.0%)	1	NA	NA
AVI66253.1|2403717_2404617_+	hypothetical protein	NA	G9BW84	Planktothrix_phage	41.4	2.0e-18
>prophage 164
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2418402	2421602	5266746		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AVI66260.1|2418402_2419155_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	33.1	7.3e-30
AVI66261.1|2419158_2419647_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AVI66262.1|2419653_2419893_-	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
AVI66263.1|2419952_2421602_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	G8DDN0	Micromonas_pusilla_virus	30.3	9.1e-41
>prophage 165
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2431983	2434377	5266746		Acinetobacter_phage(100.0%)	1	NA	NA
AVI66276.1|2431983_2434377_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	38.5	4.3e-15
>prophage 166
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2445932	2449459	5266746	transposase	Bacillus_thuringiensis_phage(33.33%)	3	NA	NA
AVI66286.1|2445932_2446640_-	short chain dehydrogenase	NA	Q56AQ6	Bacillus_thuringiensis_phage	33.5	3.4e-29
AVI66287.1|2446725_2448291_-	cryptochrome/photolyase family protein	NA	E3T4R9	Cafeteria_roenbergensis_virus	28.0	9.5e-48
AVI66288.1|2448700_2449459_-|transposase	IS5 family transposase ISSod6	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.4	7.9e-16
>prophage 167
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2453088	2455681	5266746		Erwinia_phage(50.0%)	3	NA	NA
AVI66293.1|2453088_2454417_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.2	6.0e-43
AVI66294.1|2454436_2454961_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AVI66295.1|2455105_2455681_-	pilus assembly protein PilD	NA	A0A088F7U0	Vibrio_phage	51.1	6.2e-05
>prophage 168
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2475601	2476777	5266746		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
AVI66313.1|2475601_2476777_+	ornithine decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	30.0	1.5e-42
>prophage 169
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2483364	2485110	5266746	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVI66322.1|2483364_2485110_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	35.6	1.3e-93
>prophage 170
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2497226	2498135	5266746		Burkholderia_phage(100.0%)	1	NA	NA
AVI66333.1|2497226_2498135_+	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	28.1	3.7e-12
>prophage 171
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2510931	2511981	5266746		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVI66344.1|2510931_2511981_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.4	6.1e-06
>prophage 172
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2552002	2554285	5266746		Escherichia_phage(100.0%)	1	NA	NA
AVI66376.1|2552002_2554285_+	thiosulfate reductase PhsA	NA	A0A077SK27	Escherichia_phage	25.8	8.7e-42
>prophage 173
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2562055	2563960	5266746		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVI66384.1|2562055_2563960_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.8	7.1e-29
>prophage 174
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2575890	2584822	5266746		Diachasmimorpha_longicaudata_entomopoxvirus(33.33%)	5	NA	NA
AVI66396.1|2575890_2577813_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.3	5.8e-63
AVI66397.1|2578007_2579162_-	peptidase M28	NA	NA	NA	NA	NA
AVI66398.1|2579349_2582232_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.1	2.7e-311
AVI66399.1|2582635_2584003_+	MFS transporter	NA	NA	NA	NA	NA
AVI66400.1|2584111_2584822_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	75.8	1.5e-48
>prophage 175
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2594990	2597825	5266746		Moumouvirus(100.0%)	1	NA	NA
AVI66408.1|2594990_2597825_+	peptidase M16	NA	A0A2P1EL85	Moumouvirus	28.2	2.1e-13
>prophage 176
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2607347	2608781	5266746		Lactobacillus_phage(100.0%)	1	NA	NA
AVI66414.1|2607347_2608781_-	lytic transglycosylase	NA	A0A0A7NU10	Lactobacillus_phage	29.9	1.8e-05
>prophage 177
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2611857	2614929	5266746		Leptospira_phage(100.0%)	1	NA	NA
AVI66417.1|2611857_2614929_+	acriflavin resistance protein	NA	S5VTK5	Leptospira_phage	22.1	9.0e-50
>prophage 178
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2620488	2621247	5266746	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
AVI66420.1|2620488_2621247_+|transposase	IS5 family transposase ISSod6	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.4	7.9e-16
>prophage 179
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2633003	2641864	5266746		Leptospira_phage(50.0%)	6	NA	NA
AVI66429.1|2633003_2636090_-	MFS transporter	NA	S5VL66	Leptospira_phage	22.5	1.3e-24
AVI66430.1|2636093_2637176_-	efflux transporter periplasmic adaptor subunit	NA	S5VL44	Leptospira_phage	26.9	2.3e-08
AVI66431.1|2637304_2638294_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVI66432.1|2638295_2639663_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AVI66433.1|2639887_2640178_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	38.9	2.0e-12
AVI66434.1|2640235_2641864_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	66.2	9.2e-179
>prophage 180
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2670485	2678501	5266746		Thermobifida_phage(20.0%)	10	NA	NA
AVI66462.1|2670485_2671340_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	33.1	1.4e-08
AVI66463.1|2671336_2671780_-	PTS IIA-like nitrogen-regulatory protein PtsN	NA	NA	NA	NA	NA
AVI66464.1|2671782_2672070_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
AVI66465.1|2672098_2673577_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
AVI66466.1|2673684_2674416_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	4.2e-22
AVI66467.1|2674412_2674967_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
AVI66468.1|2674953_2675514_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AVI66469.1|2675510_2676062_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	55.2	9.1e-38
AVI66470.1|2676061_2677039_-	D-arabinose 5-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	35.9	1.6e-40
AVI66471.1|2677682_2678501_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.1	3.4e-20
>prophage 181
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2683610	2684963	5266746	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVI66479.1|2683610_2684963_-|protease	serine endoprotease DegQ	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	27.6	4.4e-09
>prophage 182
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2688013	2692541	5266746		Brazilian_cedratvirus(50.0%)	3	NA	NA
AVI66484.1|2688013_2689309_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	36.9	6.4e-66
AVI66485.1|2689421_2690078_+	flagellar protein MotX	NA	NA	NA	NA	NA
AVI66486.1|2690117_2692541_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.3	8.1e-62
>prophage 183
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2700347	2702933	5266746		Salmonella_phage(50.0%)	2	NA	NA
AVI66496.1|2700347_2701754_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	70.3	1.4e-178
AVI66497.1|2701856_2702933_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.4	1.2e-25
>prophage 184
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2709773	2711528	5266746		Enterobacterial_phage(50.0%)	5	NA	NA
AVI66506.1|2709773_2710094_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	37.1	5.0e-12
AVI66507.1|2710090_2710321_-	hypothetical protein	NA	NA	NA	NA	NA
AVI66508.1|2710317_2710596_-	hypothetical protein	NA	NA	NA	NA	NA
AVI66509.1|2710596_2710890_-	hypothetical protein	NA	NA	NA	NA	NA
AVI66510.1|2710886_2711528_-	hypothetical protein	NA	R9VWB9	Serratia_phage	40.3	6.9e-29
>prophage 185
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2715687	2734674	5266746	terminase,integrase,portal	Pseudomonas_phage(33.33%)	26	2711278:2711292	2724046:2724060
2711278:2711292	attL	TGATCACCAAGTGTG	NA	NA	NA	NA
AVI66515.1|2715687_2716458_-	Cro/Cl family transcriptional regulator	NA	A0A0A0YR73	Pseudomonas_phage	43.8	3.5e-51
AVI66516.1|2716587_2716827_+	transcriptional regulator	NA	NA	NA	NA	NA
AVI66517.1|2716858_2717467_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66518.1|2717632_2718382_+	transcriptional regulator	NA	H9C164	Pectobacterium_phage	59.8	3.6e-29
AVI66519.1|2718378_2719065_+	replication protein P	NA	I6PBN0	Cronobacter_phage	28.5	1.6e-10
AVI66520.1|2719054_2720311_+|integrase	integrase	integrase	A0A067ZJC5	Vibrio_phage	33.9	5.0e-47
AVI66521.1|2720366_2720585_+	transcriptional regulator	NA	NA	NA	NA	NA
AVI66522.1|2720571_2720925_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66523.1|2720933_2721548_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	63.6	7.5e-65
AVI66524.1|2721871_2722534_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66525.1|2722977_2723511_+	glycoside hydrolase	NA	A0A1S5R1I9	Pseudomonas_phage	39.2	2.8e-23
AVI66526.1|2723491_2723995_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66527.1|2724105_2724441_+	hypothetical protein	NA	NA	NA	NA	NA
2724046:2724060	attR	TGATCACCAAGTGTG	NA	NA	NA	NA
AVI66528.1|2724394_2724928_+	DNA packaging protein	NA	O64316	Escherichia_phage	48.5	1.6e-34
AVI66529.1|2724902_2726900_+|terminase	terminase	terminase	A0A1B0Z2K0	Pseudomonas_phage	49.7	2.9e-190
AVI66530.1|2726929_2727136_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66531.1|2727185_2728760_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	48.0	2.6e-125
AVI66532.1|2728731_2730735_+	peptidase S14	NA	A0A1B0YZU0	Pseudomonas_phage	62.7	1.6e-220
AVI66533.1|2730815_2731139_+	DNA breaking-rejoining protein	NA	Q9EYD5	Enterobacteria_phage	41.1	1.2e-08
AVI66534.1|2731131_2731476_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66535.1|2731479_2732049_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66536.1|2732065_2732491_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66537.1|2732487_2733207_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66538.1|2733330_2733717_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66539.1|2733700_2734006_+	transcriptional regulator	NA	NA	NA	NA	NA
AVI66540.1|2734089_2734674_-	Rha family transcriptional regulator	NA	A0A1C9IHV9	Salmonella_phage	48.1	7.2e-17
>prophage 186
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2739471	2748180	5266746	integrase	Vibrio_phage(57.14%)	8	2746630:2746644	2752523:2752537
AVI66541.1|2739471_2739843_+	hypothetical protein	NA	A0A2I7QS24	Vibrio_phage	51.4	3.0e-24
AVI66542.1|2739850_2742289_+	hypothetical protein	NA	A0A2I7QXQ4	Vibrio_phage	63.6	4.3e-297
AVI66543.1|2742301_2743246_+	hypothetical protein	NA	A0A2I7S8P4	Vibrio_phage	37.7	1.5e-51
AVI66544.1|2743238_2743544_+	hypothetical protein	NA	A0A2I7QRU3	Vibrio_phage	39.0	1.6e-07
AVI66545.1|2743540_2745304_+	hypothetical protein	NA	A0A088C4B7	Shewanella_sp._phage	58.3	1.0e-138
AVI66546.1|2745364_2745577_+	hypothetical protein	NA	A0A088C533	Shewanella_sp._phage	62.9	1.2e-14
AVI66547.1|2745667_2746639_-	hypothetical protein	NA	NA	NA	NA	NA
2746630:2746644	attL	TTTTTTTCATAATTA	NA	NA	NA	NA
AVI66548.1|2747118_2748180_-|integrase	integrase	integrase	A0A1W6JP34	Morganella_phage	60.3	3.6e-123
AVI66548.1|2747118_2748180_-|integrase	integrase	integrase	A0A1W6JP34	Morganella_phage	60.3	3.6e-123
2752523:2752537	attR	TAATTATGAAAAAAA	NA	NA	NA	NA
>prophage 187
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2757457	2762838	5266746		Bacillus_phage(50.0%)	3	NA	NA
AVI66562.1|2757457_2759344_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	33.4	3.2e-82
AVI66563.1|2759396_2760569_+	L-sorbosone dehydrogenase	NA	NA	NA	NA	NA
AVI66564.1|2760561_2762838_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.3	1.0e-74
>prophage 188
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2765985	2766795	5266746	tRNA	Pandoravirus(100.0%)	1	NA	NA
AVI66567.1|2765985_2766795_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	30.4	6.7e-13
>prophage 189
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2769870	2781475	5266746	transposase	Planktothrix_phage(40.0%)	9	NA	NA
AVI66571.1|2769870_2771460_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.2	2.5e-35
AVI66572.1|2771780_2772866_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	2.4e-21
AVI68686.1|2772859_2773597_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AVI66573.1|2773613_2774405_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVI66574.1|2774610_2775390_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AVI66575.1|2775661_2776327_+	hypothetical protein	NA	Q7M296	Enterobacteria_phage	40.9	4.5e-15
AVI66576.1|2776576_2777593_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVI66577.1|2778206_2779439_+	efflux transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	60.0	5.3e-09
AVI66578.1|2779441_2781475_+	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	42.5	3.0e-41
>prophage 190
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2810007	2812101	5266746		Streptococcus_phage(100.0%)	1	NA	NA
AVI66594.1|2810007_2812101_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.4	3.4e-56
>prophage 191
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2821165	2832981	5266746	tRNA	Planktothrix_phage(25.0%)	6	NA	NA
AVI66602.1|2821165_2821840_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	4.4e-26
AVI66603.1|2822667_2824026_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
AVI66604.1|2824156_2829481_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	35.0	5.5e-79
AVI66605.1|2829529_2830546_+	two-component system response regulator	NA	W8CYM9	Bacillus_phage	32.9	6.1e-11
AVI66606.1|2830634_2831597_-|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
AVI66607.1|2831751_2832981_-	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	49.6	3.2e-107
>prophage 192
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2840600	2846051	5266746	tRNA	Bacillus_virus(50.0%)	5	NA	NA
AVI68687.1|2840600_2842082_-	poly(A) polymerase	NA	G3MAR3	Bacillus_virus	36.7	3.0e-27
AVI66616.1|2842161_2843076_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AVI66617.1|2843245_2843689_-	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AVI66618.1|2843852_2844557_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AVI66619.1|2844758_2846051_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.4	1.2e-32
>prophage 193
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2853160	2855074	5266746		Tupanvirus(100.0%)	1	NA	NA
AVI66628.1|2853160_2855074_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	32.2	6.8e-72
>prophage 194
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2859350	2873565	5266746		uncultured_Mediterranean_phage(20.0%)	12	NA	NA
AVI68689.1|2859350_2860727_+	ATP-dependent RNA helicase DbpA	NA	A0A1B1IS59	uncultured_Mediterranean_phage	32.2	8.1e-51
AVI66633.1|2861016_2862066_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66634.1|2862256_2863801_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	6.3e-52
AVI66635.1|2864435_2865482_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66636.1|2865617_2866136_-	pilus assembly protein	NA	NA	NA	NA	NA
AVI66637.1|2866415_2868365_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	2.0e-18
AVI66638.1|2868361_2870113_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.5	1.1e-20
AVI66639.1|2870204_2870792_+	adenylate cyclase	NA	NA	NA	NA	NA
AVI66640.1|2871103_2871280_-	DNA-binding protein	NA	NA	NA	NA	NA
AVI66641.1|2871372_2872116_-	hypothetical protein	NA	NA	NA	NA	NA
AVI66642.1|2872253_2872454_-	hypothetical protein	NA	NA	NA	NA	NA
AVI66643.1|2872986_2873565_+	hypothetical protein	NA	A0A1X9IGI7	Lactococcus_phage	32.8	2.3e-15
>prophage 195
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2879872	2888827	5266746		Ostreococcus_lucimarinus_virus(33.33%)	9	NA	NA
AVI66648.1|2879872_2881162_-	inorganic phosphate transporter	NA	M4QMY4	Ostreococcus_lucimarinus_virus	36.6	1.7e-63
AVI66649.1|2881188_2881869_-	TIGR00153 family protein	NA	NA	NA	NA	NA
AVI66650.1|2882100_2883597_+	adenylate cyclase	NA	NA	NA	NA	NA
AVI68690.1|2883680_2884505_-	ion transporter	NA	A0A2I7SA68	Vibrio_phage	31.8	4.0e-05
AVI66651.1|2884660_2884990_-	hypothetical protein	NA	NA	NA	NA	NA
AVI66652.1|2885091_2885745_-	hypothetical protein	NA	NA	NA	NA	NA
AVI66653.1|2885909_2886599_-	phage shock protein A	NA	NA	NA	NA	NA
AVI66654.1|2886610_2887024_-	hypothetical protein	NA	NA	NA	NA	NA
AVI66655.1|2887102_2888827_-	spermidine synthase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	29.3	3.5e-11
>prophage 196
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2897182	2898808	5266746		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVI66662.1|2897182_2898808_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.1	3.6e-58
>prophage 197
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2909539	2915740	5266746	transposase	Morganella_phage(33.33%)	7	NA	NA
AVI66670.1|2909539_2910466_-	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	36.2	3.9e-49
AVI66671.1|2910569_2912000_+	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	E3SJ88	Synechococcus_phage	40.8	9.4e-18
AVI66672.1|2911996_2912824_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66673.1|2912975_2913455_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVI66674.1|2913623_2914208_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66675.1|2914404_2914785_-	hypothetical protein	NA	NA	NA	NA	NA
AVI66676.1|2914981_2915740_+|transposase	IS5/IS1182 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.4	7.9e-16
>prophage 198
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2932485	2936338	5266746		Hokovirus(50.0%)	3	NA	NA
AVI66688.1|2932485_2933928_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	24.8	2.2e-30
AVI66689.1|2933931_2935656_+	SLC13 family permease	NA	NA	NA	NA	NA
AVI66690.1|2935720_2936338_+	adenylyl-sulfate kinase	NA	A0A1B0XTK9	Freshwater_phage	36.0	1.2e-09
>prophage 199
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2945877	2946603	5266746		Planktothrix_phage(100.0%)	1	NA	NA
AVI66698.1|2945877_2946603_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.7	8.9e-33
>prophage 200
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2977681	2983801	5266746		Dickeya_phage(50.0%)	3	NA	NA
AVI66716.1|2977681_2981416_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	71.2	1.7e-18
AVI66717.1|2981685_2982411_+	phosphoglycerate mutase	NA	NA	NA	NA	NA
AVI66718.1|2982925_2983801_+	ABC transporter	NA	G9BWD6	Planktothrix_phage	29.4	6.6e-14
>prophage 201
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	2995552	2996068	5266746		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVI66728.1|2995552_2996068_+	cell division protein ZipA	NA	A0A2H4JFX6	uncultured_Caudovirales_phage	53.2	2.0e-42
>prophage 202
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3001777	3004332	5266746	transposase	Pelagibacter_phage(50.0%)	4	NA	NA
AVI68698.1|3001777_3002629_+	glucosaminidase	NA	M1IDP9	Pelagibacter_phage	33.8	2.4e-08
AVI66736.1|3002897_3003104_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66737.1|3003270_3003552_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66738.1|3003573_3004332_-|transposase	IS5 family transposase ISSod6	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.4	7.9e-16
>prophage 203
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3011628	3012378	5266746		Planktothrix_phage(100.0%)	1	NA	NA
AVI66747.1|3011628_3012378_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.6	1.9e-33
>prophage 204
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3016558	3020168	5266746		Hokovirus(50.0%)	4	NA	NA
AVI66751.1|3016558_3018247_+	histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.5	3.7e-05
AVI66752.1|3018545_3018956_+	curli production assembly protein CsgE	NA	NA	NA	NA	NA
AVI66753.1|3018966_3019362_+	curli production assembly protein CsgF	NA	NA	NA	NA	NA
AVI66754.1|3019361_3020168_+	transporter	NA	M1ICK2	Pelagibacter_phage	38.7	7.4e-36
>prophage 205
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3025146	3036332	5266746	tRNA	Streptococcus_phage(33.33%)	10	NA	NA
AVI66760.1|3025146_3025698_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.4	1.9e-19
AVI66761.1|3025905_3026232_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66762.1|3026837_3028127_+	guanine permease	NA	A0A0R6PHV4	Moraxella_phage	37.3	2.0e-67
AVI66763.1|3028329_3029448_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.1	8.3e-62
AVI66764.1|3029460_3030738_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.0	3.5e-88
AVI66765.1|3030842_3031151_-	hypothetical protein	NA	NA	NA	NA	NA
AVI66766.1|3031360_3031837_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AVI66767.1|3031956_3032877_-	EamA family transporter	NA	NA	NA	NA	NA
AVI66768.1|3033165_3035085_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.3	9.0e-149
AVI66769.1|3035195_3036332_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.5	1.5e-21
>prophage 206
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3040158	3041490	5266746		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVI66772.1|3040158_3041490_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.8	3.0e-42
>prophage 207
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3045056	3046217	5266746		Halovirus(100.0%)	1	NA	NA
AVI66777.1|3045056_3046217_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.9	3.0e-46
>prophage 208
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3051377	3052466	5266746		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVI66780.1|3051377_3052466_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	7.7e-12
>prophage 209
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3066841	3070017	5266746		Bacillus_phage(50.0%)	2	NA	NA
AVI66792.1|3066841_3068419_-	ABC transporter	NA	W8CYL7	Bacillus_phage	28.3	4.8e-23
AVI66793.1|3068415_3070017_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	30.1	8.6e-12
>prophage 210
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3075213	3075996	5266746		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVI66797.1|3075213_3075996_+	siderophore ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.0	1.7e-13
>prophage 211
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3081035	3081503	5266746		Lake_Baikal_phage(100.0%)	1	NA	NA
AVI66801.1|3081035_3081503_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	34.6	5.8e-17
>prophage 212
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3085064	3087227	5266746		Stx2-converting_phage(50.0%)	2	NA	NA
AVI66805.1|3085064_3086240_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	45.2	1.2e-87
AVI66806.1|3086381_3087227_-	septal ring lytic transglycosylase RlpA	NA	I3ULI9	Synechococcus_phage	44.7	7.0e-13
>prophage 213
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3094550	3097130	5266746	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
AVI66815.1|3094550_3097130_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	7.0e-189
>prophage 214
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3102162	3103212	5266746		Pseudomonas_phage(100.0%)	1	NA	NA
AVI66822.1|3102162_3103212_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.1	7.8e-46
>prophage 215
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3116786	3121842	5266746	protease	uncultured_Mediterranean_phage(33.33%)	5	NA	NA
AVI66833.1|3116786_3117689_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.9	2.3e-38
AVI66834.1|3117778_3118078_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
AVI66835.1|3118168_3118798_+	ribosomal RNA large subunit methyltransferase E	NA	NA	NA	NA	NA
AVI66836.1|3118842_3120798_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	44.0	8.1e-121
AVI66837.1|3121008_3121842_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	30.0	5.1e-16
>prophage 216
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3127014	3129657	5266746		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
AVI66843.1|3127014_3129657_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	24.0	2.1e-23
>prophage 217
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3137291	3145333	5266746		Streptococcus_phage(33.33%)	7	NA	NA
AVI66850.1|3137291_3138872_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.4	2.9e-28
AVI66851.1|3138963_3139167_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66852.1|3139177_3139942_+	hydrolase TatD	NA	NA	NA	NA	NA
AVI66853.1|3140118_3141414_+	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	22.5	1.4e-15
AVI66854.1|3141761_3142622_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66855.1|3143046_3143817_+	2-deoxyribose-5-phosphate aldolase	NA	NA	NA	NA	NA
AVI66856.1|3144001_3145333_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	41.0	3.4e-78
>prophage 218
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3155743	3157096	5266746		Moraxella_phage(100.0%)	1	NA	NA
AVI66865.1|3155743_3157096_+	permease	NA	A0A0R6PHV4	Moraxella_phage	67.7	1.8e-151
>prophage 219
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3167683	3179647	5266746	protease	Phage_TP(28.57%)	10	NA	NA
AVI66874.1|3167683_3168694_-|protease	protease	protease	Q6DW11	Phage_TP	32.9	2.5e-25
AVI66875.1|3168832_3169366_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66876.1|3169475_3171365_-|protease	alkaline serine protease	protease	A0A2K9L199	Tupanvirus	35.2	5.2e-32
AVI66877.1|3171886_3172138_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.4e-22
AVI66878.1|3172142_3173510_-	U32 family peptidase	NA	Q6DW11	Phage_TP	70.2	5.6e-153
AVI66879.1|3173838_3174681_+	histidine kinase	NA	A0A1C3NFB0	Phage_NCTB	32.5	9.4e-34
AVI68704.1|3174771_3176265_+	GGDEF-domain containing protein	NA	NA	NA	NA	NA
AVI66880.1|3176473_3176905_-	thioesterase	NA	NA	NA	NA	NA
AVI66881.1|3177257_3178238_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	78.5	4.6e-141
AVI66882.1|3178390_3179647_-	adenylosuccinate synthetase	NA	A0A2R8FF47	Brazilian_cedratvirus	30.1	2.7e-45
>prophage 220
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3185640	3188799	5266746		Leptospira_phage(100.0%)	1	NA	NA
AVI66888.1|3185640_3188799_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.5	4.6e-65
>prophage 221
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3201905	3203108	5266746		Hokovirus(100.0%)	1	NA	NA
AVI66898.1|3201905_3203108_-	metallophosphoesterase	NA	A0A1V0SFZ7	Hokovirus	26.4	2.1e-18
>prophage 222
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3207058	3214684	5266746		Staphylococcus_phage(50.0%)	7	NA	NA
AVI66901.1|3207058_3208726_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	28.0	6.6e-39
AVI66902.1|3208915_3210169_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.6	5.4e-102
AVI66903.1|3210457_3210907_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AVI68708.1|3211064_3212207_+	riboflavin biosynthesis protein RibD	NA	A0A1V0SE20	Indivirus	34.9	9.1e-48
AVI66904.1|3212218_3212875_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	34.0	3.0e-27
AVI66905.1|3212970_3214074_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.7	3.4e-68
AVI66906.1|3214204_3214684_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.0	2.7e-30
>prophage 223
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3221693	3225948	5266746		Hokovirus(50.0%)	2	NA	NA
AVI66914.1|3221693_3224495_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.4	3.2e-54
AVI66915.1|3224595_3225948_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	4.4e-41
>prophage 224
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3241919	3271841	5266746	portal,capsid,tail,terminase,head	Vibrio_phage(27.27%)	33	NA	NA
AVI66924.1|3241919_3243032_-	agmatine deiminase	NA	M1H3B1	Paramecium_bursaria_Chlorella_virus	51.4	1.0e-104
AVI66925.1|3243541_3244465_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AVI66926.1|3244581_3246219_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	3.3e-152
AVI66927.1|3246449_3247745_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.2	1.8e-132
AVI66928.1|3247861_3248182_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66929.1|3248144_3249215_-	DNA adenine methylase	NA	K7RG04	Vibrio_phage	52.5	4.2e-103
AVI66930.1|3249442_3249811_-	hypothetical protein	NA	A0A2I7QRW7	Vibrio_phage	50.4	2.0e-28
AVI66931.1|3249807_3250422_-	hypothetical protein	NA	NA	NA	NA	NA
AVI66932.1|3250424_3251075_-	hypothetical protein	NA	NA	NA	NA	NA
AVI66933.1|3251074_3251338_-	hypothetical protein	NA	NA	NA	NA	NA
AVI66934.1|3251337_3252366_-|portal	phage portal protein	portal	A0A2I7RNI9	Vibrio_phage	42.9	1.6e-67
AVI66935.1|3252365_3254171_-|terminase	terminase	terminase	R9TMR7	Vibrio_phage	42.4	1.2e-118
AVI66936.1|3254283_3255336_+	hypothetical protein	NA	A0A1S6KZW9	Salmonella_phage	37.6	3.2e-23
AVI66937.1|3255359_3256682_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	44.6	5.4e-68
AVI66938.1|3256691_3257414_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66939.1|3257450_3257966_+|head	head protein	head	A0A0U4J933	Pseudomonas_phage	34.0	1.3e-14
AVI66940.1|3257980_3258463_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66941.1|3258452_3259106_+	virion morphogenesis protein	NA	A0A1D9C9S1	Salinivibrio_phage	30.5	1.5e-15
AVI66942.1|3259109_3260267_+|tail	phage tail protein	tail	A0A1D9C9S8	Salinivibrio_phage	39.8	2.4e-72
AVI66943.1|3260281_3260746_+|tail	phage tail protein	tail	A0A0U3TH58	Pseudomonas_phage	50.7	8.8e-34
AVI66944.1|3260754_3261078_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66945.1|3261087_3261513_+	peptidase M15	NA	A0A219Y9Z2	Aeromonas_phage	46.0	2.1e-21
AVI66946.1|3261523_3261916_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66947.1|3262109_3262778_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66948.1|3262774_3264820_+	hypothetical protein	NA	A0A2I7RNI7	Vibrio_phage	35.9	2.4e-75
AVI66949.1|3264816_3265137_+	hypothetical protein	NA	A0A2I7RNH9	Vibrio_phage	59.2	7.2e-27
AVI66950.1|3265127_3266315_+	hypothetical protein	NA	A0A0U4JJ14	Pseudomonas_phage	42.7	6.3e-84
AVI66951.1|3266311_3266899_+|tail	phage tail protein	tail	A0A0U4JVX3	Pseudomonas_phage	48.7	2.4e-36
AVI66952.1|3266920_3268714_+	hypothetical protein	NA	F1BUK3	Cronobacter_phage	38.0	2.9e-56
AVI66953.1|3268744_3269614_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66954.1|3269610_3270189_+	adenine glycosylase	NA	A0A1L5C2B6	Pseudoalteromonas_phage	41.3	4.1e-20
AVI66955.1|3270189_3270870_+	hypothetical protein	NA	A0A1D9CA29	Salinivibrio_phage	34.4	2.1e-39
AVI66956.1|3270917_3271841_+	hypothetical protein	NA	Q94MX6	Haemophilus_virus	25.6	3.0e-17
>prophage 225
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3277477	3305904	5266746	integrase,tRNA	Enterobacteria_phage(15.38%)	26	3274256:3274270	3305770:3305784
3274256:3274270	attL	GGTTATATCAGTAAC	NA	NA	NA	NA
AVI66963.1|3277477_3279754_-	replication protein	NA	Q94N00	Haemophilus_virus	34.6	1.4e-68
AVI66964.1|3279750_3280062_-	hypothetical protein	NA	NA	NA	NA	NA
AVI66965.1|3280061_3280661_-	DNA polymerase III subunit epsilon	NA	A2I2Z6	Vibrio_virus	50.0	1.1e-39
AVI66966.1|3280657_3280915_-	hypothetical protein	NA	NA	NA	NA	NA
AVI66967.1|3280929_3281286_-	hypothetical protein	NA	NA	NA	NA	NA
AVI66968.1|3281551_3281824_-	hypothetical protein	NA	NA	NA	NA	NA
AVI66969.1|3281929_3282217_+	hypothetical protein	NA	Q1JS45	Enterobacteria_phage	30.3	2.5e-07
AVI66970.1|3282265_3283234_+|integrase	integrase	integrase	U5N0A8	Enterobacteria_phage	47.5	3.4e-80
AVI68710.1|3283408_3283708_+	cell division protein FtsB	NA	NA	NA	NA	NA
AVI68711.1|3283786_3284512_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AVI66971.1|3284549_3285035_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
AVI66972.1|3285055_3286171_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
AVI66973.1|3286167_3286917_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.1	2.7e-72
AVI66974.1|3286913_3287549_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	7.1e-34
AVI66975.1|3287648_3288545_+	peptidase M23	NA	NA	NA	NA	NA
AVI66976.1|3288625_3289606_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	33.2	8.4e-34
AVI66977.1|3289738_3292309_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	22.7	3.3e-29
AVI66978.1|3292354_3292594_+	hypothetical protein	NA	NA	NA	NA	NA
AVI66979.1|3292711_3293779_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.9	4.1e-111
AVI66980.1|3293853_3294276_+	recombinase RecX	NA	NA	NA	NA	NA
AVI66981.1|3294595_3297220_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.4	1.0e-78
AVI66982.1|3297229_3298486_+	aspartate kinase	NA	NA	NA	NA	NA
AVI66983.1|3298604_3298802_+	carbon storage regulator	NA	J7I430	Pseudomonas_phage	60.7	1.8e-12
AVI66984.1|3300653_3303530_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	8.2e-146
AVI66985.1|3303550_3304054_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AVI66986.1|3304395_3305904_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.7	1.0e-46
3305770:3305784	attR	GTTACTGATATAACC	NA	NA	NA	NA
>prophage 226
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3325233	3337779	5266746	transposase	Diachasmimorpha_longicaudata_entomopoxvirus(20.0%)	7	NA	NA
AVI67003.1|3325233_3326535_-	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.0	8.7e-55
AVI67004.1|3326896_3328465_-	chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	44.2	7.9e-34
AVI68714.1|3329044_3330262_+	phosphohydrolase	NA	NA	NA	NA	NA
AVI67005.1|3330464_3332252_-	X-Pro aminopeptidase	NA	A0A0P0I8D7	Acinetobacter_phage	33.8	2.6e-94
AVI67006.1|3332956_3333742_+	hypothetical protein	NA	NA	NA	NA	NA
AVI67007.1|3334077_3334836_+|transposase	IS5 family transposase ISSod6	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.4	7.9e-16
AVI67008.1|3335172_3337779_+	glycoside hydrolase	NA	Q0IL62	Leucania_separata_nucleopolyhedrovirus	62.1	1.2e-201
>prophage 227
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3353625	3355245	5266746		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVI67024.1|3353625_3355245_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.1	5.6e-27
>prophage 228
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3361200	3363721	5266746		Enterobacteria_phage(50.0%)	2	NA	NA
AVI67032.1|3361200_3362232_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	36.9	1.1e-15
AVI67033.1|3362218_3363721_+	deoxyribodipyrimidine photo-lyase	NA	A0A2H4UV63	Bodo_saltans_virus	32.1	4.2e-53
>prophage 229
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3367045	3368320	5266746		Tupanvirus(100.0%)	1	NA	NA
AVI67037.1|3367045_3368320_+	SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	30.6	1.3e-39
>prophage 230
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3384427	3387456	5266746		Cassava_brown_streak_virus(50.0%)	5	NA	NA
AVI67054.1|3384427_3385045_-	non-canonical purine NTP pyrophosphatase, RdgB/HAM1 family	NA	E9KZD7	Cassava_brown_streak_virus	38.9	8.5e-08
AVI67055.1|3385167_3385602_-	hypothetical protein	NA	NA	NA	NA	NA
AVI67056.1|3385737_3386043_-	YggU family protein	NA	NA	NA	NA	NA
AVI67057.1|3386042_3386591_-	hypothetical protein	NA	NA	NA	NA	NA
AVI67058.1|3386637_3387456_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	30.6	6.8e-21
>prophage 231
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3406736	3407543	5266746		Salmonella_phage(100.0%)	1	NA	NA
AVI67077.1|3406736_3407543_-	chromosome partitioning protein ParA	NA	J9Q7R7	Salmonella_phage	43.2	8.7e-37
>prophage 232
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3425484	3428418	5266746		Moumouvirus(50.0%)	2	NA	NA
AVI67096.1|3425484_3426831_-	exodeoxyribonuclease VII large subunit	NA	A0A2P1EMK6	Moumouvirus	32.1	2.8e-32
AVI67097.1|3426951_3428418_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.7	4.4e-95
>prophage 233
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3432972	3436854	5266746		Burkholderia_phage(100.0%)	1	NA	NA
AVI67101.1|3432972_3436854_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	55.4	6.7e-119
>prophage 234
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3454452	3456596	5266746		Catovirus(50.0%)	2	NA	NA
AVI67114.1|3454452_3455454_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A1V0SAI8	Catovirus	35.7	3.4e-38
AVI67115.1|3455450_3456596_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2K9L470	Tupanvirus	33.1	4.3e-29
>prophage 235
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3465117	3466863	5266746		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
AVI67123.1|3465117_3466863_-	acetolactate synthase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.7	2.7e-51
>prophage 236
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3473953	3474874	5266746		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AVI67133.1|3473953_3474874_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	33.4	1.6e-34
>prophage 237
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3482542	3483685	5266746		Clostridium_phage(100.0%)	1	NA	NA
AVI67142.1|3482542_3483685_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A0A7RUS8	Clostridium_phage	32.2	8.9e-11
>prophage 238
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3514873	3515257	5266746		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AVI67173.1|3514873_3515257_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	33.9	2.6e-07
>prophage 239
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3520027	3520819	5266746		Enterococcus_phage(100.0%)	1	NA	NA
AVI67177.1|3520027_3520819_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	28.2	5.2e-10
>prophage 240
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3526389	3529117	5266746		Feldmannia_irregularis_virus(50.0%)	2	NA	NA
AVI67184.1|3526389_3527493_+	two-component system response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	29.7	1.4e-08
AVI67185.1|3527611_3529117_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.3	7.2e-69
>prophage 241
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3534837	3538848	5266746		Enterobacteria_phage(33.33%)	5	NA	NA
AVI67189.1|3534837_3535926_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.1	1.6e-97
AVI67190.1|3536002_3536878_+	glucose-1-phosphate thymidylyltransferase	NA	A0A291LA53	Escherichia_phage	67.0	1.2e-108
AVI67191.1|3536881_3537304_+	dTDP-6-deoxy-3,4-keto-hexulose isomerase	NA	NA	NA	NA	NA
AVI67192.1|3537281_3537743_+	dTDP-6-deoxy-3,4-keto-hexulose isomerase	NA	NA	NA	NA	NA
AVI67193.1|3537744_3538848_+	aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	31.7	1.1e-42
>prophage 242
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3546160	3548596	5266746		Prochlorococcus_phage(50.0%)	2	NA	NA
AVI67201.1|3546160_3547168_+	protein CapI	NA	A0A0K0KW07	Prochlorococcus_phage	31.0	1.1e-12
AVI67202.1|3547429_3548596_+	UDP-glucose 6-dehydrogenase	NA	M1IB49	Acanthocystis_turfacea_Chlorella_virus	52.9	9.1e-112
>prophage 243
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3556208	3590225	5266746	tail,head,plate	Vibrio_phage(90.48%)	50	NA	NA
AVI67208.1|3556208_3558008_-	hypothetical protein	NA	M4M9L1	Vibrio_phage	69.4	6.3e-27
AVI67209.1|3558074_3558659_-	hypothetical protein	NA	M4M9M8	Vibrio_phage	79.8	7.6e-91
AVI67210.1|3558643_3559711_-|plate	phage baseplate protein	plate	M4MHE1	Vibrio_phage	79.1	2.0e-158
AVI67211.1|3559700_3560153_-	hypothetical protein	NA	A0A2I7S9F0	Vibrio_phage	74.4	5.0e-58
AVI67212.1|3560160_3560808_-	hypothetical protein	NA	M1Q572	Vibrio_phage	67.8	8.4e-75
AVI67213.1|3560797_3561898_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	79.3	1.5e-164
AVI67214.1|3561897_3563214_-	multidrug DMT transporter permease	NA	M4M9N2	Vibrio_phage	70.5	1.7e-175
AVI67215.1|3563234_3564983_-|tail	phage tail tape measure protein	tail	M4MHE6	Vibrio_phage	60.8	5.8e-187
AVI67216.1|3565108_3565453_-	hypothetical protein	NA	M1NVT1	Vibrio_phage	77.0	2.5e-41
AVI67217.1|3565452_3565806_-|tail	phage tail protein	tail	A0A2I7S9D5	Vibrio_phage	74.4	1.2e-46
AVI67218.1|3565821_3567303_-|tail	phage tail protein	tail	M4M9L9	Vibrio_phage	83.8	7.5e-236
AVI67219.1|3567317_3567503_-	DUF2635 domain-containing protein	NA	A0A2I7S9K4	Vibrio_phage	56.1	3.0e-09
AVI67220.1|3567553_3568147_-	hypothetical protein	NA	M4MHF0	Vibrio_phage	66.7	2.2e-77
AVI67221.1|3568143_3568686_-	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	78.8	8.0e-79
AVI67222.1|3568685_3569117_-	hypothetical protein	NA	M1PVU7	Vibrio_phage	79.2	1.9e-59
AVI67223.1|3569127_3569766_-	hypothetical protein	NA	A0A2I7S9F2	Vibrio_phage	57.6	9.0e-21
AVI67224.1|3569858_3570758_-|head	phage head protein	head	A0A2I7S9D0	Vibrio_phage	78.6	3.5e-135
AVI67225.1|3570757_3571720_-	peptidase	NA	M1Q578	Vibrio_phage	60.0	7.0e-102
AVI67226.1|3572062_3572842_-	hypothetical protein	NA	A0A2I7S9F9	Vibrio_phage	71.4	5.5e-113
AVI67227.1|3572834_3574400_-	hypothetical protein	NA	M4M9P3	Vibrio_phage	72.1	4.2e-221
AVI67228.1|3574396_3576055_-	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	74.7	4.5e-229
AVI67229.1|3576054_3576648_-	hypothetical protein	NA	A0A2I7S9D1	Vibrio_phage	66.5	3.4e-62
AVI67230.1|3576657_3576948_-	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	78.1	2.4e-37
AVI67231.1|3576956_3577259_-	hypothetical protein	NA	M4M9P7	Vibrio_phage	72.0	4.7e-36
AVI67232.1|3577258_3577474_-	conjugal transfer protein TraR	NA	M4MHG5	Vibrio_phage	54.3	5.5e-15
AVI67233.1|3577473_3578082_-	hypothetical protein	NA	M4MB79	Vibrio_phage	57.2	9.1e-47
AVI67234.1|3578066_3578327_-	hypothetical protein	NA	M4MCR6	Vibrio_phage	54.1	1.3e-18
AVI67235.1|3578326_3578911_-	peptidoglycan-binding protein	NA	A0A2I7S9B9	Vibrio_phage	67.4	7.1e-65
AVI67236.1|3578974_3579463_-	hypothetical protein	NA	NA	NA	NA	NA
AVI67237.1|3579474_3579906_-	transcriptional regulator	NA	M4MHG9	Vibrio_phage	77.1	1.8e-52
AVI67238.1|3579997_3580270_-	hypothetical protein	NA	NA	NA	NA	NA
AVI67239.1|3580270_3580789_-	hypothetical protein	NA	A0A2I7S9B8	Vibrio_phage	57.7	4.9e-49
AVI67240.1|3580781_3580994_-	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	47.0	7.9e-06
AVI67241.1|3581002_3581257_-	hypothetical protein	NA	NA	NA	NA	NA
AVI67242.1|3581266_3581521_-	hypothetical protein	NA	A0A2I7S9D2	Vibrio_phage	53.2	3.5e-16
AVI67243.1|3581562_3581832_-	hypothetical protein	NA	B5AX89	Iodobacteriophage	40.4	9.3e-12
AVI67244.1|3581920_3582592_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	6.1e-28
AVI67245.1|3582584_3582767_-	hypothetical protein	NA	NA	NA	NA	NA
AVI67246.1|3582750_3582987_-	hypothetical protein	NA	M4MCS5	Vibrio_phage	56.8	4.8e-12
AVI67247.1|3582979_3583255_-	hypothetical protein	NA	M1PJ71	Vibrio_phage	69.0	1.8e-26
AVI67248.1|3583257_3583878_-	sulfate transporter	NA	M4MHH7	Vibrio_phage	72.5	1.6e-78
AVI67249.1|3583892_3584213_-	hypothetical protein	NA	NA	NA	NA	NA
AVI67250.1|3584212_3584407_-	hypothetical protein	NA	NA	NA	NA	NA
AVI67251.1|3584408_3584624_-	hypothetical protein	NA	NA	NA	NA	NA
AVI67252.1|3584623_3584878_-	hypothetical protein	NA	NA	NA	NA	NA
AVI67253.1|3584886_3585831_-	DNA transposition protein	NA	M4M9P4	Vibrio_phage	76.4	6.2e-135
AVI67254.1|3585875_3587882_-	DDE endonuclease	NA	A0A2I7S9A8	Vibrio_phage	77.8	2.0e-308
AVI68724.1|3587886_3588111_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	85.1	5.4e-29
AVI67255.1|3588284_3589019_+	transcriptional regulator	NA	A0A2I7S9A5	Vibrio_phage	74.1	1.7e-103
AVI67256.1|3589685_3590225_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	50.3	3.1e-46
>prophage 244
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3612315	3617907	5266746		Klosneuvirus(50.0%)	3	NA	NA
AVI67276.1|3612315_3614466_-	dipeptidyl carboxypeptidase II	NA	A0A1V0SIU1	Klosneuvirus	21.1	4.0e-20
AVI67277.1|3614669_3616769_-	cytochrome C	NA	NA	NA	NA	NA
AVI67278.1|3617310_3617907_+	thymidine kinase	NA	A0A289ZTU3	Serratia_phage	58.7	3.1e-55
>prophage 245
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3626734	3638889	5266746		Klosneuvirus(25.0%)	9	NA	NA
AVI67285.1|3626734_3627658_-	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	35.8	4.9e-44
AVI67286.1|3627659_3629702_-	3-methylcrotonyl-CoA carboxylase	NA	NA	NA	NA	NA
AVI67287.1|3629701_3630583_-	gamma-carboxygeranoyl-CoA hydratase	NA	NA	NA	NA	NA
AVI67288.1|3630632_3632240_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	69.4	8.6e-20
AVI67289.1|3632356_3633526_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVI67290.1|3633666_3634074_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AVI67291.1|3634365_3636324_+	propionyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	32.2	8.2e-65
AVI67292.1|3636621_3636936_+	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
AVI67293.1|3637362_3638889_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QGJ9	Cyanophage	30.7	5.9e-26
>prophage 246
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3653715	3655512	5266746		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AVI67304.1|3653715_3655512_-	histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	32.3	3.2e-07
>prophage 247
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3664573	3671841	5266746		Bacillus_phage(25.0%)	6	NA	NA
AVI67309.1|3664573_3666403_-	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.0	3.1e-29
AVI67310.1|3666575_3668267_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AVI67311.1|3668370_3668928_+	cysteine methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	53.5	5.1e-20
AVI67312.1|3668975_3670259_+	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.4	9.9e-43
AVI67313.1|3670331_3670802_+	protein phosphatase	NA	NA	NA	NA	NA
AVI67314.1|3670941_3671841_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	28.9	3.1e-27
>prophage 248
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3679334	3683647	5266746	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
AVI67323.1|3679334_3680459_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.8	1.8e-93
AVI67324.1|3680486_3680819_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	49.4	2.6e-11
AVI67325.1|3680836_3682687_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
AVI67326.1|3682699_3683647_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.2	1.6e-45
>prophage 249
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3690383	3693626	5266746		Leptospira_phage(100.0%)	1	NA	NA
AVI67333.1|3690383_3693626_-	multidrug transporter AcrB	NA	S5VL66	Leptospira_phage	27.2	4.3e-10
>prophage 250
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3717944	3724247	5266746		Klosneuvirus(50.0%)	5	NA	NA
AVI67352.1|3717944_3720734_-	peptidase M16	NA	A0A1V0SJA4	Klosneuvirus	28.1	1.7e-92
AVI67353.1|3720903_3721374_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AVI67354.1|3721472_3722003_-	endonuclease SmrB	NA	NA	NA	NA	NA
AVI67355.1|3722083_3723028_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVI67356.1|3723152_3724247_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	44.9	3.2e-82
>prophage 251
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3740870	3751097	5266746		Streptococcus_phage(50.0%)	7	NA	NA
AVI67370.1|3740870_3742385_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.1	1.4e-83
AVI67371.1|3742512_3743991_-	sodium:alanine symporter	NA	NA	NA	NA	NA
AVI67372.1|3744258_3744546_-	hypothetical protein	NA	NA	NA	NA	NA
AVI67373.1|3744712_3746812_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	32.8	4.1e-38
AVI67374.1|3747022_3748312_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVI67375.1|3748567_3749212_+	hypothetical protein	NA	A0A1X9I5D3	Streptococcus_phage	29.2	4.1e-21
AVI67376.1|3749357_3751097_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.7	1.3e-26
>prophage 252
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3760672	3761485	5266746		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVI67385.1|3760672_3761485_-	exodeoxyribonuclease III	NA	A0A0N9QXX6	Chrysochromulina_ericina_virus	27.1	9.4e-15
>prophage 253
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3775588	3777234	5266746		Acinetobacter_phage(100.0%)	2	NA	NA
AVI67398.1|3775588_3776635_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.9	3.7e-64
AVI67399.1|3776631_3777234_-	anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	43.8	7.9e-35
>prophage 254
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3781748	3782345	5266746		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVI67402.1|3781748_3782345_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.6	6.0e-27
>prophage 255
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3788021	3791719	5266746	protease	Bodo_saltans_virus(50.0%)	4	NA	NA
AVI67407.1|3788021_3789038_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.2	1.0e-21
AVI67408.1|3789125_3790193_-	hypothetical protein	NA	NA	NA	NA	NA
AVI67409.1|3790338_3790938_-	arylesterase	NA	NA	NA	NA	NA
AVI67410.1|3790990_3791719_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	9.9e-32
>prophage 256
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3807049	3809332	5266746		Tetraselmis_virus(100.0%)	1	NA	NA
AVI68733.1|3807049_3809332_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	3.0e-167
>prophage 257
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3819055	3819814	5266746	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
AVI67432.1|3819055_3819814_-|transposase	IS5 family transposase ISSod6	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.4	7.9e-16
>prophage 258
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3823991	3826643	5266746		Acinetobacter_phage(100.0%)	1	NA	NA
AVI67434.1|3823991_3826643_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.6	1.5e-53
>prophage 259
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3829718	3830687	5266746		Streptococcus_phage(100.0%)	1	NA	NA
AVI67437.1|3829718_3830687_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	48.9	2.2e-66
>prophage 260
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3841537	3843595	5266746		Serratia_phage(100.0%)	1	NA	NA
AVI67441.1|3841537_3843595_+	DNA ligase (NAD(+)) LigA	NA	A0A289ZTZ3	Serratia_phage	50.0	2.6e-138
>prophage 261
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3850225	3852073	5266746		Macacine_betaherpesvirus(100.0%)	1	NA	NA
AVI67448.1|3850225_3852073_+	cyclic nucleotide-binding protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	30.0	9.6e-07
>prophage 262
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3877128	3882836	5266746		Hokovirus(50.0%)	2	NA	NA
AVI67464.1|3877128_3880560_+	hypothetical protein	NA	A0A1V0SGX0	Hokovirus	26.3	2.0e-37
AVI67465.1|3880643_3882836_-	peptidase M3	NA	A0A1V0SID3	Klosneuvirus	25.1	3.6e-45
>prophage 263
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3894057	3894543	5266746		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AVI67473.1|3894057_3894543_+	hypothetical protein	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	33.1	5.6e-15
>prophage 264
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3903298	3905011	5266746		Staphylococcus_phage(100.0%)	1	NA	NA
AVI67482.1|3903298_3905011_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.5	1.1e-28
>prophage 265
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3910025	3913467	5266746		Klosneuvirus(33.33%)	3	NA	NA
AVI67488.1|3910025_3910739_+	NUDIX hydrolase	NA	A0A1V0SIB1	Klosneuvirus	31.0	2.3e-09
AVI67489.1|3911096_3911984_+	ribose-phosphate pyrophosphokinase	NA	A0A2H4YGS6	Raoultella_phage	40.7	2.7e-39
AVI67490.1|3911994_3913467_+	nicotinate phosphoribosyltransferase	NA	A0A249Y1N9	Staphylococcus_phage	53.2	4.2e-146
>prophage 266
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3918165	3919110	5266746		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AVI67495.1|3918165_3919110_+	chemotaxis protein CheW	NA	Q56AR1	Bacillus_thuringiensis_phage	29.3	3.4e-32
>prophage 267
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3928607	3931268	5266746		Acinetobacter_phage(100.0%)	1	NA	NA
AVI67503.1|3928607_3931268_+	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	25.8	1.5e-45
>prophage 268
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3936274	3940166	5266746		Klosneuvirus(50.0%)	2	NA	NA
AVI67511.1|3936274_3936826_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.8	1.7e-28
AVI67512.1|3936863_3940166_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.4	5.1e-43
>prophage 269
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3946813	3948739	5266746		Tupanvirus(100.0%)	1	NA	NA
AVI67518.1|3946813_3948739_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	9.3e-53
>prophage 270
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3954268	3956266	5266746		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVI67521.1|3954268_3956266_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	1.0e-22
>prophage 271
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3971298	3972057	5266746	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
AVI67534.1|3971298_3972057_+|transposase	IS5 family transposase ISSod6	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.4	7.9e-16
>prophage 272
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3976669	3978583	5266746		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVI67537.1|3976669_3978583_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	35.6	1.4e-112
>prophage 273
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3983479	3992407	5266746		Vibrio_phage(28.57%)	16	NA	NA
AVI67543.1|3983479_3984310_+	NAD(+) synthase	NA	G3MA24	Bacillus_virus	47.8	2.6e-60
AVI67544.1|3984427_3984928_-	hypothetical protein	NA	NA	NA	NA	NA
AVI67545.1|3985149_3986679_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVI67546.1|3987227_3988412_-	recombinase	NA	A0A2D1GN00	Marinobacter_phage	28.1	5.7e-29
AVI67547.1|3988417_3988645_-	hypothetical protein	NA	NA	NA	NA	NA
AVI67548.1|3988657_3988861_-	hypothetical protein	NA	NA	NA	NA	NA
AVI67549.1|3988857_3989166_-	hypothetical protein	NA	A0A2D0YGQ8	Vibrio_phage	52.6	6.1e-23
AVI67550.1|3989162_3989348_-	hypothetical protein	NA	NA	NA	NA	NA
AVI67551.1|3989344_3989659_-	hypothetical protein	NA	NA	NA	NA	NA
AVI67552.1|3989655_3989976_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	38.3	8.5e-12
AVI67553.1|3989972_3990587_-	hypothetical protein	NA	A0A2R3UAL4	Myoviridae_environmental_samples	35.5	1.1e-07
AVI67554.1|3990583_3990814_-	hypothetical protein	NA	NA	NA	NA	NA
AVI67555.1|3990810_3991089_-	hypothetical protein	NA	NA	NA	NA	NA
AVI67556.1|3991089_3991383_-	hypothetical protein	NA	NA	NA	NA	NA
AVI67557.1|3991379_3992081_-	hypothetical protein	NA	A0A059WLH8	Vibrio_phage	40.8	1.1e-40
AVI67558.1|3992077_3992407_-	hypothetical protein	NA	G4W935	Tetrasphaera_phage	53.8	3.5e-29
>prophage 274
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	3997920	4005929	5266746	integrase	Vibrio_phage(42.86%)	12	3997667:3997680	4004779:4004792
3997667:3997680	attL	CAAATGATTGTTTT	NA	NA	NA	NA
AVI67566.1|3997920_3998610_-	XRE family transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	47.4	4.5e-58
AVI67567.1|3998715_3998910_+	Cro/Cl family transcriptional regulator	NA	R9TPV3	Vibrio_phage	48.9	6.1e-05
AVI67568.1|3998953_3999577_+	hypothetical protein	NA	NA	NA	NA	NA
AVI68747.1|3999582_3999909_+	hypothetical protein	NA	G8CTB7	Vibrio_phage	38.4	8.4e-07
AVI67569.1|4000074_4000812_+	hypothetical protein	NA	NA	NA	NA	NA
AVI67570.1|4000955_4001813_+	transcriptional regulator	NA	A5LH71	Enterobacteria_phage	45.8	8.6e-35
AVI67571.1|4001809_4002493_+	replication protein P	NA	I6PBN0	Cronobacter_phage	28.9	3.4e-10
AVI67572.1|4002482_4002707_+	hypothetical protein	NA	NA	NA	NA	NA
AVI67573.1|4002707_4003976_+|integrase	integrase	integrase	A0A067ZJC5	Vibrio_phage	33.1	8.8e-44
AVI67574.1|4004036_4004252_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVI67575.1|4004241_4004601_+	hypothetical protein	NA	NA	NA	NA	NA
AVI67576.1|4004969_4005929_-	recombinase XerD	NA	A0A1P8DJJ6	Virus_Rctr41k	40.4	2.4e-54
4004779:4004792	attR	CAAATGATTGTTTT	NA	NA	NA	NA
>prophage 275
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4043542	4045216	5266746		Staphylococcus_phage(100.0%)	1	NA	NA
AVI67612.1|4043542_4045216_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	3.5e-32
>prophage 276
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4051400	4055087	5266746	tRNA	Bodo_saltans_virus(50.0%)	3	NA	NA
AVI68751.1|4051400_4052384_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.4	3.2e-33
AVI67619.1|4052399_4054787_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AVI67620.1|4054790_4055087_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	37.8	1.3e-11
>prophage 277
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4068998	4069466	5266746		Streptomyces_phage(100.0%)	1	NA	NA
AVI67632.1|4068998_4069466_+	redoxin	NA	A0A1J0GW78	Streptomyces_phage	38.8	2.3e-05
>prophage 278
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4097151	4099170	5266746		Streptococcus_phage(100.0%)	1	NA	NA
AVI67651.1|4097151_4099170_+	K(+)-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	27.4	2.9e-33
>prophage 279
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4104805	4108687	5266746		Catovirus(100.0%)	1	NA	NA
AVI67657.1|4104805_4108687_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	33.3	6.6e-58
>prophage 280
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4114037	4117999	5266746	tRNA	Powai_lake_megavirus(50.0%)	4	NA	NA
AVI67663.1|4114037_4115438_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.6	2.5e-79
AVI67664.1|4115588_4115924_+	hypothetical protein	NA	NA	NA	NA	NA
AVI67665.1|4115967_4116555_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
AVI67666.1|4116586_4117999_-	aminodeoxychorismate synthase, component I	NA	S4VNU7	Pandoravirus	44.7	2.3e-48
>prophage 281
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4122338	4122776	5266746	transposase	Clostridium_botulinum_C_phage(100.0%)	1	NA	NA
AVI67668.1|4122338_4122776_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	40.0	1.6e-21
>prophage 282
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4133895	4136607	5266746		Lactobacillus_phage(100.0%)	1	NA	NA
AVI67676.1|4133895_4136607_-	DNA primase	NA	Q9T1H6	Lactobacillus_phage	28.5	2.2e-60
>prophage 283
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4140782	4141337	5266746	integrase	Clostridium_phage(100.0%)	1	4135779:4135791	4141419:4141431
4135779:4135791	attL	CTGTGGTATTAAT	NA	NA	NA	NA
AVI67684.1|4140782_4141337_+|integrase	integrase	integrase	M9Q1K0	Clostridium_phage	47.3	3.1e-33
AVI67684.1|4140782_4141337_+|integrase	integrase	integrase	M9Q1K0	Clostridium_phage	47.3	3.1e-33
4141419:4141431	attR	CTGTGGTATTAAT	NA	NA	NA	NA
>prophage 284
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4148299	4149703	5266746		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVI67692.1|4148299_4149703_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	4.5e-57
>prophage 285
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4155766	4156204	5266746	transposase	Clostridium_botulinum_C_phage(100.0%)	1	NA	NA
AVI67698.1|4155766_4156204_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	40.0	1.6e-21
>prophage 286
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4160907	4162177	5266746		Salmonella_phage(50.0%)	2	NA	NA
AVI67703.1|4160907_4161378_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.3	9.5e-52
AVI67704.1|4161448_4162177_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	46.9	2.2e-39
>prophage 287
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4199886	4203023	5266746	transposase,tRNA	Shigella_phage(50.0%)	2	NA	NA
AVI67722.1|4199886_4201063_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	64.8	3.9e-118
AVI67723.1|4201826_4203023_+|tRNA	threonine--tRNA ligase	tRNA	A0A1V0SKZ9	Klosneuvirus	36.5	3.2e-80
>prophage 288
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4278576	4280369	5266746	integrase	Fusobacterium_phage(50.0%)	3	4276385:4276398	4280746:4280759
4276385:4276398	attL	GATGGGGCAGTTTT	NA	NA	NA	NA
AVI67775.1|4278576_4278813_-	transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	40.0	5.1e-06
AVI68762.1|4278959_4279181_+	hypothetical protein	NA	NA	NA	NA	NA
AVI67776.1|4279190_4280369_+|integrase	site-specific integrase	integrase	Q76UT6	Pseudomonas_virus	30.0	2.8e-15
4280746:4280759	attR	GATGGGGCAGTTTT	NA	NA	NA	NA
>prophage 289
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4311616	4312108	5266746		Synechococcus_phage(100.0%)	1	NA	NA
AVI67796.1|4311616_4312108_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.0	2.4e-13
>prophage 290
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4327164	4338089	5266746		Bacillus_virus(33.33%)	6	NA	NA
AVI67806.1|4327164_4329429_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	37.1	6.5e-21
AVI67807.1|4329636_4330650_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AVI67808.1|4330971_4331442_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVI68763.1|4331606_4331999_-	hypothetical protein	NA	NA	NA	NA	NA
AVI67809.1|4332093_4334295_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	23.6	3.6e-16
AVI67810.1|4334291_4338089_-	exodeoxyribonuclease V subunit beta	NA	S5M596	Bacillus_phage	22.7	1.5e-06
>prophage 291
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4347425	4351007	5266746		Bacillus_phage(50.0%)	2	NA	NA
AVI67816.1|4347425_4349351_-	lytic transglycosylase	NA	A0A0A0RVE6	Bacillus_phage	35.2	4.2e-13
AVI67817.1|4349432_4351007_-	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	42.4	4.5e-05
>prophage 292
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4367692	4369255	5266746		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVI67831.1|4367692_4368415_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	60.8	5.3e-78
AVI67832.1|4368586_4369255_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	35.8	2.3e-14
>prophage 293
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4376324	4376915	5266746		Acinetobacter_phage(100.0%)	1	NA	NA
AVI67839.1|4376324_4376915_+	DNA endonuclease SmrA	NA	A0A0P0IDT4	Acinetobacter_phage	30.9	1.4e-12
>prophage 294
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4385058	4386531	5266746		Cyanophage(100.0%)	1	NA	NA
AVI67845.1|4385058_4386531_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.5	9.5e-82
>prophage 295
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4400314	4401091	5266746		Mycobacterium_phage(100.0%)	1	NA	NA
AVI67858.1|4400314_4401091_-	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	32.5	4.3e-09
>prophage 296
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4417063	4420841	5266746	tRNA	Streptococcus_phage(50.0%)	4	NA	NA
AVI68765.1|4417063_4417984_-	hypothetical protein	NA	A1IMD5	Streptococcus_phage	29.0	2.7e-26
AVI67871.1|4418294_4419107_+	glucosaminidase	NA	NA	NA	NA	NA
AVI67872.1|4419099_4419723_+	hypothetical protein	NA	NA	NA	NA	NA
AVI68766.1|4419908_4420841_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	73.9	3.7e-108
>prophage 297
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4423894	4426294	5266746		uncultured_virus(100.0%)	1	NA	NA
AVI67877.1|4423894_4426294_-	ATPase P	NA	A0A218MNH6	uncultured_virus	29.7	2.9e-72
>prophage 298
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4436921	4439429	5266746		uncultured_virus(100.0%)	1	NA	NA
AVI67889.1|4436921_4439429_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.6	1.0e-96
>prophage 299
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4444147	4445314	5266746		Leptospira_phage(100.0%)	1	NA	NA
AVI67892.1|4444147_4445314_-	efflux transporter periplasmic adaptor subunit	NA	S5VL44	Leptospira_phage	28.1	1.1e-08
>prophage 300
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4451004	4470911	5266746	tRNA	uncultured_Caudovirales_phage(27.27%)	23	NA	NA
AVI67896.1|4451004_4452276_-	Bcr/CflA family multidrug efflux transporter	NA	S4TR35	Salmonella_phage	23.6	3.5e-16
AVI67897.1|4452391_4453294_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVI67898.1|4453633_4454293_+	BAX inhibitor (BI)-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	43.9	2.5e-34
AVI67899.1|4454362_4454752_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.4	3.9e-19
AVI67900.1|4454766_4455123_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
AVI67901.1|4455122_4455404_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
AVI67902.1|4455397_4455736_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
AVI67903.1|4455835_4455958_-	hypothetical protein	NA	NA	NA	NA	NA
AVI67904.1|4455977_4457264_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.0	2.3e-100
AVI67905.1|4457282_4457657_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	35.6	1.1e-05
AVI67906.1|4457649_4458981_-	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	38.3	2.2e-77
AVI67907.1|4458989_4459616_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AVI67908.1|4459671_4462437_-	cell division protein FtsK	NA	S5VNE3	Mycobacterium_phage	48.8	6.6e-84
AVI67909.1|4462778_4463285_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
AVI67910.1|4463464_4464580_+	alanine dehydrogenase	NA	NA	NA	NA	NA
AVI67911.1|4464899_4465853_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.8	7.8e-61
AVI67912.1|4466152_4466509_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVI67913.1|4466525_4466720_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVI67914.1|4466804_4467347_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	37.1	3.4e-13
AVI67915.1|4467350_4469279_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	5.5e-130
AVI67916.1|4469570_4469804_+	hypothetical protein	NA	NA	NA	NA	NA
AVI67917.1|4470052_4470253_+	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
AVI67918.1|4470287_4470911_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	39.1	7.7e-25
>prophage 301
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4476622	4477381	5266746	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
AVI67926.1|4476622_4477381_+|transposase	IS5 family transposase ISSod6	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.4	7.9e-16
>prophage 302
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4484593	4485628	5266746		Bacillus_virus(100.0%)	1	NA	NA
AVI67932.1|4484593_4485628_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	29.5	1.7e-13
>prophage 303
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4492924	4494535	5266746		Tupanvirus(100.0%)	1	NA	NA
AVI67936.1|4492924_4494535_+	ABC-F family ATPase	NA	A0A2K9L3Z8	Tupanvirus	27.2	2.8e-50
>prophage 304
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4499119	4500754	5266746		Bacillus_phage(100.0%)	1	NA	NA
AVI67943.1|4499119_4500754_+	diguanylate cyclase response regulator	NA	A0A127AWB9	Bacillus_phage	34.7	2.4e-17
>prophage 305
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4508065	4511618	5266746		Bacillus_thuringiensis_phage(50.0%)	4	NA	NA
AVI67949.1|4508065_4508431_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	38.5	6.1e-14
AVI67950.1|4508434_4510168_-	fused response regulator/phosphatase	NA	NA	NA	NA	NA
AVI67951.1|4510176_4510461_-	anti-sigma factor antagonist	NA	NA	NA	NA	NA
AVI67952.1|4510475_4511618_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.7	5.8e-10
>prophage 306
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4523444	4525433	5266746		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AVI67961.1|4523444_4525433_-	recombinase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	38.3	4.2e-56
>prophage 307
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4545105	4545393	5266746		Bacillus_virus(100.0%)	1	NA	NA
AVI67978.1|4545105_4545393_-	integration host factor subunit beta	NA	G3M9Y0	Bacillus_virus	37.2	7.9e-09
>prophage 308
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4555097	4569713	5266746		Pseudomonas_phage(33.33%)	9	NA	NA
AVI67986.1|4555097_4556189_-	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	45.7	1.2e-81
AVI68771.1|4556324_4559075_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.1	1.0e-108
AVI67987.1|4559460_4560171_+	bifunctional 3-demethylubiquinol 3-O-methyltransferase/2-polyprenyl-6-hydroxyphenol methylase	NA	NA	NA	NA	NA
AVI67988.1|4560172_4560844_+	HAD family hydrolase	NA	NA	NA	NA	NA
AVI67989.1|4561347_4563636_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	68.1	8.4e-311
AVI67990.1|4563710_4564841_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	72.5	9.6e-159
AVI68772.1|4564878_4565304_+	ferredoxin	NA	G9IAA2	Pseudomonas_phage	45.3	1.5e-11
AVI67991.1|4565681_4567700_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
AVI67992.1|4567865_4569713_+	signal peptide peptidase SppA	NA	K4HZZ6	Acidithiobacillus_phage	28.6	3.3e-15
>prophage 309
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4573129	4585637	5266746	tRNA	Bacillus_phage(20.0%)	8	NA	NA
AVI67997.1|4573129_4573810_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	31.4	8.4e-25
AVI67998.1|4574033_4576553_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.5	2.8e-41
AVI67999.1|4577555_4578560_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	33.3	1.8e-07
AVI68000.1|4578607_4579225_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AVI68001.1|4579221_4579743_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
AVI68002.1|4579846_4580593_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AVI68003.1|4580863_4582642_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	27.6	5.3e-10
AVI68004.1|4582826_4585637_-	deoxyguanosine kinase	NA	G3MA91	Bacillus_virus	32.6	4.7e-21
>prophage 310
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4595808	4596711	5266746		Indivirus(100.0%)	1	NA	NA
AVI68015.1|4595808_4596711_-	thiamine biosynthesis protein ThiF	NA	A0A1V0SCZ9	Indivirus	30.9	9.5e-08
>prophage 311
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4604596	4605127	5266746		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVI68021.1|4604596_4605127_-	NUDIX domain-containing protein	NA	A0A2H4J8B3	uncultured_Caudovirales_phage	46.7	8.3e-28
>prophage 312
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4619877	4628040	5266746		uncultured_virus(25.0%)	7	NA	NA
AVI68031.1|4619877_4620297_+	UV protection and mutation protein	NA	A0A218MND2	uncultured_virus	50.7	3.3e-32
AVI68032.1|4620293_4621568_+	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	56.2	2.1e-130
AVI68033.1|4622044_4623202_-	cupin	NA	NA	NA	NA	NA
AVI68034.1|4623421_4624048_+	DNA polymerase III subunit epsilon	NA	A0A0A7RWA3	Clostridium_phage	32.8	6.8e-21
AVI68035.1|4624165_4625212_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AVI68036.1|4625316_4626045_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68037.1|4626402_4628040_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.6	2.6e-40
>prophage 313
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4639447	4640635	5266746		uncultured_marine_virus(100.0%)	1	NA	NA
AVI68051.1|4639447_4640635_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A0F7LAY0	uncultured_marine_virus	30.1	1.1e-24
>prophage 314
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4646375	4648133	5266746		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVI68059.1|4646375_4648133_-	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.2	4.9e-16
>prophage 315
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4654663	4664959	5266746		Yellowstone_lake_phycodnavirus(12.5%)	13	NA	NA
AVI68065.1|4654663_4656382_+	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.2	5.5e-57
AVI68066.1|4656381_4656876_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
AVI68067.1|4656975_4657419_-	heat-shock protein	NA	A0A2L0V0Y9	Agrobacterium_phage	47.8	1.8e-20
AVI68068.1|4657779_4658211_-	nucleoside-diphosphate kinase	NA	K7YW26	Megavirus	40.2	1.1e-17
AVI68069.1|4658408_4658576_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68070.1|4658793_4658991_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AVI68774.1|4659104_4660010_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	33.6	9.4e-40
AVI68071.1|4660167_4660506_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AVI68072.1|4660514_4662377_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.2	1.4e-101
AVI68073.1|4662444_4662969_-	co-chaperone protein HscB	NA	NA	NA	NA	NA
AVI68074.1|4662985_4663309_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	46.3	1.8e-22
AVI68075.1|4663323_4663707_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	76.6	2.2e-51
AVI68076.1|4663744_4664959_-	cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	31.2	9.7e-32
>prophage 316
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4669935	4670631	5266746		Planktothrix_phage(100.0%)	1	NA	NA
AVI68082.1|4669935_4670631_-	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	39.7	2.3e-38
>prophage 317
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4688610	4689750	5266746		Synechococcus_phage(100.0%)	1	NA	NA
AVI68095.1|4688610_4689750_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	31.1	3.6e-36
>prophage 318
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4694322	4702712	5266746	transposase	Acinetobacter_phage(33.33%)	6	NA	NA
AVI68100.1|4694322_4696311_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	31.5	1.0e-17
AVI68101.1|4696846_4697137_+	cytochrome C	NA	NA	NA	NA	NA
AVI68775.1|4697374_4699276_-	helicase	NA	A0A127AW80	Bacillus_phage	33.4	5.7e-87
AVI68102.1|4699813_4700317_+	hypothetical protein	NA	NA	NA	NA	NA
AVI68103.1|4700459_4701437_+|transposase	transposase	transposase	NA	NA	NA	NA
AVI68776.1|4702190_4702712_+	hypothetical protein	NA	A0A1L5C2A2	Pseudoalteromonas_phage	58.5	1.2e-07
>prophage 319
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4709072	4711341	5266746		Bodo_saltans_virus(100.0%)	3	NA	NA
AVI68108.1|4709072_4709810_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	A0A2H4UVM0	Bodo_saltans_virus	24.9	8.0e-05
AVI68109.1|4709791_4710565_+	imidazole glycerol phosphate synthase cyclase subunit	NA	NA	NA	NA	NA
AVI68110.1|4710699_4711341_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase	NA	A0A2H4UVM0	Bodo_saltans_virus	33.9	6.5e-19
>prophage 320
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4733850	4738533	5266746		Acinetobacter_phage(50.0%)	2	NA	NA
AVI68125.1|4733850_4736400_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.0	2.6e-18
AVI68126.1|4736484_4738533_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.8	5.0e-89
>prophage 321
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4749814	4756921	5266746	tRNA	Catovirus(50.0%)	7	NA	NA
AVI68138.1|4749814_4750441_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	34.7	1.1e-26
AVI68139.1|4750463_4751501_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
AVI68140.1|4751497_4752307_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
AVI68141.1|4752312_4752894_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.1	2.6e-27
AVI68142.1|4752925_4753564_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.0	1.6e-33
AVI68778.1|4753575_4754691_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
AVI68143.1|4754851_4756921_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	23.4	7.4e-24
>prophage 322
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4761468	4764489	5266746	protease	Agrobacterium_phage(33.33%)	3	NA	NA
AVI68150.1|4761468_4763736_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	9.6e-166
AVI68151.1|4763779_4764088_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.1e-13
AVI68152.1|4764282_4764489_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	60.3	4.3e-17
>prophage 323
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4770797	4774017	5266746	transposase	Bodo_saltans_virus(50.0%)	3	NA	NA
AVI68157.1|4770797_4772168_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.6	1.5e-110
AVI68780.1|4772320_4773460_+	cupin	NA	NA	NA	NA	NA
AVI68158.1|4773579_4774017_-|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	40.0	1.6e-21
>prophage 324
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4781008	4786207	5266746		Hokovirus(33.33%)	4	NA	NA
AVI68164.1|4781008_4783378_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.8	1.1e-177
AVI68165.1|4783502_4784315_+	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AVI68166.1|4784497_4785562_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	47.1	4.4e-81
AVI68782.1|4785757_4786207_+	acyl-CoA thioesterase	NA	A0A292GK23	Xanthomonas_phage	39.4	4.7e-08
>prophage 325
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4789372	4792015	5266746		Catovirus(100.0%)	1	NA	NA
AVI68170.1|4789372_4792015_-	DNA topoisomerase I subunit omega	NA	A0A1V0SB35	Catovirus	34.4	7.2e-88
>prophage 326
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4800515	4801211	5266746		Synechococcus_phage(100.0%)	1	NA	NA
AVI68177.1|4800515_4801211_-	proline hydroxylase	NA	R9TLF0	Synechococcus_phage	55.0	3.6e-23
>prophage 327
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4805004	4808783	5266746		Vibrio_phage(50.0%)	5	NA	NA
AVI68182.1|4805004_4805736_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	31.1	1.5e-19
AVI68183.1|4805993_4806425_+	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
AVI68184.1|4806508_4807006_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVI68185.1|4807101_4807509_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
AVI68186.1|4807910_4808783_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	32.4	2.2e-17
>prophage 328
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4820621	4826917	5266746		Leptospira_phage(100.0%)	2	NA	NA
AVI68196.1|4820621_4823873_+	acriflavin resistance protein	NA	S5VTK5	Leptospira_phage	29.7	5.8e-124
AVI68197.1|4823869_4826917_+	acriflavin resistance protein	NA	S5VTK5	Leptospira_phage	24.9	1.6e-70
>prophage 329
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4833937	4838702	5266746		Microbacterium_phage(33.33%)	4	NA	NA
AVI68784.1|4833937_4834858_-	peptidase	NA	A0A2R3ZZL7	Microbacterium_phage	40.6	9.1e-06
AVI68205.1|4835174_4836047_-	hypothetical protein	NA	I6W6Z1	Vibriophage	28.8	5.9e-15
AVI68206.1|4836516_4837515_+	cytochrome C biogenesis protein CcsA	NA	NA	NA	NA	NA
AVI68207.1|4837673_4838702_-	nucleoid-associated protein	NA	A0A1V0E8C0	Vibrio_phage	35.7	3.8e-61
>prophage 330
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4845636	4847406	5266746		Lactobacillus_phage(100.0%)	1	NA	NA
AVI68212.1|4845636_4847406_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	35.0	6.8e-50
>prophage 331
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4861350	4862340	5266746		Escherichia_phage(100.0%)	1	NA	NA
AVI68223.1|4861350_4862340_+	hypothetical protein	NA	K7QKE8	Escherichia_phage	34.1	6.3e-37
>prophage 332
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4872060	4881653	5266746		uncultured_Caudovirales_phage(25.0%)	12	NA	NA
AVI68232.1|4872060_4873701_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.2	2.6e-19
AVI68233.1|4874434_4874791_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68234.1|4874780_4874996_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVI68235.1|4876275_4876500_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68236.1|4876489_4877173_-	replication protein P	NA	I6PBN0	Cronobacter_phage	28.9	3.4e-10
AVI68237.1|4877169_4878027_-	transcriptional regulator	NA	A5LH71	Enterobacteria_phage	45.8	8.6e-35
AVI68238.1|4878187_4878451_+	hypothetical protein	NA	NA	NA	NA	NA
AVI68239.1|4878601_4879339_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68240.1|4879501_4879828_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68241.1|4879833_4880457_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68242.1|4880641_4880875_-	transcriptional regulator	NA	NA	NA	NA	NA
AVI68786.1|4880987_4881653_+	LexA family transcriptional repressor	NA	A0A286S2B2	Klebsiella_phage	55.5	3.8e-62
>prophage 333
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4887079	4897438	5266746	integrase	Vibrio_phage(25.0%)	17	4881899:4881912	4892945:4892958
4881899:4881912	attL	TTCATTAATGCTGT	NA	NA	NA	NA
AVI68249.1|4887079_4887724_+	hypothetical protein	NA	A0A1V0E8F0	Vibrio_phage	47.2	4.3e-39
AVI68250.1|4887720_4888014_+	hypothetical protein	NA	NA	NA	NA	NA
AVI68251.1|4888014_4888293_+	hypothetical protein	NA	NA	NA	NA	NA
AVI68252.1|4888289_4888520_+	hypothetical protein	NA	NA	NA	NA	NA
AVI68253.1|4888516_4889125_+	hypothetical protein	NA	A0A2R3UAL4	Myoviridae_environmental_samples	36.2	7.1e-07
AVI68254.1|4889121_4889442_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	38.3	1.0e-12
AVI68255.1|4889438_4889753_+	hypothetical protein	NA	NA	NA	NA	NA
AVI68256.1|4889749_4889935_+	hypothetical protein	NA	NA	NA	NA	NA
AVI68257.1|4889931_4890288_+	hypothetical protein	NA	A0A2D0YGQ8	Vibrio_phage	51.5	2.7e-22
AVI68258.1|4890284_4890515_+	hypothetical protein	NA	NA	NA	NA	NA
AVI68259.1|4890504_4891689_+|integrase	integrase	integrase	O21925	Phage_21	39.7	7.4e-69
AVI68260.1|4892268_4893339_+	restriction endonuclease	NA	A0A1S5SAB0	Streptococcus_phage	39.0	4.5e-65
4892945:4892958	attR	ACAGCATTAATGAA	NA	NA	NA	NA
AVI68261.1|4893409_4894321_-	DNA ligase	NA	A0A1X9VNU1	Mimivirus	32.9	4.7e-31
AVI68262.1|4894600_4894972_+	diacylglycerol kinase	NA	NA	NA	NA	NA
AVI68263.1|4894982_4895852_-	HTH-type transcriptional regulator HdfR	NA	NA	NA	NA	NA
AVI68264.1|4895960_4896410_+	DUF413 family protein	NA	NA	NA	NA	NA
AVI68265.1|4896430_4897438_+	alpha-L-glutamate ligase	NA	A0A1D7SYT2	Cyanophage	46.2	1.0e-74
>prophage 334
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4902501	4904808	5266746		Tupanvirus(100.0%)	1	NA	NA
AVI68269.1|4902501_4904808_-	marine proteobacterial sortase target protein	NA	A0A2K9L4P5	Tupanvirus	21.5	4.1e-23
>prophage 335
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4917441	4917726	5266746		Hokovirus(100.0%)	1	NA	NA
AVI68277.1|4917441_4917726_+	molecular chaperone DnaJ	NA	A0A1V0SGX8	Hokovirus	40.0	3.3e-07
>prophage 336
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4934805	4971175	5266746	portal,capsid,tail,transposase,terminase,integrase	Pseudoalteromonas_phage(54.29%)	50	4934107:4934121	4969549:4969563
4934107:4934121	attL	AAAACACCCTATTTT	NA	NA	NA	NA
AVI68293.1|4934805_4935003_-	hypothetical protein	NA	A0A2I7RNJ8	Vibrio_phage	64.6	2.8e-13
AVI68294.1|4935014_4935710_-	hypothetical protein	NA	A0A2I7RNK2	Vibrio_phage	61.6	1.8e-70
AVI68295.1|4935712_4936402_-	hypothetical protein	NA	A0A2I7RNK1	Vibrio_phage	48.9	9.9e-66
AVI68296.1|4936401_4936929_-	adenine glycosylase	NA	A0A1L5C2B6	Pseudoalteromonas_phage	70.6	1.3e-41
AVI68297.1|4936931_4937153_-	hypothetical protein	NA	A0A2I7RA84	Vibrio_phage	56.6	4.2e-10
AVI68298.1|4937294_4938368_-	hypothetical protein	NA	A0A2I7RA84	Vibrio_phage	50.1	2.1e-91
AVI68299.1|4938471_4939230_-|transposase	IS5 family transposase ISSod6	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.4	7.9e-16
AVI68300.1|4940364_4940997_-	hypothetical protein	NA	A0A1L5C2C5	Pseudoalteromonas_phage	64.8	8.0e-62
AVI68301.1|4940993_4942196_-	hypothetical protein	NA	A0A1L5C2D1	Pseudoalteromonas_phage	75.1	2.0e-170
AVI68302.1|4942196_4942532_-	hypothetical protein	NA	A0A1L5C2D6	Pseudoalteromonas_phage	70.6	1.2e-37
AVI68303.1|4942528_4944343_-|tail	phage tail tape measure protein	tail	A0A1L5C2B2	Pseudoalteromonas_phage	38.3	1.6e-110
AVI68304.1|4944545_4944812_-	hypothetical protein	NA	A0A1L5C2C7	Pseudoalteromonas_phage	69.3	1.3e-26
AVI68305.1|4944808_4945075_-	hypothetical protein	NA	A0A1L5C2D5	Pseudoalteromonas_phage	53.1	1.2e-14
AVI68306.1|4945078_4945654_-	hypothetical protein	NA	A0A1L5C2C2	Pseudoalteromonas_phage	64.7	2.0e-56
AVI68307.1|4945663_4946209_-	peptidase	NA	A0A1L5C2A4	Pseudoalteromonas_phage	60.0	1.3e-49
AVI68308.1|4946216_4946417_-	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AVI68309.1|4946447_4946897_-	DUF2597 domain-containing protein	NA	A0A1L5C2D0	Pseudoalteromonas_phage	81.9	2.7e-64
AVI68310.1|4946909_4948016_-|tail	phage tail protein	tail	A0A1L5C2B3	Pseudoalteromonas_phage	76.8	2.1e-158
AVI68311.1|4948018_4948783_-	hypothetical protein	NA	A0A0U4ISN1	Pseudomonas_phage	32.5	2.7e-11
AVI68312.1|4948779_4949247_-	hypothetical protein	NA	A0A1L5C2C9	Pseudoalteromonas_phage	45.2	5.2e-34
AVI68313.1|4949243_4949705_-	hypothetical protein	NA	A0A1L5C2A5	Pseudoalteromonas_phage	68.7	1.3e-50
AVI68314.1|4949830_4950481_-	hypothetical protein	NA	A0A1L5C2B7	Pseudoalteromonas_phage	70.9	4.8e-70
AVI68315.1|4950522_4951143_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68316.1|4951239_4952268_-|capsid	phage major capsid protein, P2 family	capsid	A0A1L5C2B0	Pseudoalteromonas_phage	71.2	1.7e-138
AVI68317.1|4952324_4953266_-|capsid	capsid protein	capsid	A0A1L5C292	Pseudoalteromonas_phage	57.4	2.9e-76
AVI68318.1|4953470_4955279_+|terminase	terminase	terminase	A0A1L5C295	Pseudoalteromonas_phage	79.5	8.7e-287
AVI68319.1|4955260_4956034_+	hypothetical protein	NA	A0A1L5C295	Pseudoalteromonas_phage	41.5	1.2e-51
AVI68320.1|4956039_4957089_+|portal	phage portal protein	portal	A0A1L5C2C1	Pseudoalteromonas_phage	74.8	2.1e-139
AVI68321.1|4957208_4957457_+	transcriptional regulator	NA	R9TNQ2	Vibrio_phage	58.0	1.2e-21
AVI68322.1|4957820_4958111_+	hypothetical protein	NA	NA	NA	NA	NA
AVI68323.1|4958155_4958395_-	hypothetical protein	NA	R9TMR5	Vibrio_phage	74.2	3.1e-19
AVI68324.1|4958443_4958782_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68325.1|4958778_4958970_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68326.1|4958989_4959688_-	DNA methylase	NA	A0A0M4S5U3	Salmonella_phage	49.1	2.9e-57
AVI68327.1|4959806_4959998_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68328.1|4960000_4960360_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68329.1|4960346_4962671_-	replication protein	NA	A5X9G4	Aeromonas_virus	41.7	7.3e-137
AVI68330.1|4962670_4963237_-	DNA methyltransferase	NA	U3PDF3	Vibrio_phage	70.1	1.7e-71
AVI68331.1|4963233_4963665_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68332.1|4963661_4963886_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68333.1|4963882_4964164_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68334.1|4964166_4964406_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68335.1|4964468_4964942_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68336.1|4964954_4966244_-	hypothetical protein	NA	A0A0S0N767	Pseudomonas_phage	43.6	8.1e-53
AVI68337.1|4966252_4966807_-	hypothetical protein	NA	A5X9F7	Aeromonas_virus	37.0	3.1e-17
AVI68338.1|4966855_4967068_-	DNA-binding protein	NA	NA	NA	NA	NA
AVI68790.1|4967159_4967855_+	chromophore lyase	NA	NA	NA	NA	NA
AVI68339.1|4968417_4969479_+|integrase	integrase	integrase	E5G6L0	Salmonella_phage	55.0	2.9e-104
AVI68340.1|4969860_4970484_-	proline hydroxylase	NA	NA	NA	NA	NA
4969549:4969563	attR	AAAACACCCTATTTT	NA	NA	NA	NA
AVI68341.1|4970671_4971175_-	GNAT family N-acetyltransferase	NA	G9BWD5	Planktothrix_phage	32.4	2.8e-09
>prophage 337
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4991287	4991638	5266746		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVI68363.1|4991287_4991638_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	45.7	2.9e-21
>prophage 338
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	4996520	5002631	5266746		Enterobacteria_phage(33.33%)	5	NA	NA
AVI68368.1|4996520_4997771_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.7	3.1e-57
AVI68369.1|4997932_4998265_-	monothiol glutaredoxin, Grx4 family	NA	NA	NA	NA	NA
AVI68370.1|4998490_4999075_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	42.0	3.9e-39
AVI68791.1|4999361_5001296_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
AVI68371.1|5001362_5002631_+	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	39.0	3.2e-09
>prophage 339
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	5020431	5021965	5266746		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
AVI68386.1|5020431_5021343_+	ABC transporter	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.7	1.3e-25
AVI68387.1|5021683_5021965_+	DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	40.4	5.7e-12
>prophage 340
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	5026607	5037962	5266746		Klosneuvirus(20.0%)	6	NA	NA
AVI68392.1|5026607_5027963_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.1	1.2e-17
AVI68393.1|5028353_5029955_+	chemotaxis protein	NA	NA	NA	NA	NA
AVI68394.1|5030096_5033537_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.4	3.1e-14
AVI68395.1|5033711_5035664_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.1	1.1e-93
AVI68396.1|5035886_5037641_+	ATP-dependent helicase	NA	A0A2P1MXB6	Escherichia_phage	33.6	7.1e-84
AVI68397.1|5037701_5037962_+	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	67.9	5.5e-25
>prophage 341
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	5045040	5047224	5266746		Klosneuvirus(100.0%)	1	NA	NA
AVI68405.1|5045040_5047224_-	S9 family peptidase	NA	A0A1V0SHT0	Klosneuvirus	32.5	7.8e-72
>prophage 342
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	5052244	5056548	5266746		Bacillus_phage(33.33%)	4	NA	NA
AVI68410.1|5052244_5053660_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.5	1.8e-13
AVI68411.1|5053909_5054536_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AVI68412.1|5054866_5055904_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.5	2.3e-74
AVI68413.1|5055903_5056548_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.5	1.4e-26
>prophage 343
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	5059941	5061606	5266746		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
AVI68416.1|5059941_5061606_+	asparagine synthase B	NA	E5EQ62	Micromonas_sp._RCC1109_virus	41.8	6.5e-87
>prophage 344
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	5072499	5073644	5266746		Ralstonia_phage(50.0%)	2	NA	NA
AVI68424.1|5072499_5072733_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	4.4e-10
AVI68425.1|5072897_5073644_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.7	6.0e-16
>prophage 345
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	5085057	5088706	5266746	transposase	Lactococcus_phage(50.0%)	4	NA	NA
AVI68435.1|5085057_5085267_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	68.9	2.3e-18
AVI68436.1|5085574_5086390_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AVI68437.1|5086430_5087279_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68438.1|5087947_5088706_+|transposase	IS5 family transposase ISSod6	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.4	7.9e-16
>prophage 346
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	5098033	5107794	5266746	transposase	Paenibacillus_phage(25.0%)	9	NA	NA
AVI68444.1|5098033_5098792_+|transposase	IS5 family transposase ISSod6	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.4	7.9e-16
AVI68445.1|5099507_5100980_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	50.6	6.9e-125
AVI68446.1|5101974_5102691_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68447.1|5102775_5103240_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68448.1|5103349_5103982_-	type B chloramphenicol O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	40.4	1.9e-26
AVI68449.1|5104101_5104443_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68450.1|5105140_5106223_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68451.1|5106209_5106602_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68452.1|5106744_5107794_-	zinc-binding dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.1	5.5e-76
>prophage 347
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	5118139	5118331	5266746		Escherichia_phage(100.0%)	1	NA	NA
AVI68462.1|5118139_5118331_-	hypothetical protein	NA	A0A2R2Z2Y0	Escherichia_phage	69.0	3.3e-11
>prophage 348
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	5131393	5140722	5266746		Bacillus_phage(25.0%)	10	NA	NA
AVI68474.1|5131393_5133202_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.4	3.7e-59
AVI68475.1|5133234_5135553_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	26.3	6.8e-18
AVI68476.1|5135585_5136095_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
AVI68477.1|5136352_5136757_+	phosphate starvation-inducible protein PhoH	NA	NA	NA	NA	NA
AVI68478.1|5136915_5137218_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
AVI68479.1|5137294_5137963_+	chromosome partitioning protein ParA	NA	J9Q7R7	Salmonella_phage	41.3	7.7e-39
AVI68480.1|5137949_5138294_+	replication protein RepA	NA	NA	NA	NA	NA
AVI68481.1|5138529_5138727_+	hypothetical protein	NA	NA	NA	NA	NA
AVI68482.1|5138653_5138896_-	metal-binding protein	NA	NA	NA	NA	NA
AVI68483.1|5139024_5140722_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	58.3	1.9e-171
>prophage 349
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	5145337	5149380	5266746		Vibrio_phage(66.67%)	4	NA	NA
AVI68489.1|5145337_5145952_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	45.8	9.5e-44
AVI68490.1|5146225_5146582_-	hypothetical protein	NA	NA	NA	NA	NA
AVI68491.1|5146696_5147158_-	anaerobic ribonucleotide reductase-activating protein	NA	A0A2D0YLR2	Vibrio_phage	60.3	6.0e-51
AVI68492.1|5147262_5149380_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	63.5	5.1e-262
>prophage 350
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	5153429	5161540	5266746		Klosneuvirus(33.33%)	6	NA	NA
AVI68497.1|5153429_5154785_+	RNA helicase	NA	A0A1V0SIR5	Klosneuvirus	31.3	2.0e-46
AVI68498.1|5154988_5155426_+	DUF3010 domain-containing protein	NA	NA	NA	NA	NA
AVI68499.1|5155474_5155999_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AVI68798.1|5156089_5156545_+	hypothetical protein	NA	NA	NA	NA	NA
AVI68500.1|5156917_5158219_-	peptidase M23	NA	Q8SBN9	Clostridium_phage	51.6	2.9e-18
AVI68501.1|5158483_5161540_-	chromosome segregation protein SMC	NA	E3SSY3	Prochlorococcus_phage	26.2	1.6e-06
>prophage 351
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	5165758	5166295	5266746		Streptococcus_phage(100.0%)	1	NA	NA
AVI68507.1|5165758_5166295_-	N-acetyltransferase	NA	D0R097	Streptococcus_phage	25.0	3.9e-09
>prophage 352
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	5176163	5188667	5266746		Acinetobacter_phage(25.0%)	8	NA	NA
AVI68517.1|5176163_5179046_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.3	1.0e-39
AVI68518.1|5179493_5180705_-	porin	NA	NA	NA	NA	NA
AVI68519.1|5180927_5183375_-	DNA polymerase II	NA	A0A1S5Y2Z1	uncultured_archaeal_virus	27.1	2.6e-31
AVI68520.1|5183512_5185585_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.3	1.1e-48
AVI68521.1|5185594_5186368_+	hypothetical protein	NA	NA	NA	NA	NA
AVI68799.1|5186364_5187027_+	prepilin peptidase	NA	NA	NA	NA	NA
AVI68522.1|5187036_5187726_+	hypothetical protein	NA	NA	NA	NA	NA
AVI68800.1|5187761_5188667_+	histone deacetylase	NA	A0A2K9L2T7	Tupanvirus	26.0	2.4e-11
>prophage 353
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	5201658	5202444	5266746		Planktothrix_phage(100.0%)	1	NA	NA
AVI68536.1|5201658_5202444_+	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	2.6e-17
>prophage 354
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	5206386	5216098	5266746	protease,tRNA	Bacillus_phage(16.67%)	7	NA	NA
AVI68801.1|5206386_5206659_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	61.8	1.2e-22
AVI68540.1|5206918_5209276_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.6	5.7e-222
AVI68541.1|5209408_5210689_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.2	7.4e-131
AVI68542.1|5210773_5211382_-	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	8.2e-56
AVI68543.1|5211471_5212776_-	trigger factor	NA	NA	NA	NA	NA
AVI68544.1|5213757_5214612_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	33.3	4.1e-29
AVI68545.1|5214718_5216098_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	25.9	1.9e-44
>prophage 355
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	5219465	5221136	5266746	tRNA	Escherichia_phage(100.0%)	1	NA	NA
AVI68550.1|5219465_5221136_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	72.8	7.9e-242
>prophage 356
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	5243697	5246843	5266746		Streptococcus_phage(50.0%)	2	NA	NA
AVI68565.1|5243697_5244912_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.0	5.8e-53
AVI68566.1|5245193_5246843_+	putative pyridoxal-dependent aspartate 1-decarboxylase	NA	S4W1T5	Pandoravirus	22.7	2.3e-12
>prophage 357
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	5254373	5255030	5266746		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVI68574.1|5254373_5255030_+	chloramphenicol acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	39.7	1.6e-28
>prophage 358
CP023019	Shewanella sp. WE21 chromosome, complete genome	5266746	5259507	5263967	5266746	transposase	Streptococcus_phage(66.67%)	4	NA	NA
AVI68579.1|5259507_5260266_+|transposase	IS5 family transposase ISSod6	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.4	7.9e-16
AVI68580.1|5260328_5261042_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	28.5	1.7e-12
AVI68581.1|5261687_5262071_-	VOC family protein	NA	NA	NA	NA	NA
AVI68582.1|5262245_5263967_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	36.5	5.0e-90
