The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026610	Bacillus velezensis strain CGMCC 11640 chromosome, complete genome	4322979	689597	699488	4322979		Synechococcus_phage(50.0%)	9	NA	NA
AVI27491.1|689597_690890_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
AVI27492.1|690965_691685_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.7	1.3e-47
AVI27493.1|691684_691939_+	phosphoribosylformylglycinamidine synthase, purS protein	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
AVI27494.1|691935_692619_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AVI27495.1|692602_694831_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.7	9.4e-158
AVI27496.1|694806_696237_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
AVI27497.1|696328_697369_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.9	3.7e-64
AVI27498.1|697365_697953_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.0e-26
AVI27499.1|697949_699488_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	6.7e-78
>prophage 2
CP026610	Bacillus velezensis strain CGMCC 11640 chromosome, complete genome	4322979	1157982	1191592	4322979	tRNA,coat	Planktothrix_phage(16.67%)	38	NA	NA
AVI30866.1|1157982_1158975_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AVI27923.1|1159718_1161353_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVI27924.1|1161459_1162395_+	ABC transporter permease	NA	NA	NA	NA	NA
AVI27925.1|1162398_1163316_+	ABC transporter permease	NA	NA	NA	NA	NA
AVI27926.1|1163328_1164405_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	2.3e-16
AVI27927.1|1164397_1165315_+	ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
AVI27928.1|1165421_1166609_+	GTP-binding protein	NA	NA	NA	NA	NA
AVI27929.1|1166726_1167305_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVI27930.1|1167482_1167878_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AVI27931.1|1167935_1168592_-	hypothetical protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.0	9.9e-31
AVI27932.1|1168867_1169524_+	adaptor protein MecA	NA	NA	NA	NA	NA
AVI27933.1|1169674_1170862_+	competence protein CoiA	NA	NA	NA	NA	NA
AVI30867.1|1171064_1172894_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AVI27934.1|1173384_1174287_-	DsbA family protein	NA	NA	NA	NA	NA
AVI27935.1|1174283_1174682_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
AVI27936.1|1174910_1175597_-	lytic transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	72.6	2.3e-38
AVI27937.1|1175601_1176174_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AVI27938.1|1176298_1176664_+	hypothetical protein	NA	NA	NA	NA	NA
AVI27939.1|1176691_1177327_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AVI27940.1|1177344_1178145_+	NAD kinase	NA	NA	NA	NA	NA
AVI27941.1|1178159_1179053_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	31.2	1.4e-06
AVI27942.1|1179086_1179836_-	hypothetical protein	NA	A0A1V0SJW2	Klosneuvirus	26.4	9.9e-11
AVI27943.1|1179852_1180038_+	hypothetical protein	NA	NA	NA	NA	NA
AVI27944.1|1180064_1181909_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AVI30868.1|1182158_1182866_+	thiaminase II	NA	NA	NA	NA	NA
AVI30869.1|1182843_1183461_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
AVI27945.1|1183444_1184554_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
AVI27946.1|1184550_1184754_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AVI27947.1|1184750_1185521_+	thiazole synthase	NA	NA	NA	NA	NA
AVI27948.1|1185517_1186528_+	thiamine biosynthesis protein MoeB	NA	NA	NA	NA	NA
AVI27949.1|1186550_1187363_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AVI27950.1|1187493_1188270_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AVI27951.1|1188367_1188976_+|coat	spore coat protein	coat	NA	NA	NA	NA
AVI27952.1|1189034_1189478_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVI27953.1|1189625_1190108_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVI27954.1|1190258_1190759_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVI27955.1|1190851_1191166_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVI27956.1|1191205_1191592_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 3
CP026610	Bacillus velezensis strain CGMCC 11640 chromosome, complete genome	4322979	1259970	1292401	4322979	portal,holin,capsid,terminase	Bacillus_phage(33.33%)	42	NA	NA
AVI28030.1|1259970_1261107_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
AVI28031.1|1261373_1262327_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
AVI28032.1|1262363_1262741_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	41.4	1.5e-15
AVI28033.1|1262850_1263453_+	hypothetical protein	NA	A0A0Y0AJU6	Bacillus_phage	48.3	7.9e-43
AVI28034.1|1263523_1264360_+	manganese catalase	NA	NA	NA	NA	NA
AVI28035.1|1264381_1264972_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
AVI28036.1|1264972_1265170_+	hypothetical protein	NA	NA	NA	NA	NA
AVI28037.1|1265120_1265459_-	XRE family transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
AVI28038.1|1265649_1265829_+	hypothetical protein	NA	NA	NA	NA	NA
AVI28039.1|1265818_1266646_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	49.0	2.2e-19
AVI28040.1|1266545_1267346_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.3	3.0e-58
AVI28041.1|1267610_1267952_+|portal	phage portal protein	portal	NA	NA	NA	NA
AVI28042.1|1267941_1268145_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	1.9e-12
AVI28043.1|1268258_1268771_+	Fis family transcriptional regulator	NA	A0A0K2CNQ1	Brevibacillus_phage	44.6	2.9e-22
AVI28044.1|1268883_1269681_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	49.8	4.0e-58
AVI28045.1|1269677_1270976_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.2	2.1e-149
AVI30873.1|1271024_1272416_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.8	3.0e-138
AVI28046.1|1272435_1273281_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	58.1	2.5e-55
AVI28047.1|1273307_1274243_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
AVI28048.1|1274259_1274643_+	DUF3199 domain-containing protein	NA	NA	NA	NA	NA
AVI28049.1|1274639_1274996_+	DUF3599 domain-containing protein	NA	NA	NA	NA	NA
AVI28050.1|1274992_1275496_+|portal	phage portal protein	portal	A0A249XXA4	Clostridium_phage	41.1	2.7e-36
AVI28051.1|1275492_1275939_+|portal	phage portal protein	portal	NA	NA	NA	NA
AVI28052.1|1275935_1276145_+	hypothetical protein	NA	NA	NA	NA	NA
AVI28053.1|1277542_1277986_+|portal	phage portal protein	portal	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
AVI28054.1|1278062_1278509_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
AVI28055.1|1278550_1278703_+	hypothetical protein	NA	NA	NA	NA	NA
AVI28056.1|1278690_1283571_+|portal	phage portal protein	portal	A0A1L2JY60	Aeribacillus_phage	41.4	7.1e-41
AVI28057.1|1283563_1284223_+|portal	phage portal protein	portal	G3MBQ1	Bacillus_virus	45.3	1.8e-08
AVI28058.1|1284236_1285214_+|portal	phage portal protein	portal	A0A1L6BY20	Clostridium_phage	30.6	6.4e-34
AVI28059.1|1285213_1285480_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	38.6	1.2e-06
AVI28060.1|1285583_1286009_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	3.3e-11
AVI28061.1|1286001_1287048_+|portal	phage portal protein	portal	S6AVU3	Thermus_phage	43.8	1.7e-69
AVI28062.1|1287031_1287610_+	DUF2313 domain-containing protein	NA	A0A0A7RTT8	Clostridium_phage	28.9	3.1e-12
AVI28063.1|1287606_1287879_+	hypothetical protein	NA	NA	NA	NA	NA
AVI28064.1|1287881_1289513_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	33.5	3.5e-53
AVI28065.1|1289525_1289897_+	hypothetical protein	NA	NA	NA	NA	NA
AVI28066.1|1289901_1290099_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	63.6	2.5e-14
AVI28067.1|1290155_1290917_+|portal	phage portal protein	portal	NA	NA	NA	NA
AVI28068.1|1290968_1291232_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
AVI28069.1|1291245_1291509_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
AVI28070.1|1291522_1292401_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.5	3.7e-81
>prophage 4
CP026610	Bacillus velezensis strain CGMCC 11640 chromosome, complete genome	4322979	1895493	1901706	4322979		Bacillus_phage(50.0%)	7	NA	NA
AVI28554.1|1895493_1895886_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	3.8e-30
AVI28555.1|1895845_1897948_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	85.7	0.0e+00
AVI28556.1|1897965_1898955_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.0	1.1e-155
AVI28557.1|1899003_1899624_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	2.1e-46
AVI28558.1|1899672_1900431_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.0	3.1e-52
AVI28559.1|1900464_1900689_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28560.1|1900737_1901706_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 5
CP026610	Bacillus velezensis strain CGMCC 11640 chromosome, complete genome	4322979	2098236	2143529	4322979	portal,tRNA,head,plate,holin,protease,integrase,capsid,terminase,tail	Bacillus_phage(80.0%)	58	2137366:2137381	2139343:2139358
AVI28685.1|2098236_2100063_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	41.0	9.9e-105
AVI28686.1|2100078_2100519_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AVI28687.1|2100711_2101455_+	hypothetical protein	NA	NA	NA	NA	NA
AVI28688.1|2101499_2102513_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	95.3	2.3e-183
AVI28689.1|2102555_2102978_-|holin	holin	holin	D6R405	Bacillus_phage	87.1	1.0e-57
AVI28690.1|2103028_2103217_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	95.2	1.5e-29
AVI28691.1|2103213_2103576_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	92.4	2.4e-55
AVI28692.1|2103572_2104850_-|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	76.7	9.3e-142
AVI28693.1|2104867_2107429_-	peptidase G2	NA	D6R401	Bacillus_phage	95.8	0.0e+00
AVI28694.1|2107468_2109172_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	98.6	7.6e-309
AVI28695.1|2109183_2110023_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	94.6	6.9e-154
AVI28696.1|2110022_2113898_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	97.7	0.0e+00
AVI28697.1|2113910_2114102_-	hypothetical protein	NA	D6R3Z7	Bacillus_phage	94.4	9.2e-22
AVI28698.1|2114098_2114437_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	90.2	2.6e-51
AVI28699.1|2114488_2115097_-|tail	phage tail protein	tail	Q9ZXE9	Bacillus_phage	81.7	1.1e-92
AVI28700.1|2115097_2115478_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	96.8	9.0e-61
AVI28701.1|2115474_2115858_-	hypothetical protein	NA	Q9ZXF1	Bacillus_phage	97.6	3.2e-66
AVI28702.1|2115850_2116210_-|head,tail	head-tail adaptor protein	head,tail	Q9ZXF2	Bacillus_phage	96.6	8.0e-59
AVI28703.1|2116142_2116490_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	99.1	3.5e-59
AVI28704.1|2116504_2117050_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	99.4	2.0e-45
AVI28705.1|2117077_2117389_-	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	96.2	2.3e-46
AVI28706.1|2117401_2118595_-|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	99.7	2.5e-221
AVI28707.1|2118634_2119261_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	99.5	1.5e-113
AVI28708.1|2119250_2120501_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	99.3	2.4e-243
AVI28709.1|2120506_2120725_-	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	100.0	4.3e-31
AVI28710.1|2120737_2122447_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	99.6	0.0e+00
AVI28711.1|2122446_2122953_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	95.2	7.0e-85
AVI28712.1|2123039_2123366_-	transglycosylase	NA	Q9T203	Bacillus_phage	96.3	1.1e-54
AVI28713.1|2123334_2123709_-	HNH endonuclease	NA	Q38456	Bacillus_phage	94.4	8.9e-69
AVI28714.1|2123885_2124362_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28715.1|2124473_2124893_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
AVI28716.1|2124920_2125103_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28717.1|2125669_2126305_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
AVI28718.1|2126461_2127004_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	65.0	2.6e-61
AVI28719.1|2127000_2127453_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	3.7e-37
AVI28720.1|2127464_2127977_-	Fis family transcriptional regulator	NA	A0A2H4J6J3	uncultured_Caudovirales_phage	39.4	2.2e-30
AVI28721.1|2128620_2129310_-	dUTPase	NA	R9TQ23	Paenibacillus_phage	43.7	3.3e-37
AVI28722.1|2129465_2129723_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	42.3	1.6e-05
AVI28723.1|2129719_2129947_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28724.1|2129943_2130174_-	hypothetical protein	NA	J9PL10	Bacillus_phage	41.6	1.5e-10
AVI28725.1|2130170_2130575_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28726.1|2130688_2130892_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	55.4	7.5e-14
AVI28727.1|2131191_2131419_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28728.1|2131387_2131936_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.0e-05
AVI28729.1|2132229_2133087_-	hypothetical protein	NA	A0A2H4JH61	uncultured_Caudovirales_phage	29.8	1.9e-21
AVI28730.1|2133037_2133898_-	replication protein	NA	V5UQV4	Oenococcus_phage	44.7	4.9e-46
AVI28731.1|2133884_2134109_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28732.1|2134126_2134450_-	DUF771 domain-containing protein	NA	Q9MBW7	Lactococcus_phage	39.8	2.0e-13
AVI28733.1|2134513_2134720_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVI28734.1|2134884_2135283_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVI28735.1|2135714_2136815_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28736.1|2137054_2138167_+|integrase	site-specific integrase	integrase	Q5YAA6	Bacillus_phage	58.3	1.9e-111
2137366:2137381	attL	TCAAGAGTTTTTAAAT	NA	NA	NA	NA
AVI28737.1|2138440_2138986_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	48.6	2.1e-42
AVI28738.1|2139300_2139531_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
2139343:2139358	attR	ATTTAAAAACTCTTGA	NA	NA	NA	NA
AVI28739.1|2139774_2141550_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AVI28740.1|2141594_2142770_-	MFS transporter	NA	NA	NA	NA	NA
AVI28741.1|2142913_2143216_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AVI28742.1|2143262_2143529_-|tRNA	threonyl-tRNA synthetase	tRNA	NA	NA	NA	NA
>prophage 6
CP026610	Bacillus velezensis strain CGMCC 11640 chromosome, complete genome	4322979	2245759	2254868	4322979		Bacillus_phage(100.0%)	10	NA	NA
AVI28850.1|2245759_2246134_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	52.0	1.2e-28
AVI28851.1|2246367_2246820_-	hypothetical protein	NA	O64117	Bacillus_phage	78.0	5.7e-62
AVI28852.1|2247217_2248333_+	tetratricopeptide repeat-containing protein	NA	D6R410	Bacillus_phage	48.4	6.3e-94
AVI28853.1|2248329_2248452_+	phosphatase RapK inhibitor	NA	NA	NA	NA	NA
AVI28854.1|2248505_2248838_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVI28855.1|2248933_2249530_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	81.9	1.7e-85
AVI28856.1|2249531_2251283_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	67.1	6.8e-228
AVI30904.1|2251319_2251754_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28857.1|2252018_2252984_+	endonuclease	NA	A0A1P8CWK6	Bacillus_phage	75.4	4.9e-79
AVI28858.1|2253200_2254868_+	recombinase family protein	NA	O64015	Bacillus_phage	91.0	6.4e-276
>prophage 7
CP026610	Bacillus velezensis strain CGMCC 11640 chromosome, complete genome	4322979	2289749	2362836	4322979	tRNA,integrase	Bacillus_phage(94.37%)	107	2331115:2331139	2364446:2364470
AVI28899.1|2289749_2290304_-	hypothetical protein	NA	O64195	Bacillus_phage	89.9	1.5e-88
AVI28900.1|2290401_2290641_+	XRE family transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	65.8	6.5e-25
AVI28901.1|2290630_2290837_-	hypothetical protein	NA	O64193	Bacillus_phage	69.0	1.8e-15
AVI28902.1|2291032_2291296_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28903.1|2291463_2292012_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28904.1|2292060_2292399_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28905.1|2292395_2292812_-	hypothetical protein	NA	A0A1P8CX53	Bacillus_phage	72.3	4.5e-37
AVI28906.1|2292786_2293200_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28907.1|2293585_2293825_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28908.1|2294054_2294234_-	hypothetical protein	NA	A0A1P8CWU9	Bacillus_phage	86.4	3.5e-23
AVI28909.1|2294268_2294826_-	hypothetical protein	NA	A0A140HLT6	Bacillus_phage	57.2	1.9e-59
AVI28910.1|2294847_2295066_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28911.1|2295898_2296846_-	HNH endonuclease	NA	A0A1B1P765	Bacillus_phage	43.4	3.4e-16
AVI28912.1|2297331_2297673_-	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	71.2	7.4e-22
AVI28913.1|2297800_2298148_-	hypothetical protein	NA	R4JGJ3	Bacillus_phage	37.9	3.0e-10
AVI28914.1|2298161_2298707_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28915.1|2298703_2299882_-	hypothetical protein	NA	R4JEY6	Bacillus_phage	39.6	1.1e-56
AVI28916.1|2300099_2300471_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28917.1|2300530_2300896_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28918.1|2301024_2301531_-	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	41.5	3.7e-33
AVI28919.1|2301530_2302370_-	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	88.9	2.7e-150
AVI28920.1|2302384_2302777_-	hypothetical protein	NA	A0A1P8CX52	Bacillus_phage	60.2	6.7e-35
AVI28921.1|2303145_2303445_-	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	54.7	1.4e-19
AVI28922.1|2303437_2303746_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28923.1|2304167_2304782_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	42.7	4.7e-43
AVI30907.1|2304828_2305185_-|tRNA	peptidyl-tRNA hydrolase	tRNA	A0A1V0SFB5	Hokovirus	29.8	9.8e-09
AVI28924.1|2305180_2305420_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28925.1|2305412_2305655_-	thiol reductase thioredoxin	NA	A0A1P8CX24	Bacillus_phage	74.7	5.8e-29
AVI28926.1|2305651_2306650_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A076G7U1	Bacillus_phage	79.9	2.7e-149
AVI28927.1|2306650_2306893_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28928.1|2306880_2308980_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	61.4	0.0e+00
AVI28929.1|2309885_2310197_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28930.1|2310250_2310604_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28931.1|2310649_2311021_-	hypothetical protein	NA	Q5YA89	Bacillus_phage	33.6	9.6e-07
AVI30908.1|2311047_2311353_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28932.1|2311398_2311746_-	hypothetical protein	NA	O64164	Bacillus_phage	88.7	5.9e-51
AVI28933.1|2311760_2312165_-	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	61.9	3.4e-34
AVI28934.1|2312165_2312618_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28935.1|2312635_2312815_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28936.1|2312847_2313321_-	hypothetical protein	NA	O64162	Bacillus_phage	66.9	1.6e-59
AVI28937.1|2313639_2313825_-	hypothetical protein	NA	A0A1P8CX22	Bacillus_phage	66.7	3.2e-19
AVI28938.1|2314118_2314877_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28939.1|2315061_2315259_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28940.1|2315273_2315501_-	hypothetical protein	NA	O64157	Bacillus_phage	80.0	9.3e-29
AVI28941.1|2315538_2315757_-	hypothetical protein	NA	O64155	Bacillus_phage	55.7	2.3e-13
AVI28942.1|2315807_2317286_-	nicotinate phosphoribosyltransferase	NA	A0A218KC49	Bacillus_phage	65.1	5.6e-191
AVI28943.1|2317332_2318160_-	ribose-phosphate pyrophosphokinase	NA	A0A218KC69	Bacillus_phage	54.7	1.5e-76
AVI28944.1|2318210_2318708_-	hypothetical protein	NA	A0A1P8CX28	Bacillus_phage	79.9	8.2e-70
AVI28945.1|2318867_2319071_-	hypothetical protein	NA	O64150	Bacillus_phage	79.1	2.3e-26
AVI28946.1|2319082_2319790_-	hypothetical protein	NA	O64147	Bacillus_phage	34.0	3.9e-25
AVI28947.1|2319816_2323746_-	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	84.9	0.0e+00
AVI28948.1|2323758_2325486_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	80.6	6.8e-273
AVI28949.1|2325485_2326622_-	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	89.7	1.1e-205
AVI28950.1|2326637_2328152_-	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	95.0	2.9e-275
AVI28951.1|2328166_2328637_-	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	91.0	4.4e-81
AVI28952.1|2328678_2329650_-	hypothetical protein	NA	A0A1P8CX29	Bacillus_phage	95.7	5.9e-173
AVI28953.1|2329738_2330653_-	hypothetical protein	NA	O64140	Bacillus_phage	89.8	3.1e-155
AVI28954.1|2330675_2331056_-	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	79.2	6.3e-54
2331115:2331139	attL	TCAATAACTATTTTATTTTTATTCT	NA	NA	NA	NA
AVI28955.1|2331585_2331963_-	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	76.2	9.9e-52
AVI30909.1|2332035_2332272_+	hypothetical protein	NA	NA	NA	NA	NA
AVI28956.1|2332302_2332827_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28957.1|2332939_2334682_-	hypothetical protein	NA	O64135	Bacillus_phage	68.6	7.2e-222
AVI28958.1|2334678_2335503_-	hypothetical protein	NA	O64134	Bacillus_phage	62.7	1.0e-88
AVI28959.1|2335676_2336117_-	hypothetical protein	NA	A0A1S5SCZ9	Streptococcus_phage	35.6	2.4e-12
AVI28960.1|2336122_2336329_-	hypothetical protein	NA	A0A1P8CWZ9	Bacillus_phage	77.1	1.6e-11
AVI28961.1|2336303_2336570_-	hypothetical protein	NA	O64132	Bacillus_phage	89.9	4.9e-29
AVI28962.1|2336642_2337317_+	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	96.5	2.5e-77
AVI28963.1|2337386_2338199_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	87.8	3.6e-139
AVI28964.1|2338723_2339227_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	52.1	4.6e-36
AVI28965.1|2339267_2339576_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28966.1|2339587_2340112_-	hypothetical protein	NA	A0A1Z1DA37	Bacillus_phage	56.1	4.6e-47
AVI28967.1|2340480_2340855_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	61.8	1.4e-34
AVI28968.1|2340868_2341084_-	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	97.2	1.1e-31
AVI28969.1|2341286_2341904_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28970.1|2342230_2342506_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28971.1|2342549_2342873_-	hypothetical protein	NA	A0A1P8CWY4	Bacillus_phage	95.2	6.5e-52
AVI28972.1|2342920_2345119_-	phosphatase	NA	Q4Z932	Staphylococcus_phage	43.1	1.4e-158
AVI30910.1|2345167_2345575_-	hypothetical protein	NA	A0A1P8CWY3	Bacillus_phage	91.9	1.1e-67
AVI28973.1|2345747_2345951_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28974.1|2345947_2346370_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28975.1|2346403_2346628_-	hypothetical protein	NA	A0A1P8CWW8	Bacillus_phage	53.2	5.2e-16
AVI28976.1|2346735_2346981_-	hypothetical protein	NA	A0A1P8CWW5	Bacillus_phage	52.0	5.7e-16
AVI28977.1|2347055_2347355_-	hypothetical protein	NA	A0A1P8CWX3	Bacillus_phage	50.0	1.0e-19
AVI28978.1|2347520_2347742_+	XRE family transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	79.5	2.2e-27
AVI28979.1|2347962_2348946_-|integrase	integrase	integrase	A0A1P8CWX4	Bacillus_phage	78.0	1.9e-139
AVI28980.1|2348966_2350316_-	hypothetical protein	NA	A0A1P8CWX1	Bacillus_phage	75.2	4.8e-189
AVI28981.1|2350392_2351451_-|integrase	integrase	integrase	A0A1P8CWW9	Bacillus_phage	76.0	1.8e-154
AVI28982.1|2351663_2351894_-	hypothetical protein	NA	A0A1P8CWW1	Bacillus_phage	72.3	5.5e-21
AVI28983.1|2351908_2352121_-	hypothetical protein	NA	A0A1P8CWW7	Bacillus_phage	78.5	1.6e-22
AVI28984.1|2352715_2353861_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28985.1|2354016_2355108_-	hypothetical protein	NA	A0A1P8CWW3	Bacillus_phage	25.7	6.9e-13
AVI28986.1|2355531_2355663_-	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	90.7	9.4e-18
AVI28987.1|2355674_2355890_-	hypothetical protein	NA	A0A1P8CWW0	Bacillus_phage	52.1	1.1e-12
AVI28988.1|2355892_2356144_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	63.4	5.4e-22
AVI28989.1|2356214_2356397_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	89.7	1.0e-25
AVI28990.1|2356411_2356636_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28991.1|2356666_2356894_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28992.1|2356936_2357488_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28993.1|2357590_2357968_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28994.1|2357999_2358191_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28995.1|2358302_2358518_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28996.1|2358596_2358824_-	XRE family transcriptional regulator	NA	O64085	Bacillus_phage	40.8	4.8e-09
AVI28997.1|2358871_2359084_-	XRE family transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	73.9	1.2e-22
AVI28998.1|2359177_2359615_-	hypothetical protein	NA	NA	NA	NA	NA
AVI28999.1|2359694_2359967_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29000.1|2360447_2361539_+	acyltransferase	NA	NA	NA	NA	NA
AVI29001.1|2361906_2362836_-	hypothetical protein	NA	A0A1P8CWV0	Bacillus_phage	83.2	7.2e-136
2364446:2364470	attR	TCAATAACTATTTTATTTTTATTCT	NA	NA	NA	NA
>prophage 8
CP026610	Bacillus velezensis strain CGMCC 11640 chromosome, complete genome	4322979	2371327	2383856	4322979		Bacillus_phage(60.0%)	13	NA	NA
AVI29009.1|2371327_2372440_-	cell division protein FtsZ	NA	G3MBK4	Bacillus_virus	29.8	2.2e-30
AVI29010.1|2372439_2372724_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29011.1|2372902_2373139_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVI29012.1|2373258_2373438_+	hypothetical protein	NA	A0A1P8CWT4	Bacillus_phage	71.2	1.5e-18
AVI29013.1|2373478_2376004_+	hypothetical protein	NA	O64076	Bacillus_phage	84.6	0.0e+00
AVI29014.1|2376257_2376533_+	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	95.6	9.2e-39
AVI29015.1|2377127_2377418_+	hypothetical protein	NA	NA	NA	NA	NA
AVI29016.1|2377471_2378134_+	hypothetical protein	NA	K7PJU1	Enterobacteria_phage	39.9	5.5e-29
AVI29017.1|2378411_2378603_+	hypothetical protein	NA	A0A1P8CWT3	Bacillus_phage	98.4	5.6e-27
AVI29018.1|2378615_2379833_+	hypothetical protein	NA	A0A1P8CWS1	Bacillus_phage	99.5	3.3e-229
AVI29019.1|2380466_2380997_+	hypothetical protein	NA	U5J9P3	Bacillus_phage	32.8	5.7e-13
AVI29020.1|2381100_2382108_+	hypothetical protein	NA	Q331V7	Clostridium_botulinum_C_phage	24.2	1.6e-08
AVI29021.1|2382107_2383856_+	hypothetical protein	NA	A0A0K2FLD6	Brevibacillus_phage	30.8	8.7e-66
>prophage 9
CP026610	Bacillus velezensis strain CGMCC 11640 chromosome, complete genome	4322979	2389160	2436547	4322979	holin,coat,integrase,tail	Bacillus_phage(84.62%)	44	2387182:2387197	2436546:2436561
2387182:2387197	attL	ATGCTAAATCCCCTCT	NA	NA	NA	NA
AVI29028.1|2389160_2389826_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	50.0	5.3e-48
AVI29029.1|2389822_2390329_+	hypothetical protein	NA	O64060	Bacillus_phage	69.0	2.3e-64
AVI29030.1|2390325_2391051_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	33.2	1.9e-27
AVI29031.1|2391089_2391881_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	37.5	1.8e-18
AVI29032.1|2391901_2392369_+	hypothetical protein	NA	NA	NA	NA	NA
AVI29033.1|2392440_2392797_+	hypothetical protein	NA	O64055	Bacillus_phage	79.7	8.2e-48
AVI29034.1|2392796_2394128_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	53.5	5.0e-21
AVI29035.1|2394141_2394417_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	37.2	4.0e-10
AVI29036.1|2394417_2394570_+	XkdX family protein	NA	NA	NA	NA	NA
AVI29037.1|2395991_2396408_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	66.9	1.4e-46
AVI29038.1|2396421_2397441_+|integrase	integrase	integrase	A0A0E3U2P3	Fusobacterium_phage	35.8	3.0e-50
AVI29039.1|2398061_2398598_+	hypothetical protein	NA	NA	NA	NA	NA
AVI29040.1|2398673_2399102_+	hypothetical protein	NA	O64047	Bacillus_phage	37.4	1.4e-14
AVI29041.1|2399187_2399814_+	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	31.7	2.1e-22
AVI29042.1|2399877_2406756_+|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	78.8	0.0e+00
AVI29043.1|2406813_2407572_+|tail	phage tail protein	tail	O64045	Bacillus_phage	84.1	1.9e-126
AVI29044.1|2410886_2411705_+	hypothetical protein	NA	A0A1P8CWP7	Bacillus_phage	70.5	3.5e-110
AVI29045.1|2411746_2414272_+	hypothetical protein	NA	D6R401	Bacillus_phage	38.3	2.1e-145
AVI29046.1|2414444_2415488_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	56.1	6.1e-91
AVI30911.1|2415594_2415966_+	hypothetical protein	NA	NA	NA	NA	NA
AVI29047.1|2415978_2416230_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	86.7	5.2e-33
AVI29048.1|2416290_2416572_+	hypothetical protein	NA	NA	NA	NA	NA
AVI30912.1|2416586_2416847_+	hypothetical protein	NA	NA	NA	NA	NA
AVI29049.1|2416998_2418159_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	26.3	3.8e-33
AVI29050.1|2418322_2419573_-	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	91.1	1.5e-221
AVI29051.1|2419565_2419898_-	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	74.5	6.3e-42
AVI29052.1|2420125_2420899_-	sporulation protein YunB	NA	NA	NA	NA	NA
AVI29053.1|2421027_2421231_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29054.1|2421474_2421564_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AVI30913.1|2421860_2422334_-	SMI1/KNR4 family protein	NA	A0A1P8CWM6	Bacillus_phage	65.8	2.5e-60
AVI29055.1|2422435_2422924_-	TIGR01741 family protein	NA	NA	NA	NA	NA
AVI29056.1|2422913_2423402_-	SMI1/KNR4 family protein	NA	O64024	Bacillus_phage	89.4	5.2e-85
AVI29057.1|2423410_2425126_-	hypothetical protein	NA	O64023	Bacillus_phage	77.1	5.4e-254
AVI29058.1|2425302_2426283_+	endonuclease	NA	A0A1P8CWK6	Bacillus_phage	76.8	3.5e-80
AVI29059.1|2426532_2428074_+	recombinase family protein	NA	I3VYZ3	Thermoanaerobacterium_phage	32.1	6.3e-36
AVI29060.1|2428488_2429073_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AVI29061.1|2429407_2430910_-	carboxypeptidase M32	NA	NA	NA	NA	NA
AVI29062.1|2431021_2432941_-	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	21.8	1.8e-11
AVI29063.1|2433044_2433236_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29064.1|2433401_2433554_+	YpzG family protein	NA	NA	NA	NA	NA
AVI29065.1|2433594_2434761_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
AVI29066.1|2435294_2435594_-	cell division regulator GpsB	NA	NA	NA	NA	NA
AVI29067.1|2435673_2436222_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
AVI29068.1|2436310_2436547_-|coat	spore coat protein	coat	NA	NA	NA	NA
2436546:2436561	attR	ATGCTAAATCCCCTCT	NA	NA	NA	NA
>prophage 10
CP026610	Bacillus velezensis strain CGMCC 11640 chromosome, complete genome	4322979	2528108	2534361	4322979		Staphylococcus_phage(66.67%)	10	NA	NA
AVI29164.1|2528108_2528702_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
AVI29165.1|2528691_2529447_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	2.9e-10
AVI29166.1|2529654_2529744_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
AVI29167.1|2529831_2530353_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
AVI29168.1|2530297_2530513_+	hypothetical protein	NA	NA	NA	NA	NA
AVI29169.1|2530418_2530793_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVI29170.1|2530909_2531374_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
AVI29171.1|2531406_2532603_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	9.6e-117
AVI29172.1|2532617_2533265_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	2.6e-39
AVI29173.1|2533245_2534361_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	1.7e-54
>prophage 11
CP026610	Bacillus velezensis strain CGMCC 11640 chromosome, complete genome	4322979	3226160	3296125	4322979	portal,head,transposase,coat,holin,protease,capsid,terminase,tail	Bacillus_phage(40.0%)	77	NA	NA
AVI29795.1|3226160_3233039_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	56.1	0.0e+00
AVI29796.1|3233116_3233455_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29797.1|3233465_3233783_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29798.1|3233990_3234809_-|coat	P22 coat protein - protein 5 domain protein	coat	E5DV53	Deep-sea_thermophilic_phage	43.3	3.8e-56
AVI29799.1|3234837_3235437_-	hypothetical protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	44.5	4.0e-31
AVI29800.1|3235544_3236879_-|portal	phage portal protein	portal	I1TJV4	Clostridium_phage	31.1	2.3e-42
AVI29801.1|3236893_3238651_-	hypothetical protein	NA	A0A1V0DZW7	Clostridioides_phage	46.5	3.5e-147
AVI29802.1|3239003_3239567_+	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	50.5	3.7e-42
AVI29803.1|3239583_3239991_-|transposase	transposase	transposase	NA	NA	NA	NA
AVI29804.1|3240073_3240286_-	DNA-binding protein	NA	A0A1Z1LZP5	Bacillus_phage	51.6	4.5e-09
AVI29805.1|3240278_3240461_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29806.1|3240862_3241336_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	38.7	2.9e-24
AVI29807.1|3241332_3241503_-	XkdX family protein	NA	A0A1W6JQ64	Staphylococcus_phage	53.5	6.3e-06
AVI29808.1|3241503_3241887_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	69.2	2.9e-38
AVI29809.1|3241883_3242912_-	hypothetical protein	NA	Q9ZXE1	Bacillus_phage	82.7	2.5e-60
AVI29810.1|3242943_3243171_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29811.1|3243170_3243758_-	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	47.8	9.7e-38
AVI29812.1|3243766_3244552_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	48.4	1.1e-36
AVI29813.1|3244575_3245289_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	42.4	5.7e-48
AVI29814.1|3245288_3245765_-	hypothetical protein	NA	O64060	Bacillus_phage	45.5	1.7e-32
AVI29815.1|3246353_3246572_-	transcriptional regulator	NA	NA	NA	NA	NA
AVI29816.1|3246899_3249806_-	hypothetical protein	NA	O64076	Bacillus_phage	45.8	4.9e-223
AVI29817.1|3250029_3250665_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29818.1|3251065_3251578_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29819.1|3251828_3253007_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29820.1|3253285_3253498_+	hypothetical protein	NA	NA	NA	NA	NA
AVI29821.1|3253603_3255196_+	hypothetical protein	NA	A0A288WFZ3	Bacillus_phage	27.9	2.1e-34
AVI29822.1|3255543_3256074_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29823.1|3256220_3256709_+	DinB family protein	NA	NA	NA	NA	NA
AVI29824.1|3256710_3257292_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AVI29825.1|3257363_3258572_-	NAD-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
AVI29826.1|3258589_3260062_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVI29827.1|3260262_3260817_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVI30948.1|3260977_3261517_+	hypothetical protein	NA	NA	NA	NA	NA
AVI29828.1|3261680_3262349_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
AVI29829.1|3262382_3263228_-	GW domain-containing glycosaminoglycan-binding protein	NA	A0A0K2CP65	Brevibacillus_phage	45.2	1.1e-26
AVI29830.1|3263369_3264545_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AVI29831.1|3264763_3265405_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AVI29832.1|3265465_3265786_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29833.1|3268320_3268554_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29834.1|3268748_3269144_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29835.1|3269158_3269470_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29836.1|3269654_3269879_+	transcriptional regulator	NA	A0A2I7SC34	Paenibacillus_phage	45.2	8.3e-06
AVI29837.1|3270004_3270268_+	hypothetical protein	NA	NA	NA	NA	NA
AVI29838.1|3270501_3270744_-	DNA-binding protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	54.4	8.7e-17
AVI29839.1|3271196_3271868_-	hypothetical protein	NA	F8WPX5	Bacillus_phage	71.9	4.8e-65
AVI29840.1|3271888_3272155_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	62.1	2.2e-21
AVI29841.1|3272166_3272379_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	59.4	1.4e-15
AVI29842.1|3272414_3272654_-	XkdX family protein	NA	NA	NA	NA	NA
AVI29843.1|3272653_3272995_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29844.1|3272995_3274282_-	DUF2479 domain-containing protein	NA	A0A1J0MFQ3	Staphylococcus_phage	39.0	8.6e-79
AVI29845.1|3274298_3275309_-	SGNH/GDSL hydrolase family protein	NA	A0A1J0MFI8	Staphylococcus_phage	40.4	2.7e-64
AVI29846.1|3275305_3275614_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29847.1|3275606_3276761_-	hypothetical protein	NA	A0A1W6JQ67	Staphylococcus_phage	33.6	8.4e-25
AVI29848.1|3276770_3277610_-|tail	phage tail family protein	tail	A8ATA8	Listeria_phage	33.2	3.3e-31
AVI29849.1|3277612_3283606_-|tail	phage tail tape measure protein	tail	A0A0B5CTS6	Listeria_phage	35.3	4.1e-22
AVI29850.1|3283800_3284121_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29851.1|3284150_3284384_-	hypothetical protein	NA	A0A1P8CWR2	Bacillus_phage	52.7	4.6e-15
AVI29852.1|3284383_3284971_-	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	45.3	1.5e-38
AVI29853.1|3284979_3285588_-|tail	phage tail protein	tail	A0A2P0ZKX7	Lactobacillus_phage	36.3	5.2e-26
AVI29854.1|3285644_3286031_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29855.1|3286027_3286444_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AVI29856.1|3286440_3286770_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AVI29857.1|3286742_3287054_-	hypothetical protein	NA	E9LUQ4	Lactobacillus_phage	34.5	4.4e-05
AVI29858.1|3287067_3288270_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	47.5	2.9e-97
AVI29859.1|3288273_3289002_-|protease	Clp protease ClpP	protease	A0A2I7SDE1	Paenibacillus_phage	60.0	3.0e-68
AVI29860.1|3288976_3290200_-|portal	phage portal protein	portal	A0A2I7SCY4	Paenibacillus_phage	39.1	3.3e-72
AVI29861.1|3290211_3292002_-|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	57.7	2.0e-203
AVI29862.1|3291991_3292447_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	43.2	7.8e-27
AVI30949.1|3292675_3292987_-	endonuclease	NA	A0A0C5AEM7	Paenibacillus_phage	45.2	5.5e-16
AVI29863.1|3293013_3293250_-	hypothetical protein	NA	A0A217EQZ2	Bacillus_phage	49.1	1.4e-08
AVI29864.1|3293281_3293551_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29865.1|3293849_3294128_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29866.1|3294128_3294371_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29867.1|3294821_3295019_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29868.1|3295011_3295200_-	hypothetical protein	NA	NA	NA	NA	NA
AVI29869.1|3295384_3296125_-	hypothetical protein	NA	A0A2D1GQ65	Lysinibacillus_phage	39.7	1.6e-24
>prophage 12
CP026610	Bacillus velezensis strain CGMCC 11640 chromosome, complete genome	4322979	3983266	4028381	4322979	protease,coat	Cafeteria_roenbergensis_virus(11.11%)	47	NA	NA
AVI30503.1|3983266_3983926_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AVI30504.1|3984031_3984220_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AVI30505.1|3984257_3984677_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVI30506.1|3985062_3986442_+	amino acid permease	NA	NA	NA	NA	NA
AVI30507.1|3986507_3987008_-	YwgA family protein	NA	NA	NA	NA	NA
AVI30508.1|3987047_3988349_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.5	1.0e-23
AVI30509.1|3988508_3988733_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
AVI30510.1|3988935_3989709_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
AVI30511.1|3990008_3990284_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AVI30512.1|3990284_3990839_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
AVI30513.1|3990936_3991857_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.6	3.8e-36
AVI30514.1|3991853_3992807_+	ABC transporter permease	NA	NA	NA	NA	NA
AVI30515.1|3992796_3993633_-	hypothetical protein	NA	NA	NA	NA	NA
AVI30516.1|3993623_3994421_-	hypothetical protein	NA	NA	NA	NA	NA
AVI30517.1|3994389_3995313_-	hypothetical protein	NA	NA	NA	NA	NA
AVI30518.1|3995361_3995541_-	hypothetical protein	NA	NA	NA	NA	NA
AVI30519.1|3995694_3996558_-	lipoyl-[GcvH]:protein N-lipoyltransferase	NA	NA	NA	NA	NA
AVI30520.1|3996604_3997504_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.1e-07
AVI30521.1|3997619_3998597_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
AVI30522.1|3998634_3999606_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AVI30523.1|3999867_4000632_+	heme-binding protein	NA	NA	NA	NA	NA
AVI30524.1|4000751_4001531_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AVI30525.1|4001547_4002747_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AVI30526.1|4002759_4003941_-	MFS transporter	NA	NA	NA	NA	NA
AVI30527.1|4003937_4005356_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AVI30528.1|4005373_4006135_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.1	4.8e-21
AVI30529.1|4006131_4006842_-	bacilysin biosynthesis protein BacB	NA	NA	NA	NA	NA
AVI30530.1|4006831_4007446_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
AVI30531.1|4007607_4008846_-	MFS transporter	NA	NA	NA	NA	NA
AVI30532.1|4009068_4010271_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	25.9	1.2e-26
AVI30533.1|4010303_4011722_-	amino acid permease	NA	NA	NA	NA	NA
AVI30534.1|4011746_4013429_-	peptidase M20	NA	NA	NA	NA	NA
AVI30535.1|4013500_4015048_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AVI30536.1|4015255_4016542_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
AVI30537.1|4016726_4017188_-	hypothetical protein	NA	NA	NA	NA	NA
AVI30538.1|4017403_4017859_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVI30539.1|4017855_4018704_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	5.4e-37
AVI30540.1|4018724_4019672_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.9	5.9e-69
AVI30541.1|4019674_4020412_-	glucose-1-phosphate thymidylyltransferase	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
AVI30542.1|4020439_4021444_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVI30543.1|4021445_4022189_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVI30544.1|4022178_4023300_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVI30545.1|4023299_4024163_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVI30546.1|4024163_4025333_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
AVI30547.1|4025355_4026780_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
AVI30548.1|4026784_4027555_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.3	4.4e-06
AVI30549.1|4027835_4028381_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
