The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP023268	Serratia sp. MYb239 chromosome, complete genome	4986519	827995	868127	4986519	tRNA,plate,tail,holin	Erwinia_phage(27.59%)	45	NA	NA
AVJ16324.1|827995_829042_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
AVJ16325.1|829022_829784_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.6	5.1e-55
AVJ16326.1|829777_830404_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.7	1.0e-32
AVJ16327.1|830705_831725_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	37.5	2.0e-06
AVJ16328.1|831779_832778_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	1.2e-32
AVJ16329.1|832851_835404_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	19.8	3.1e-27
AVJ16330.1|835727_836819_+	murein transglycosylase B	NA	NA	NA	NA	NA
AVJ16331.1|836857_838261_-	MFS transporter	NA	NA	NA	NA	NA
AVJ16332.1|838498_838987_+	hypothetical protein	NA	B5TK85	Pseudomonas_phage	48.4	5.8e-28
AVJ16333.1|839099_840152_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.2	1.1e-111
AVJ16334.1|840213_840744_+	recombination regulator RecX	NA	NA	NA	NA	NA
AVJ16335.1|840878_843506_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.1	6.0e-79
AVJ16336.1|843758_843944_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AVJ16337.1|844902_845469_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	G3MA51	Bacillus_virus	26.3	3.5e-08
AVJ16338.1|845465_845894_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ16339.1|846044_847607_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AVJ16340.1|847774_848290_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
AVJ19992.1|848362_849607_-	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
AVJ16341.1|849711_850503_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ16342.1|850670_852032_+	signal recognition particle protein	NA	NA	NA	NA	NA
AVJ16343.1|852247_852496_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AVJ16344.1|852514_853063_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AVJ16345.1|853115_853883_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AVJ16346.1|853926_854283_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AVJ19993.1|854366_854693_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ16347.1|855117_855540_-|tail	phage tail protein	tail	U5P083	Shigella_phage	38.7	2.0e-16
AVJ16348.1|855541_857287_-	hypothetical protein	NA	A0A0M3ULH6	Salmonella_phage	52.2	7.6e-62
AVJ16349.1|857298_857865_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	75.3	2.8e-74
AVJ16350.1|857868_858102_-	late control protein B	NA	F1BUT0	Erwinia_phage	75.5	3.7e-17
AVJ16351.1|858178_859330_-	hypothetical protein	NA	A0A0M5M5V5	Salmonella_phage	46.2	1.0e-94
AVJ16352.1|859326_859809_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	53.6	1.1e-42
AVJ16353.1|859821_861876_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	30.8	6.5e-28
AVJ16354.1|861868_862003_-|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	70.5	3.3e-10
AVJ16355.1|862023_862311_-|tail	phage tail protein	tail	A0A0F7LDQ8	Escherichia_phage	56.7	4.3e-23
AVJ16356.1|862380_862890_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	69.5	3.3e-66
AVJ16357.1|862903_864073_-|tail	phage tail protein	tail	F1BUU3	Erwinia_phage	79.6	3.1e-184
AVJ16358.1|864236_865145_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	75.5	6.4e-121
AVJ16359.1|865149_865500_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	68.1	8.9e-39
AVJ16360.1|865496_866132_-|plate	baseplate assembly protein	plate	A0A0F7LDY9	Escherichia_phage	56.1	6.8e-61
AVJ16361.1|866220_866685_-|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	41.9	6.1e-19
AVJ16362.1|866659_866893_-|holin	holin	holin	F1BUQ0	Erwinia_phage	61.8	1.5e-21
AVJ16363.1|866795_867209_-	LysB family transcriptional regulator	NA	NA	NA	NA	NA
AVJ16364.1|867205_867718_-	glycoside hydrolase	NA	A0A218M4K3	Erwinia_phage	63.9	1.1e-58
AVJ16365.1|867701_867920_-	hypothetical protein	NA	F1BUQ4	Erwinia_phage	48.3	4.6e-09
AVJ16366.1|867923_868127_-|tail	phage tail protein	tail	F1BUQ5	Erwinia_phage	64.2	2.0e-19
>prophage 2
CP023268	Serratia sp. MYb239 chromosome, complete genome	4986519	1819184	1883124	4986519	lysis,integrase,tail,transposase,terminase,portal,capsid,head	Salmonella_phage(29.55%)	79	1819026:1819085	1860257:1860381
1819026:1819085	attL	GATTTAAAATCCCTCGGCTTATGGCTGTGCGGGTTCAAGTCCCGCCCCGGGTACCATGGG	NA	NA	NA	NA
AVJ17178.1|1819184_1820195_-|integrase	integrase	integrase	K7PLZ2	Enterobacterial_phage	65.8	1.2e-128
AVJ20036.1|1820194_1820431_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ20037.1|1820477_1820822_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	58.2	2.6e-30
AVJ17179.1|1821003_1821396_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ17180.1|1821395_1821701_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ17181.1|1821700_1821907_-	hypothetical protein	NA	A0A220NQV0	Salmonella_phage	54.1	3.2e-12
AVJ17182.1|1821903_1822965_-	hypothetical protein	NA	T1SBJ4	Salmonella_phage	75.7	1.1e-151
AVJ17183.1|1822961_1823600_-	exodeoxyribonuclease VIII	NA	NA	NA	NA	NA
AVJ17184.1|1823599_1824130_-	hypothetical protein	NA	A5LH62	Enterobacteria_phage	62.4	3.2e-56
AVJ17185.1|1824604_1824892_-	DNA-binding protein	NA	NA	NA	NA	NA
AVJ17186.1|1825756_1826407_-	XRE family transcriptional regulator	NA	G9L676	Escherichia_phage	58.8	1.8e-61
AVJ17187.1|1826506_1826704_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	75.4	8.9e-20
AVJ17188.1|1826732_1827257_+	DNA-binding protein	NA	Q8SBF4	Shigella_phage	30.5	1.5e-13
AVJ17189.1|1827270_1827456_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ20038.1|1827452_1828361_+	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	62.5	9.5e-32
AVJ17190.1|1828317_1829079_+	DNA replication protein DnaC	NA	A0A1W6JP39	Morganella_phage	44.1	2.8e-53
AVJ17191.1|1829075_1829423_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17192.1|1829419_1829989_+	S-adenosylmethionine-binding protein	NA	Q858E6	Salmonella_phage	76.2	1.1e-81
AVJ17193.1|1829985_1830357_+	hypothetical protein	NA	A0A1C9IIA0	Salmonella_phage	61.7	2.5e-39
AVJ17194.1|1830353_1831340_+	hypothetical protein	NA	A0A0P0ZD76	Stx2-converting_phage	48.2	2.5e-86
AVJ17195.1|1831391_1831790_+	antitermination protein Q	NA	U5P0A5	Shigella_phage	60.3	1.4e-32
AVJ17196.1|1831924_1832668_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17197.1|1832760_1833120_-	transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	42.3	7.6e-09
AVJ17198.1|1833185_1833446_-	hypothetical protein	NA	A0A1S5NR91	Burkholderia_phage	39.5	1.2e-08
AVJ17199.1|1833614_1833863_+|lysis	lysis protein	lysis	A0A127KNH9	Pseudomonas_phage	37.7	1.1e-06
AVJ17200.1|1833865_1834345_+	lysozyme	NA	A0A2I6TCA1	Escherichia_phage	72.7	2.9e-64
AVJ20039.1|1834362_1834719_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17201.1|1834872_1835157_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	68.1	1.7e-27
AVJ17202.1|1835320_1835584_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17203.1|1835665_1836220_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17204.1|1836405_1836615_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17205.1|1836624_1838085_+	glycosyltransferase	NA	K7PKP3	Enterobacterial_phage	77.0	4.6e-230
AVJ17206.1|1838066_1838657_+	hypothetical protein	NA	S4TR53	Salmonella_phage	64.3	5.1e-71
AVJ17207.1|1838649_1839018_+	HNH endonuclease	NA	S4TTG9	Salmonella_phage	76.7	2.0e-49
AVJ17208.1|1839189_1839645_+|terminase	terminase	terminase	S4TNN3	Salmonella_phage	59.1	2.0e-38
AVJ17209.1|1839647_1841306_+|terminase	terminase	terminase	Q3HQS7	Burkholderia_phage	71.9	2.9e-236
AVJ17210.1|1841364_1843308_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	87.2	0.0e+00
AVJ17211.1|1843511_1844864_+|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	72.0	5.3e-188
AVJ17212.1|1844856_1845750_+|portal	phage portal protein	portal	S4TNN1	Salmonella_phage	44.8	1.1e-69
AVJ17213.1|1845753_1846080_+	DNA-packaging protein	NA	S4TSQ3	Salmonella_phage	54.6	4.4e-24
AVJ17214.1|1846147_1846357_+	hypothetical protein	NA	K7PJU7	Enterobacteria_phage	55.1	1.7e-08
AVJ17215.1|1846362_1846713_+|head,tail	head-tail adaptor protein	head,tail	A0A286S2A2	Klebsiella_phage	56.0	3.8e-29
AVJ20040.1|1846705_1847191_+	hypothetical protein	NA	A0A0U3TGT7	Pseudomonas_phage	61.3	1.8e-50
AVJ17216.1|1847187_1847553_+	hypothetical protein	NA	K7PHI9	Enterobacteria_phage	71.9	4.9e-48
AVJ17217.1|1847612_1848110_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	78.9	1.4e-69
AVJ17218.1|1848158_1848539_+|tail	phage tail protein	tail	K7PJU9	Enterobacteria_phage	75.6	1.5e-47
AVJ20041.1|1848586_1848805_+|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	63.4	2.3e-21
AVJ20042.1|1848897_1849254_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	77.6	1.4e-44
AVJ17219.1|1849311_1851738_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	42.2	5.7e-140
AVJ17220.1|1851737_1852208_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	61.3	3.6e-59
AVJ17221.1|1852204_1852687_+	ArsR family transcriptional regulator	NA	A0A286S2B1	Klebsiella_phage	63.8	5.5e-55
AVJ17222.1|1852697_1853078_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	77.0	2.2e-54
AVJ17223.1|1853074_1856158_+	kinase	NA	A0A286S259	Klebsiella_phage	50.1	7.6e-283
AVJ17224.1|1856216_1858025_+	hypothetical protein	NA	J7HXC9	Pseudomonas_phage	60.0	5.3e-10
AVJ17225.1|1858028_1858739_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17226.1|1859239_1859473_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17227.1|1859814_1860078_-	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	37.8	1.3e-05
AVJ17228.1|1860521_1860737_-	hypothetical protein	NA	NA	NA	NA	NA
1860257:1860381	attR	GATTTAAAATCCCTCGGCTTATGGCTGTGCGGGTTCAAGTCCCGCCCCGGGTACCATGGGAAACATCAGAATAATCAAAGCAATAAGCAGTGTCGTAAGCCGCCGAAAGGCGGTTTTTTTGTGCC	NA	NA	NA	NA
AVJ17229.1|1860834_1861023_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ17230.1|1861354_1861603_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ17231.1|1862058_1862322_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ17232.1|1862470_1862695_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ20043.1|1863074_1863839_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AVJ17233.1|1864231_1865347_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17234.1|1865793_1866834_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AVJ20044.1|1866871_1867843_-	porphobilinogen synthase	NA	NA	NA	NA	NA
AVJ17235.1|1868031_1868250_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ17236.1|1868677_1868905_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17237.1|1869039_1870563_-	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.7	1.6e-55
AVJ17238.1|1870924_1871539_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17239.1|1871900_1872200_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17240.1|1872323_1872827_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17241.1|1873491_1875213_-	potassium/proton antiporter	NA	NA	NA	NA	NA
AVJ17242.1|1875494_1875719_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ17243.1|1876072_1877206_-	glucans biosynthesis protein MdoC	NA	NA	NA	NA	NA
AVJ17244.1|1877531_1879034_+	glucan biosynthesis protein G	NA	NA	NA	NA	NA
AVJ17245.1|1879026_1881588_+	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
AVJ17246.1|1881729_1881975_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
AVJ17247.1|1882083_1883124_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP023268	Serratia sp. MYb239 chromosome, complete genome	4986519	2051476	2059105	4986519	tRNA	Tupanvirus(33.33%)	9	NA	NA
AVJ17406.1|2051476_2053405_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	1.8e-128
AVJ17407.1|2053408_2053960_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	4.4e-16
AVJ17408.1|2054058_2054256_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVJ17409.1|2054299_2054656_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVJ17410.1|2054745_2054928_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ17411.1|2055034_2056018_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.9	2.2e-34
AVJ17412.1|2056032_2058420_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.0	2.4e-05
AVJ17413.1|2058424_2058721_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
AVJ17414.1|2058895_2059105_+	hypothetical protein	NA	S4TTC1	Salmonella_phage	70.0	2.0e-09
>prophage 4
CP023268	Serratia sp. MYb239 chromosome, complete genome	4986519	2089132	2186664	4986519	plate,lysis,tail,integrase,transposase,portal	Pectobacterium_phage(17.78%)	98	2078843:2078862	2137552:2137571
2078843:2078862	attL	CAGCACCCGCGCCAGCTGCA	NA	NA	NA	NA
AVJ17441.1|2089132_2090215_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	48.8	2.4e-98
AVJ17442.1|2090189_2090522_-	excisionase	NA	NA	NA	NA	NA
AVJ17443.1|2090487_2090688_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	55.4	1.6e-08
AVJ17444.1|2090957_2091458_-	hypothetical protein	NA	H9C156	Pectobacterium_phage	67.5	4.4e-55
AVJ17445.1|2091454_2093602_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	41.7	2.4e-134
AVJ17446.1|2093653_2093932_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ17447.1|2093942_2094260_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ17448.1|2094693_2095095_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	54.6	2.1e-31
AVJ17449.1|2095176_2095371_+	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	42.9	7.0e-09
AVJ20054.1|2095432_2095882_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.1	1.4e-31
AVJ17450.1|2095903_2096110_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	60.9	5.6e-17
AVJ17451.1|2096112_2096832_+	replication protein	NA	A0A1W6JP36	Morganella_phage	66.3	1.5e-27
AVJ17452.1|2096828_2098202_+	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	49.3	1.6e-115
AVJ17453.1|2098245_2098728_+	hypothetical protein	NA	H9C166	Pectobacterium_phage	44.9	9.8e-28
AVJ17454.1|2098731_2098977_+	hypothetical protein	NA	H9C167	Pectobacterium_phage	48.1	2.5e-11
AVJ17455.1|2098973_2099186_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	69.4	4.3e-20
AVJ17456.1|2099701_2100361_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17457.1|2100470_2100758_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17458.1|2100901_2101150_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17459.1|2101295_2101487_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17460.1|2101557_2102163_+	hypothetical protein	NA	H9C173	Pectobacterium_phage	67.9	7.9e-75
AVJ17461.1|2102162_2102369_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	66.7	1.4e-20
AVJ17462.1|2102371_2102659_+	DUF1364 domain-containing protein	NA	E5AGG0	Erwinia_phage	68.8	1.7e-32
AVJ20055.1|2102658_2103024_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	64.6	1.6e-38
AVJ17463.1|2103112_2103970_+	DNA methyltransferase	NA	Q5GQR9	Synechococcus_phage	24.1	6.9e-08
AVJ17464.1|2104000_2105437_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ20056.1|2105840_2106089_+|lysis	lysis protein	lysis	A0A127KNH9	Pseudomonas_phage	37.7	1.9e-06
AVJ17465.1|2106091_2106586_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	61.6	9.0e-53
AVJ17466.1|2106582_2106966_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17467.1|2107739_2108126_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ20057.1|2108631_2109126_+	DUF1441 domain-containing protein	NA	K7PJY2	Enterobacterial_phage	64.6	4.2e-50
AVJ17468.1|2109125_2111243_+	DNA packaging protein	NA	A0A291AWY5	Escherichia_phage	68.9	4.7e-292
AVJ17469.1|2111239_2111455_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17470.1|2111462_2112974_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	53.7	9.9e-151
AVJ17471.1|2112927_2115015_+	peptidase S14	NA	A0A1W6JT88	Pseudomonas_phage	58.2	5.5e-200
AVJ17472.1|2115091_2115442_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17473.1|2115442_2115802_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17474.1|2115804_2116476_+	hypothetical protein	NA	R9TR34	Vibrio_phage	34.5	1.5e-21
AVJ20058.1|2116494_2117016_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17475.1|2117015_2117633_+|plate	baseplate assembly protein	plate	A0A2I8TV69	Erwinia_phage	33.2	3.0e-13
AVJ17476.1|2117670_2118030_+|plate	baseplate assembly protein	plate	V5YTB2	Pseudomonas_phage	48.6	2.4e-23
AVJ17477.1|2118004_2118922_+|plate	baseplate assembly protein	plate	V5YTH6	Pseudomonas_phage	41.9	3.0e-57
AVJ17478.1|2118908_2119445_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	44.1	6.8e-30
AVJ17479.1|2119449_2120595_+	hypothetical protein	NA	E5FJ29	Escherichia_phage	47.2	2.0e-26
AVJ17480.1|2120594_2121176_+|tail	phage tail protein	tail	A0A0M4RTP2	Salmonella_phage	38.6	1.0e-26
AVJ17481.1|2121215_2122742_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	36.0	9.2e-72
AVJ17482.1|2122738_2123245_+|tail	phage tail protein	tail	NA	NA	NA	NA
AVJ17483.1|2123302_2123602_+	hypothetical protein	NA	K4I007	Acidithiobacillus_phage	34.2	4.2e-05
AVJ17484.1|2123705_2125337_+	hypothetical protein	NA	R9TRP8	Vibrio_phage	33.0	1.1e-46
AVJ17485.1|2125333_2125810_+|tail	phage tail protein	tail	V5YTC2	Pseudomonas_phage	39.8	1.0e-21
AVJ20059.1|2125784_2126000_+|tail	phage tail protein	tail	NA	NA	NA	NA
AVJ17486.1|2126001_2127129_+	late control protein D	NA	R9TNM7	Vibrio_phage	31.8	8.7e-35
AVJ17487.1|2127143_2129312_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	27.0	3.6e-13
AVJ17488.1|2129325_2130123_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17489.1|2130650_2130965_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ17490.1|2131993_2134174_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AVJ17491.1|2134388_2135732_+	enterochelin esterase	NA	NA	NA	NA	NA
AVJ17492.1|2135744_2135972_+	MbtH family protein	NA	NA	NA	NA	NA
AVJ17493.1|2136023_2144549_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	20.0	3.5e-75
2137552:2137571	attR	TGCAGCTGGCGCGGGTGCTG	NA	NA	NA	NA
AVJ17494.1|2144614_2145901_+	enterobactin transporter EntS	NA	NA	NA	NA	NA
AVJ17495.1|2145916_2146897_-	Fe2+-enterobactin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVJ17496.1|2147224_2149417_+	ferric-rhodotorulic acid/ferric-coprogen receptor FhuE	NA	NA	NA	NA	NA
AVJ17497.1|2149444_2150533_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17498.1|2150679_2151609_-	esterase	NA	A0A167RJ59	Powai_lake_megavirus	22.7	5.7e-08
AVJ17499.1|2151730_2152639_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVJ17500.1|2152750_2153911_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	7.8e-39
AVJ17501.1|2154083_2155106_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVJ17502.1|2155168_2156371_+	MFS transporter	NA	NA	NA	NA	NA
AVJ17503.1|2157684_2158521_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
AVJ17504.1|2158727_2159405_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVJ17505.1|2159404_2160793_+	sensor histidine kinase	NA	NA	NA	NA	NA
AVJ17506.1|2160847_2161285_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17507.1|2161948_2162623_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17508.1|2162664_2162997_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ17509.1|2163227_2163473_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17510.1|2163502_2163781_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17511.1|2163755_2164451_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.0	3.4e-45
AVJ17512.1|2164539_2165130_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ17513.1|2166928_2169511_-	pilus assembly protein PapC	NA	NA	NA	NA	NA
AVJ20060.1|2169539_2170178_-	fimbrial chaperone	NA	NA	NA	NA	NA
AVJ17514.1|2170296_2170854_-	fimbrial protein	NA	NA	NA	NA	NA
AVJ17515.1|2171269_2171965_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	36.9	3.1e-35
AVJ17516.1|2172001_2172172_-	hypothetical protein	NA	Q716C1	Shigella_phage	90.4	6.5e-19
AVJ17517.1|2172269_2172671_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ17518.1|2172862_2173153_-	lipoprotein bor	NA	C6ZCX3	Enterobacteria_phage	66.0	6.7e-32
AVJ17519.1|2173365_2174364_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17520.1|2175202_2176417_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVJ17521.1|2176651_2176936_-	plasmid stabilization protein	NA	NA	NA	NA	NA
AVJ17522.1|2176928_2177171_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AVJ17523.1|2177745_2178027_-	cytoplasmic protein	NA	NA	NA	NA	NA
AVJ17524.1|2178029_2178239_-	resolvase	NA	NA	NA	NA	NA
AVJ17525.1|2178659_2178968_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17526.1|2179022_2179805_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17527.1|2179817_2180744_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17528.1|2180740_2181472_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ17529.1|2181511_2182687_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ17530.1|2182888_2183467_-	DNA resolvase	NA	A0JC18	Ralstonia_phage	39.8	5.8e-27
AVJ17531.1|2183616_2186664_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
>prophage 5
CP023268	Serratia sp. MYb239 chromosome, complete genome	4986519	3050805	3084840	4986519	transposase,integrase,tail,terminase,portal,capsid,head,holin	Cronobacter_phage(56.67%)	39	3047444:3047458	3066893:3066907
3047444:3047458	attL	CCTGACGGCCAGTGG	NA	NA	NA	NA
AVJ18291.1|3050805_3051846_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AVJ18292.1|3051842_3052739_-|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	45.8	9.2e-72
AVJ18293.1|3052829_3053129_-	transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	43.4	3.3e-18
AVJ18294.1|3053227_3053581_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ18295.1|3053577_3053838_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ18296.1|3053828_3054044_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ18297.1|3054120_3054429_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ18298.1|3054663_3055782_+	hypothetical protein	NA	K7RFY5	Vibrio_phage	62.8	2.9e-59
AVJ18299.1|3055778_3056588_+	adenine methylase	NA	E5G6L8	Salmonella_phage	51.5	1.9e-68
AVJ18300.1|3056584_3056872_+	DNA-binding protein	NA	NA	NA	NA	NA
AVJ18301.1|3059023_3059254_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ18302.1|3059641_3060815_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	74.1	3.1e-136
AVJ18303.1|3061240_3061510_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	61.6	1.9e-25
AVJ18304.1|3061571_3062318_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ20118.1|3062319_3063978_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ18305.1|3065072_3066113_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	63.3	3.3e-129
AVJ18306.1|3066109_3067915_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	55.8	6.6e-194
3066893:3066907	attR	CCACTGGCCGTCAGG	NA	NA	NA	NA
AVJ18307.1|3068087_3068966_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	40.1	1.6e-44
AVJ18308.1|3069023_3070076_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	59.6	2.2e-109
AVJ18309.1|3070078_3070882_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	57.1	7.8e-70
AVJ20119.1|3070908_3071370_+|head	head completion protein	head	F1BUL8	Cronobacter_phage	44.7	1.3e-24
AVJ18310.1|3071366_3071864_+|tail	phage tail protein	tail	A0A1D9C9R7	Salinivibrio_phage	28.7	3.1e-08
AVJ18311.1|3071847_3072561_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	51.5	1.2e-58
AVJ18312.1|3072557_3073682_+|tail	phage tail protein	tail	F1BUL5	Cronobacter_phage	62.1	6.3e-126
AVJ18313.1|3073688_3074144_+|tail	phage tail protein	tail	A5X9I1	Aeromonas_virus	60.3	1.8e-47
AVJ18314.1|3074149_3074449_+|holin	holin	holin	C7BGD7	Burkholderia_phage	56.2	6.1e-20
AVJ18315.1|3074435_3074777_+	hypothetical protein	NA	F1BUL3	Cronobacter_phage	83.2	4.0e-44
AVJ18316.1|3074776_3075163_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	44.1	2.5e-10
AVJ18317.1|3075101_3075281_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	54.7	1.2e-07
AVJ18318.1|3075277_3075544_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	53.0	8.6e-18
AVJ18319.1|3075728_3077642_+|tail	phage tail tape measure protein	tail	A0A2I7RNI7	Vibrio_phage	41.7	5.9e-100
AVJ18320.1|3077634_3077967_+	hypothetical protein	NA	Q94MY3	Haemophilus_virus	61.9	6.1e-29
AVJ18321.1|3077963_3079148_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	62.3	4.5e-143
AVJ18322.1|3079140_3079743_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	51.1	5.3e-47
AVJ18323.1|3079821_3081423_+	hypothetical protein	NA	F1BUK3	Cronobacter_phage	40.6	2.1e-50
AVJ18324.1|3081426_3081924_+|tail	tail assembly chaperone	tail	Q37843	Escherichia_phage	44.0	1.3e-27
AVJ18325.1|3081923_3082625_+	hypothetical protein	NA	U3PIM3	Vibrio_phage	27.1	4.0e-06
AVJ18326.1|3082621_3083176_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	47.5	7.8e-29
AVJ18327.1|3083172_3084840_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	41.9	1.6e-122
