The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027169	Pseudomonas aeruginosa strain AR_0356 chromosome, complete genome	6586916	724696	794128	6586916	capsid,portal,lysis,terminase,protease,plate,integrase,tRNA,tail,head	Pseudomonas_phage(79.07%)	86	758527:758573	790461:790507
AVK03676.1|724696_725158_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
AVK04854.1|725220_725712_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
AVK03067.1|725748_726003_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	43.4	2.1e-13
AVK08936.1|726004_726424_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
AVK05178.1|726749_728297_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVK05917.1|728283_728424_-	hypothetical protein	NA	NA	NA	NA	NA
AVK03423.1|728513_729332_+|protease	CAAX protease self-immunity family protein	protease	NA	NA	NA	NA
AVK07860.1|729481_730768_+	peptidase M23 family protein	NA	G9BW84	Planktothrix_phage	39.8	2.9e-10
AVK07260.1|730796_732107_+	C-terminal processing peptidase family protein	NA	A0A0R6PIZ1	Moraxella_phage	29.0	3.9e-26
AVK07097.1|732205_732883_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AVK06134.1|732971_734432_+	hypothetical protein	NA	NA	NA	NA	NA
AVK06040.1|734471_735227_-	bacterial extracellular solute-binding, 3 family protein	NA	NA	NA	NA	NA
AVK03580.1|735377_736130_-	bacterial extracellular solute-binding, 3 family protein	NA	NA	NA	NA	NA
AVK09063.1|736219_736966_-	bacterial extracellular solute-binding, 3 family protein	NA	NA	NA	NA	NA
AVK05891.1|737137_737908_-	imidazoleglycerol phosphate synthase, cyclase subunit	NA	NA	NA	NA	NA
AVK07664.1|737918_738656_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
AVK07228.1|738704_738965_-	hypothetical protein	NA	NA	NA	NA	NA
AVK06868.1|738968_739592_-	imidazole glycerol phosphate synthase, glutamine amidotransferase subunit	NA	NA	NA	NA	NA
AVK08427.1|739606_740200_-	imidazoleglycerol-phosphate dehydratase family protein	NA	NA	NA	NA	NA
AVK07808.1|740367_740760_+	acetyltransferase family protein	NA	NA	NA	NA	NA
AVK04832.1|740796_741033_+	hypothetical protein	NA	NA	NA	NA	NA
AVK08181.1|741029_742136_+	putative conserved exported protein	NA	NA	NA	NA	NA
AVK07412.1|742241_744494_+	asmA-like C-terminal region family protein	NA	NA	NA	NA	NA
AVK03814.1|744490_745558_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AVK07244.1|745600_745873_+	bacterial Fe(2+) trafficking family protein	NA	NA	NA	NA	NA
AVK05574.1|745900_746983_+	putative oxidoreductase	NA	NA	NA	NA	NA
AVK02934.1|747228_747966_-	enoyl-(Acyl carrier) reductase family protein	NA	NA	NA	NA	NA
AVK05977.1|748124_748814_+	hypothetical protein	NA	NA	NA	NA	NA
AVK02947.1|749062_749836_+	ABC transporter family protein	NA	G3M9Y6	Bacillus_virus	31.1	9.3e-20
AVK06598.1|749850_750603_+	bacterial extracellular solute-binding, 3 family protein	NA	NA	NA	NA	NA
AVK05653.1|750664_751360_+	amino ABC transporter, permease, 3-TM region, His/Glu/Gln/Arg/opine family domain protein	NA	NA	NA	NA	NA
AVK04798.1|751356_752049_+	amino ABC transporter, permease, 3-TM region, His/Glu/Gln/Arg/opine family domain protein	NA	NA	NA	NA	NA
AVK03553.1|752117_753338_+	methyltransferase domain protein	NA	NA	NA	NA	NA
AVK08070.1|753738_754209_+	winged helix DNA-binding domain protein	NA	NA	NA	NA	NA
AVK07197.1|754212_755685_+	efflux transporter, outer membrane factor (OMF) lipo, NodT family protein	NA	NA	NA	NA	NA
AVK07107.1|755699_756884_+	efflux transporter, RND family, MFP subunit	NA	NA	NA	NA	NA
AVK08347.1|756894_758424_+	H+ antiporter-2 family protein	NA	NA	NA	NA	NA
758527:758573	attL	GACTTGTAATCAGTAGGTCCCGGGTTCGACTCCTGGTGCCGGCACCA	NA	NA	NA	NA
AVK05985.1|758632_759976_-	bacterial SH3 domain protein	NA	NA	NA	NA	NA
AVK03313.1|759989_760970_-|integrase	phage integrase family protein	integrase	A0A0U4IBS1	Pseudomonas_phage	67.3	1.3e-119
AVK05214.1|761046_761211_-	hypothetical protein	NA	A0A0U4ISL7	Pseudomonas_phage	63.5	7.4e-12
AVK04910.1|761387_761630_+	hypothetical protein	NA	A0A0U4KLD7	Pseudomonas_phage	71.1	2.2e-20
AVK06758.1|761639_764294_+	toprim domain protein	NA	A0A0U3TH43	Pseudomonas_phage	56.5	2.0e-300
AVK04544.1|764321_764489_+	hypothetical protein	NA	NA	NA	NA	NA
AVK08188.1|764737_765139_+	hypothetical protein	NA	A0A0U4IIM6	Pseudomonas_phage	91.7	7.5e-66
AVK05847.1|765155_765503_+	hypothetical protein	NA	A0A0U4JP55	Pseudomonas_phage	96.5	2.2e-58
AVK04391.1|765532_765889_+	hypothetical protein	NA	A0A0U4JXA4	Pseudomonas_phage	60.3	4.0e-34
AVK05657.1|765959_766235_+	hypothetical protein	NA	NA	NA	NA	NA
AVK04294.1|766227_766488_+	arc-like DNA binding domain protein	NA	A0A0U4B0M9	Pseudomonas_phage	89.5	2.5e-30
AVK05187.1|766484_766841_+	hypothetical protein	NA	NA	NA	NA	NA
AVK04663.1|766830_767061_+	hypothetical protein	NA	NA	NA	NA	NA
AVK08292.1|767057_767336_+	hypothetical protein	NA	A0A0U4B0R1	Pseudomonas_phage	97.8	7.8e-46
AVK06666.1|767453_767606_-	hypothetical protein	NA	NA	NA	NA	NA
AVK05182.1|767902_768034_-	putative ogr/Delta-like zinc finger	NA	NA	NA	NA	NA
AVK09108.1|768204_768912_-|portal	phage portal protein, PBSX family	portal	A0A0U4B0L9	Pseudomonas_phage	99.1	3.1e-131
AVK05503.1|768970_771019_-|terminase	ATPase subunit of terminase family protein	terminase	A0A0U4JIZ9	Pseudomonas_phage	99.1	0.0e+00
AVK08648.1|771230_772151_+|capsid	phage capsid scaffolding (GPO) serine peptidase family protein	capsid	A0A0U4JVV6	Pseudomonas_phage	99.3	1.5e-138
AVK03688.1|772150_773173_+|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	99.7	2.4e-193
AVK04083.1|773169_773919_+|terminase	phage small terminase subunit	terminase	A0A0U4JEJ1	Pseudomonas_phage	84.6	1.4e-97
AVK04503.1|774016_774478_+|head	phage head completion family protein	head	A0A0U4J933	Pseudomonas_phage	95.4	1.7e-77
AVK02938.1|774477_774951_+	hypothetical protein	NA	NA	NA	NA	NA
AVK08539.1|774947_775385_+|tail	P2 phage tail completion R family protein	tail	A0A0U4IBS7	Pseudomonas_phage	95.9	6.7e-76
AVK08690.1|775377_776043_+	phage virion morphogenesis family protein	NA	A0A0U4ISN1	Pseudomonas_phage	98.2	1.3e-118
AVK04108.1|776054_777170_+	hypothetical protein	NA	A0A0U4KLE6	Pseudomonas_phage	98.9	1.6e-206
AVK04801.1|777172_777622_+	hypothetical protein	NA	A0A0U3TH58	Pseudomonas_phage	100.0	8.7e-79
AVK08002.1|777621_777831_+	prokaryotic dksA/traR C4-type zinc finger family protein	NA	A0A0U4IIN4	Pseudomonas_phage	95.7	3.7e-32
AVK07830.1|777881_778136_+	hypothetical protein	NA	NA	NA	NA	NA
AVK08482.1|778168_778594_+	lysozyme RrrD	NA	A0A0U4JP67	Pseudomonas_phage	98.6	7.5e-72
AVK05509.1|778590_779076_+|lysis	bacteriophage lysis family protein	lysis	A0A0U4JXC2	Pseudomonas_phage	91.9	2.9e-72
AVK07168.1|779072_779360_+	hypothetical protein	NA	A0A0U4B0P2	Pseudomonas_phage	98.9	3.4e-44
AVK08661.1|779383_779524_+	hypothetical protein	NA	A0A0U4B0S4	Pseudomonas_phage	97.8	4.8e-20
AVK04024.1|779538_781578_+|tail	phage tail tape measure protein, TP901 family, core region	tail	A0A0U4IJ81	Pseudomonas_phage	99.1	0.0e+00
AVK08126.1|781574_781895_+	hypothetical protein	NA	A0A0U4B0N5	Pseudomonas_phage	100.0	4.2e-51
AVK04144.1|781891_783064_+|plate	baseplate J-like family protein	plate	A0A0U4JJ14	Pseudomonas_phage	100.0	1.5e-223
AVK04740.1|783071_783581_+|tail	phage tail family protein	tail	A0A0U4JVX3	Pseudomonas_phage	98.8	6.4e-94
AVK06759.1|783592_785557_+|tail	phage tail-collar fiber family protein	tail	A0A0U4K5K2	Pseudomonas_phage	99.8	0.0e+00
AVK05498.1|785570_786281_+|tail	tail fiber assembly protein-like domain protein	tail	A0A0U4JEJ6	Pseudomonas_phage	99.6	1.4e-134
AVK05215.1|786277_787198_+	hypothetical protein	NA	A5X9J6	Aeromonas_virus	34.5	1.0e-17
AVK06790.1|787194_787734_+	putative bacterial nucleoid DNA-binding protein	NA	A0A0U4J942	Pseudomonas_phage	100.0	8.0e-95
AVK07629.1|787733_788432_+	hypothetical protein	NA	A0A1D9CA29	Salinivibrio_phage	36.9	9.5e-40
AVK07053.1|788416_789388_+	putative gp5 domain protein	NA	A0A0U4IBV2	Pseudomonas_phage	100.0	1.4e-182
AVK08334.1|789430_789835_-	hypothetical protein	NA	A0A0U4ISP5	Pseudomonas_phage	100.0	4.2e-72
AVK06811.1|789862_790030_-	ycfA-like family protein	NA	A0A0U4KLG1	Pseudomonas_phage	98.2	5.9e-25
AVK04309.1|790741_791800_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.9	1.0e-85
790461:790507	attR	GACTTGTAATCAGTAGGTCCCGGGTTCGACTCCTGGTGCCGGCACCA	NA	NA	NA	NA
AVK03831.1|791796_792705_+	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
AVK07497.1|792701_793583_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	60.6	7.1e-101
AVK06108.1|793582_794128_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.2	1.7e-52
>prophage 2
CP027169	Pseudomonas aeruginosa strain AR_0356 chromosome, complete genome	6586916	1026158	1045584	6586916	holin	Catovirus(33.33%)	18	NA	NA
AVK08206.1|1026158_1027844_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	2.7e-56
AVK05094.1|1027979_1029452_-	betaine aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVK07932.1|1029512_1030106_-	transcriptional repressor BetI	NA	NA	NA	NA	NA
AVK05304.1|1030067_1030184_+	putative transcriptional regulator BetI	NA	NA	NA	NA	NA
AVK03062.1|1030384_1031989_+|holin	transporter, betaine/carnitine/choline transporter family protein	holin	A0A2I7QNT1	Vibrio_phage	27.0	2.7e-21
AVK04963.1|1032198_1033377_-|holin	choline ABC transporter, ATP-binding protein	holin	G3M9Y6	Bacillus_virus	35.1	1.9e-24
AVK08532.1|1033380_1034220_-|holin	choline ABC transporter, permease protein	holin	NA	NA	NA	NA
AVK03508.1|1034261_1035200_-|holin	choline ABC transporter, periplasmic binding family protein	holin	NA	NA	NA	NA
AVK04126.1|1035396_1035624_-	hypothetical protein	NA	NA	NA	NA	NA
AVK03029.1|1035663_1037040_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AVK03397.1|1037454_1038558_+	amidotransferase family protein	NA	NA	NA	NA	NA
AVK08545.1|1038610_1038859_-	hypothetical protein	NA	NA	NA	NA	NA
AVK03545.1|1039131_1040022_-	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AVK05679.1|1040129_1041197_+	hypothetical protein	NA	NA	NA	NA	NA
AVK07469.1|1042141_1042621_-	hypothetical protein	NA	NA	NA	NA	NA
AVK03539.1|1042671_1043637_-	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
AVK04549.1|1043688_1044573_-	hypothetical protein	NA	NA	NA	NA	NA
AVK07319.1|1044645_1045584_-|holin	choline ABC transporter, periplasmic binding family protein	holin	NA	NA	NA	NA
>prophage 3
CP027169	Pseudomonas aeruginosa strain AR_0356 chromosome, complete genome	6586916	1911629	1974416	6586916	plate,holin,integrase,tRNA,tail	Pseudomonas_phage(23.33%)	66	1905411:1905428	1973715:1973732
1905411:1905428	attL	GGCCCGCTCCAGCAGGGC	NA	NA	NA	NA
AVK05988.1|1911629_1912691_-|integrase	phage integrase family protein	integrase	W6MYA3	Pseudomonas_phage	38.0	2.1e-46
AVK06718.1|1912910_1916648_-	diguanylate cyclase domain protein	NA	A0A127AWB9	Bacillus_phage	36.9	1.3e-13
AVK06305.1|1916754_1918608_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.8	1.2e-36
AVK08215.1|1918590_1918734_+	hypothetical protein	NA	NA	NA	NA	NA
AVK08864.1|1918687_1920679_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	37.0	3.2e-72
AVK06797.1|1920761_1921211_-	yqey-like family protein	NA	A0A292GL36	Xanthomonas_phage	38.8	5.0e-18
AVK04775.1|1921278_1921494_-	ribosomal protein S21	NA	NA	NA	NA	NA
AVK06546.1|1921694_1922720_+|tRNA	tRNA threonylcarbamoyl adenosine modification protein YgjD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	1.8e-108
AVK03457.1|1922798_1923368_-	acyl-phosphate glycerol 3-phosphate acyltransferase	NA	NA	NA	NA	NA
AVK04138.1|1923451_1923805_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AVK03537.1|1923795_1924338_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AVK03494.1|1924310_1925543_-	putative RNA and SrmB- binding site of polymerase A family protein	NA	A0A1V0E714	Klebsiella_phage	43.0	5.3e-78
AVK07113.1|1925585_1926092_-	hypothetical protein	NA	NA	NA	NA	NA
AVK06525.1|1926186_1927740_-	spoVR like family protein	NA	NA	NA	NA	NA
AVK05795.1|1927736_1929005_-	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.1e-09
AVK06912.1|1929105_1931028_-	prkA AAA domain protein	NA	NA	NA	NA	NA
AVK05702.1|1931049_1931163_+	hypothetical protein	NA	NA	NA	NA	NA
AVK02809.1|1931308_1931641_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
AVK05595.1|1931684_1932536_-	bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	30.9	9.6e-10
AVK06644.1|1932535_1932916_-	hypothetical protein	NA	NA	NA	NA	NA
AVK06841.1|1932952_1933759_-	dimethyladenosine transferase	NA	NA	NA	NA	NA
AVK04328.1|1933874_1934861_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
AVK08217.1|1934857_1936072_-	chaperone SurA	NA	NA	NA	NA	NA
AVK03850.1|1936130_1938893_-	organic solvent tolerance family protein	NA	NA	NA	NA	NA
AVK07561.1|1939037_1940054_+	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
AVK08696.1|1940050_1940725_+	nucleotidyl transferase family protein	NA	NA	NA	NA	NA
AVK04720.1|1940726_1941485_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
AVK03786.1|1941485_1942535_-	hypothetical protein	NA	NA	NA	NA	NA
AVK03572.1|1942686_1945086_+	sensory box protein	NA	NA	NA	NA	NA
AVK05883.1|1945131_1945761_+	bacterial regulatory, luxR family protein	NA	NA	NA	NA	NA
AVK04159.1|1945892_1946924_+	bacterial extracellular solute-binding family protein	NA	NA	NA	NA	NA
AVK08854.1|1947157_1948267_+	polyamine ABC transporter, ATP-binding family protein	NA	G3M9Y6	Bacillus_virus	34.4	1.0e-27
AVK06405.1|1948322_1949369_+	bacterial extracellular solute-binding family protein	NA	NA	NA	NA	NA
AVK03627.1|1949480_1950728_+	binding-protein-dependent transport system inner membrane component family protein	NA	NA	NA	NA	NA
AVK06710.1|1950801_1951632_+	binding-protein-dependent transport system inner membrane component family protein	NA	NA	NA	NA	NA
AVK08614.1|1951755_1952430_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AVK02895.1|1952429_1953248_+	phosphoglycolate phosphatase, bacterial	NA	NA	NA	NA	NA
AVK05547.1|1953320_1954799_+	anthranilate synthase component I	NA	NA	NA	NA	NA
AVK04237.1|1955083_1955398_-	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
AVK08572.1|1955498_1956269_-	repressor protein CI	NA	A0A1B0Z078	Pseudomonas_phage	58.5	3.0e-71
AVK05959.1|1956726_1956927_+	phage/conjugal plasmid C-4 type zinc finger, TraR family protein	NA	Q9ZXI6	Pseudomonas_virus	48.4	1.0e-07
AVK04597.1|1956972_1957332_+	hypothetical protein	NA	NA	NA	NA	NA
AVK05979.1|1957788_1958142_+|holin	putative holin	holin	B5TK61	Pseudomonas_phage	51.7	3.9e-26
AVK07804.1|1958163_1958679_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	46.3	3.0e-35
AVK08705.1|1958675_1959233_+|plate	phage baseplate assembly V family protein	plate	A0A2H4JG06	uncultured_Caudovirales_phage	53.7	5.4e-46
AVK05804.1|1959394_1959712_+	lysozyme family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	57.1	1.4e-27
AVK08454.1|1959708_1960596_+|plate	baseplate J-like family protein	plate	E5G6N8	Salmonella_phage	59.3	5.3e-88
AVK08280.1|1960588_1961122_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	65.7	1.6e-63
AVK02970.1|1961123_1963232_+|tail	phage tail-collar fiber family protein	tail	Q9ZXK6	Pseudomonas_virus	52.1	2.9e-225
AVK08074.1|1963198_1963324_-	hypothetical protein	NA	NA	NA	NA	NA
AVK04584.1|1963318_1963681_+|tail	caudovirales tail fiber assembly family protein	tail	NA	NA	NA	NA
AVK03481.1|1963723_1964884_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	5.9e-188
AVK08097.1|1964896_1965400_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	71.6	6.1e-65
AVK05161.1|1965414_1965759_+	mu-like prophage FluMu gp41 family protein	NA	NA	NA	NA	NA
AVK05879.1|1965712_1965838_+	hypothetical protein	NA	NA	NA	NA	NA
AVK08619.1|1965931_1968196_+|tail	phage tail tape measure protein, TP901 family, core region	tail	NA	NA	NA	NA
AVK09114.1|1968205_1969075_+	phage P2 GpU family protein	NA	A0A2H4J875	uncultured_Caudovirales_phage	51.2	7.8e-76
AVK06516.1|1969049_1969256_+	phage Tail Protein X family protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	61.2	5.6e-17
AVK08580.1|1969313_1970309_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	58.2	3.1e-108
AVK07021.1|1970333_1970963_+	chitinase class I family protein	NA	A0A125RNP1	Pseudomonas_phage	77.5	1.5e-84
AVK03292.1|1970959_1971322_+	hypothetical protein	NA	A0A0S2SY58	Pseudomonas_phage	50.0	4.2e-15
AVK07542.1|1971318_1971576_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	68.3	5.2e-20
AVK06455.1|1971533_1971911_-	hypothetical protein	NA	NA	NA	NA	NA
AVK04853.1|1971926_1972532_+	anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	64.7	1.9e-73
AVK06793.1|1972533_1973583_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	2.4e-111
AVK08563.1|1973579_1974416_+	indole-3-glycerol phosphate synthase family protein	NA	A0A0P0IR83	Acinetobacter_phage	56.9	1.2e-70
1973715:1973732	attR	GCCCTGCTGGAGCGGGCC	NA	NA	NA	NA
>prophage 4
CP027169	Pseudomonas aeruginosa strain AR_0356 chromosome, complete genome	6586916	2723959	2732982	6586916		Bacillus_phage(33.33%)	9	NA	NA
AVK06183.1|2723959_2724595_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.7	3.0e-40
AVK08776.1|2724715_2725534_+	biotin-lipoyl like family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	2.8e-06
AVK03507.1|2725634_2726639_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	1.2e-35
AVK04688.1|2727064_2727388_-	ferredoxin-1	NA	NA	NA	NA	NA
AVK03907.1|2727454_2729995_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.0	7.0e-24
AVK03437.1|2730001_2730166_+	hypothetical protein	NA	NA	NA	NA	NA
AVK07258.1|2730147_2731155_-	WD40-like Beta Propeller Repeat family protein	NA	NA	NA	NA	NA
AVK06996.1|2731301_2731808_+	competence/damage-inducible CinA C-terminal domain protein	NA	B5TK85	Pseudomonas_phage	73.4	9.9e-55
AVK05533.1|2731941_2732982_+	protein RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 5
CP027169	Pseudomonas aeruginosa strain AR_0356 chromosome, complete genome	6586916	3255229	3294895	6586916	portal,lysis,terminase,holin,integrase,head	Pseudomonas_phage(88.89%)	62	3244205:3244221	3263701:3263717
3244205:3244221	attL	TCGCCGCGCAGCAGCGC	NA	NA	NA	NA
AVK04540.1|3255229_3256237_-|integrase	phage integrase family protein	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	53.8	4.5e-99
AVK05234.1|3256278_3256521_-	hypothetical protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	60.3	6.6e-17
AVK08105.1|3256504_3256861_-	hypothetical protein	NA	NA	NA	NA	NA
AVK05142.1|3256865_3257555_-	hypothetical protein	NA	A0A0A0YUE3	Pseudomonas_phage	36.0	2.0e-29
AVK03000.1|3257548_3257671_-	hypothetical protein	NA	NA	NA	NA	NA
AVK03527.1|3257727_3257919_-	hypothetical protein	NA	A0A1W6JTB8	Pseudomonas_phage	98.3	3.3e-27
AVK05807.1|3257918_3258041_-	putative membrane protein	NA	A0A0A0YWF9	Pseudomonas_phage	94.7	1.8e-10
AVK07433.1|3258037_3258745_-	hypothetical protein	NA	A0A0A0YUE9	Pseudomonas_phage	100.0	1.6e-47
AVK06369.1|3258741_3259077_-	hypothetical protein	NA	A0A1W6JTA6	Pseudomonas_phage	89.2	9.1e-49
AVK08511.1|3259079_3259310_-	arc-like DNA binding domain protein	NA	A0A1W6JTB4	Pseudomonas_phage	98.7	2.8e-33
AVK03071.1|3259312_3260317_-	ice nucleation protein	NA	Q775A9	Bordetella_phage	67.2	1.7e-37
AVK04869.1|3260359_3261196_-	SPFH domain / Band 7 family protein	NA	A0A0A0YRT7	Pseudomonas_phage	99.6	2.9e-128
AVK04349.1|3261192_3261447_-	putative membrane protein	NA	A0A0A0YUF2	Pseudomonas_phage	100.0	3.8e-39
AVK04466.1|3261546_3261780_-	hypothetical protein	NA	A0A0A0YQ28	Pseudomonas_phage	98.7	3.3e-37
AVK08537.1|3261782_3262169_-	bacterial regulatory, luxR family protein	NA	A0A1W6JTA9	Pseudomonas_phage	94.9	6.4e-54
AVK02724.1|3262161_3262278_+	hypothetical protein	NA	NA	NA	NA	NA
AVK08423.1|3262317_3262632_-	peptidase S24-like family protein	NA	A0A1W6JTC8	Pseudomonas_phage	69.9	1.6e-39
AVK04750.1|3263086_3263392_+	helix-turn-helix domain protein	NA	A0A127KNT2	Pseudomonas_phage	53.0	4.0e-11
AVK03719.1|3263388_3263889_+	hypothetical protein	NA	Q9XJS9	Pseudomonas_phage	54.8	1.3e-43
3263701:3263717	attR	GCGCTGCTGCGCGGCGA	NA	NA	NA	NA
AVK03905.1|3264170_3264350_+	hypothetical protein	NA	A0A0A0YUF6	Pseudomonas_phage	98.3	9.2e-24
AVK05730.1|3264346_3264634_+	hypothetical protein	NA	A0A0A0YQ33	Pseudomonas_phage	100.0	7.6e-44
AVK04292.1|3264630_3264939_+	hypothetical protein	NA	A0A0A0YWH5	Pseudomonas_phage	94.1	5.1e-46
AVK05135.1|3264929_3265085_-	hypothetical protein	NA	NA	NA	NA	NA
AVK05088.1|3265206_3265440_+	hypothetical protein	NA	A0A0A0YRU7	Pseudomonas_phage	97.4	9.8e-34
AVK07029.1|3265529_3265928_+	hypothetical protein	NA	A0A1W6JTB9	Pseudomonas_phage	91.7	6.3e-65
AVK02797.1|3265924_3266719_+	phage antirepressor domain protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	46.0	7.0e-23
AVK07821.1|3266715_3267030_+	hypothetical protein	NA	NA	NA	NA	NA
AVK03342.1|3267026_3267344_+	hypothetical protein	NA	NA	NA	NA	NA
AVK03202.1|3267481_3267766_+	hypothetical protein	NA	NA	NA	NA	NA
AVK08372.1|3267984_3268875_+	hypothetical protein	NA	A0A222ZKP2	Mycobacterium_phage	45.8	1.8e-11
AVK06589.1|3268868_3270680_+	dnaB-like helicase C terminal domain protein	NA	A0A0U4B0G9	Pseudomonas_phage	70.1	1.8e-260
AVK06211.1|3270676_3270955_+	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	100.0	2.3e-45
AVK03628.1|3270972_3271341_+	phage antitermination Q family protein	NA	A0A1W6JTD2	Pseudomonas_phage	98.4	9.0e-66
AVK03887.1|3271793_3272396_+	HNH endonuclease family protein	NA	A0A2I7RZ08	Vibrio_phage	40.6	1.4e-31
AVK05408.1|3272416_3272749_+|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	97.3	6.5e-55
AVK03144.1|3272745_3273363_+	chitinase class I family protein	NA	A0A1W6JTC9	Pseudomonas_phage	94.6	1.9e-108
AVK04996.1|3273383_3273833_+|lysis	bacteriophage lysis family protein	lysis	A0A1B0Z001	Pseudomonas_phage	95.3	1.1e-68
AVK05353.1|3273829_3274573_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	98.0	1.3e-132
AVK04341.1|3274775_3275270_+	phage DNA packaging Nu1 family protein	NA	A0A1B0Z033	Pseudomonas_phage	99.4	2.4e-85
AVK05506.1|3275241_3277206_+|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	98.5	0.0e+00
AVK03558.1|3277196_3277412_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	100.0	6.5e-32
AVK04253.1|3277411_3279058_+|portal	phage portal protein, lambda family	portal	A0A1W6JTB6	Pseudomonas_phage	99.1	0.0e+00
AVK06938.1|3279029_3281111_+|head	mu-like prophage major head subunit gpT family protein	head	A0A1B0YZU0	Pseudomonas_phage	98.1	0.0e+00
AVK05022.1|3281177_3281495_+	hypothetical protein	NA	A0A1B0YZT7	Pseudomonas_phage	98.1	1.7e-49
AVK08950.1|3281566_3281821_+	hypothetical protein	NA	A0A1B0YZU3	Pseudomonas_phage	98.8	4.8e-42
AVK07707.1|3281916_3282288_+	hypothetical protein	NA	A0A1W6JT75	Pseudomonas_phage	96.7	2.4e-66
AVK03625.1|3282291_3282486_+	hypothetical protein	NA	A0A1W6JT79	Pseudomonas_phage	93.8	2.8e-26
AVK04606.1|3282487_3283240_+	hypothetical protein	NA	A0A1B0YZT8	Pseudomonas_phage	98.4	9.9e-136
AVK06933.1|3283969_3284272_+	hypothetical protein	NA	A0A1B0YZV7	Pseudomonas_phage	86.0	5.3e-40
AVK02816.1|3284374_3286858_+	tape measure domain protein	NA	A0A1B0YZV6	Pseudomonas_phage	98.1	0.0e+00
AVK04518.1|3287281_3287419_+	hypothetical protein	NA	A0A1B0YZV5	Pseudomonas_phage	97.8	6.2e-20
AVK07024.1|3287418_3289116_+	hypothetical protein	NA	A0A1W6JTA3	Pseudomonas_phage	94.9	4.0e-310
AVK03985.1|3289118_3289529_+	hypothetical protein	NA	A0A1W6JT78	Pseudomonas_phage	91.9	2.3e-54
AVK04078.1|3289879_3290065_+	hypothetical protein	NA	NA	NA	NA	NA
AVK08171.1|3290076_3290481_+	hypothetical protein	NA	A0A0A0YR47	Pseudomonas_phage	94.8	7.1e-64
AVK05180.1|3290477_3292133_+	hypothetical protein	NA	A0A0A0YRR5	Pseudomonas_phage	60.7	8.4e-204
AVK06685.1|3292349_3292748_+	putative suh protein	NA	A0A1W6JT86	Pseudomonas_phage	97.7	5.7e-66
AVK08243.1|3292740_3292932_+	hypothetical protein	NA	A0A1W6JT89	Pseudomonas_phage	100.0	2.0e-29
AVK02765.1|3292934_3293495_+	hypothetical protein	NA	A0A1B0YZW5	Pseudomonas_phage	96.8	3.0e-97
AVK05066.1|3293495_3293777_+	hypothetical protein	NA	A0A1W6JTD4	Pseudomonas_phage	96.8	6.7e-45
AVK04777.1|3294353_3294656_+	hypothetical protein	NA	A0A0S2SY61	Pseudomonas_phage	97.0	1.4e-48
AVK05108.1|3294652_3294895_+	hypothetical protein	NA	A0A0A0YQ17	Pseudomonas_phage	90.0	6.2e-31
>prophage 6
CP027169	Pseudomonas aeruginosa strain AR_0356 chromosome, complete genome	6586916	3700574	3707669	6586916		uncultured_Caudovirales_phage(66.67%)	7	NA	NA
AVK07992.1|3700574_3701900_+	group II intron, maturase-specific domain protein	NA	H7BVN7	unidentified_phage	28.6	3.9e-18
AVK08221.1|3702011_3702539_-	NUDIX domain protein	NA	A0A2H4J8B3	uncultured_Caudovirales_phage	84.7	2.3e-62
AVK04319.1|3702610_3702961_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
AVK04109.1|3702973_3703822_-	universal stress family protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	57.4	2.4e-85
AVK07592.1|3703946_3705041_-	methyltransferase domain protein	NA	A0A2K9L4K8	Tupanvirus	44.3	1.4e-82
AVK04823.1|3705242_3706091_-	universal stress family protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	55.0	1.9e-79
AVK04928.1|3706181_3707669_-	sulfate transporter family protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	85.9	1.4e-234
>prophage 7
CP027169	Pseudomonas aeruginosa strain AR_0356 chromosome, complete genome	6586916	3870996	3877888	6586916	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
AVK08228.1|3870996_3872277_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.9	4.1e-97
AVK07791.1|3872278_3873676_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
AVK08348.1|3873680_3874655_-	glutathione S-transferase, C-terminal domain protein	NA	NA	NA	NA	NA
AVK04198.1|3874740_3875724_-	glycosyl transferase family, a/b domain protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.3	3.2e-142
AVK06969.1|3875720_3876056_-	sulfur relay, TusE/DsrC/DsvC family protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	68.5	1.9e-38
AVK05273.1|3876052_3876358_-	sulfur relay protein TusB/DsrH	NA	NA	NA	NA	NA
AVK08555.1|3876357_3876717_-	sulfur relay protein TusC/DsrF	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	3.1e-34
AVK08720.1|3876713_3877109_-	dsrE/DsrF-like family protein	NA	A0A2H4JA39	uncultured_Caudovirales_phage	71.3	4.5e-47
AVK04122.1|3877219_3877888_-	inhibitor of apoptosis-promoting Bax1 family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	81.6	3.3e-90
>prophage 8
CP027169	Pseudomonas aeruginosa strain AR_0356 chromosome, complete genome	6586916	3922824	3935755	6586916	integrase	Pseudomonas_phage(42.86%)	21	3927439:3927455	3938667:3938683
AVK06158.1|3922824_3924432_+	methyl-accepting chemotaxis (MCP) signaling domain protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	1.9e-14
AVK06798.1|3924438_3925782_-	response regulator	NA	NA	NA	NA	NA
AVK06643.1|3925896_3927234_+	his Kinase A domain protein	NA	NA	NA	NA	NA
AVK08080.1|3927327_3928032_-|integrase	phage integrase family protein	integrase	C8CLF4	Xylella_phage	57.4	3.2e-27
3927439:3927455	attL	TTTCCTGGCGTTCCGCC	NA	NA	NA	NA
AVK08691.1|3928058_3928364_-|integrase	putative integrase	integrase	A0A0M3LQJ3	Mannheimia_phage	49.4	6.4e-17
AVK04994.1|3928542_3928755_-	hypothetical protein	NA	NA	NA	NA	NA
AVK03971.1|3928828_3929020_-	hypothetical protein	NA	A0A2K8HZQ6	Pseudomonas_phage	77.8	7.3e-19
AVK07441.1|3929028_3929160_-	hypothetical protein	NA	NA	NA	NA	NA
AVK08665.1|3929210_3929333_-	putative membrane protein	NA	A0A2K8HK84	Pseudomonas_phage	90.0	2.1e-11
AVK03593.1|3929325_3929454_-	hypothetical protein	NA	NA	NA	NA	NA
AVK07589.1|3929740_3929872_-	hypothetical protein	NA	L7TKP8	Pseudomonas_virus	90.7	1.7e-14
AVK05933.1|3930588_3930774_+	hypothetical protein	NA	NA	NA	NA	NA
AVK05012.1|3930798_3931803_+	hypothetical protein	NA	NA	NA	NA	NA
AVK03898.1|3932520_3932871_-	hypothetical protein	NA	A0A2K8HR09	Pseudomonas_phage	89.1	2.9e-53
AVK06186.1|3933020_3933464_-	hypothetical protein	NA	J7I440	Pseudomonas_phage	95.9	2.3e-76
AVK06737.1|3933487_3933727_-	hypothetical protein	NA	Q6JIG5	Burkholderia_virus	72.0	7.0e-27
AVK04366.1|3933747_3933906_-	hypothetical protein	NA	Q6JIG5	Burkholderia_virus	70.8	3.5e-11
AVK06723.1|3933902_3934343_-	hypothetical protein	NA	A0A0U1T6D1	Pseudomonas_phage	96.7	1.3e-23
AVK04277.1|3934325_3934766_+	chitinase class I family protein	NA	A0A125RNP1	Pseudomonas_phage	85.6	3.3e-54
AVK08979.1|3934762_3935287_+	phage lysozyme family protein	NA	L7TJR2	Pseudomonas_virus	87.8	8.6e-86
AVK03482.1|3935290_3935755_+	hypothetical protein	NA	L7THB0	Pseudomonas_virus	79.9	1.2e-51
3938667:3938683	attR	TTTCCTGGCGTTCCGCC	NA	NA	NA	NA
>prophage 9
CP027169	Pseudomonas aeruginosa strain AR_0356 chromosome, complete genome	6586916	4797121	4892028	6586916	terminase,protease,integrase,transposase,coat,tRNA,tail	Pseudomonas_phage(69.51%)	114	4821181:4821240	4884756:4884841
AVK07096.1|4797121_4798669_+|coat	spore coat assembly SafA domain protein	coat	M1HNA7	Bacillus_virus	30.7	1.6e-07
AVK04776.1|4798862_4800692_+	bacterial extracellular solute-binding, 5 Middle family protein	NA	NA	NA	NA	NA
AVK05604.1|4800688_4802536_+	bacterial extracellular solute-binding, 5 Middle family protein	NA	NA	NA	NA	NA
AVK06173.1|4802542_4803625_+	binding-protein-dependent transport system inner membrane component family protein	NA	NA	NA	NA	NA
AVK06069.1|4803629_4804649_+	N-terminal TM domain of oligopeptide transport permease C family protein	NA	NA	NA	NA	NA
AVK07942.1|4804650_4806264_+	nickel import ATP-binding protein NikE	NA	G9BWD6	Planktothrix_phage	36.1	2.7e-21
AVK06353.1|4806281_4807079_+	enoyl-(Acyl carrier) reductase family protein	NA	NA	NA	NA	NA
AVK05072.1|4807178_4809044_-	PPIC-type PPIASE domain protein	NA	NA	NA	NA	NA
AVK04684.1|4809275_4809548_-	DNA-binding protein HU-beta	NA	A4JWM7	Burkholderia_virus	60.7	2.5e-20
AVK08905.1|4809683_4812080_-|protease	ATP-dependent protease La	protease	A0A0R6PGP8	Moraxella_phage	52.4	6.5e-221
AVK08952.1|4812211_4813492_-|protease	ATP-dependent Clp protease, ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.2	1.1e-137
AVK06275.1|4813596_4814238_-	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.5	2.3e-56
AVK07208.1|4814330_4815641_-	trigger factor	NA	NA	NA	NA	NA
AVK07012.1|4815868_4816576_+	response regulator	NA	W8CYM9	Bacillus_phage	33.2	9.3e-35
AVK04882.1|4816576_4817863_+	HAMP domain protein	NA	W8CYF6	Bacillus_phage	26.9	2.1e-16
AVK06669.1|4817960_4819763_+	beta-lactamase family protein	NA	NA	NA	NA	NA
AVK06771.1|4819784_4820564_+	mltA-interacting MipA family protein	NA	NA	NA	NA	NA
AVK03012.1|4820741_4820972_-	hypothetical protein	NA	NA	NA	NA	NA
4821181:4821240	attL	AATATGGGGTGGACGATGGGAATCGAACCCACGACACCAGGAGCCACAATCCTGTGCTCT	NA	NA	NA	NA
AVK06860.1|4821512_4821776_-	hypothetical protein	NA	A0A0S2SYE1	Pseudomonas_phage	100.0	1.6e-45
AVK02961.1|4821811_4822087_-	hypothetical protein	NA	A0A0S2SYC6	Pseudomonas_phage	100.0	2.1e-43
AVK05480.1|4822225_4822543_+	hypothetical protein	NA	A0A0S2SY86	Pseudomonas_phage	100.0	1.6e-55
AVK08673.1|4822806_4823175_-	hypothetical protein	NA	A0A0S2SY58	Pseudomonas_phage	96.7	5.5e-55
AVK07387.1|4823171_4823606_-	phage lysozyme family protein	NA	A0A0S2SYD0	Pseudomonas_phage	100.0	5.1e-76
AVK05039.1|4823675_4823903_-	hypothetical protein	NA	A0A0S2SY98	Pseudomonas_phage	96.0	6.2e-33
AVK03291.1|4823899_4824202_-	hypothetical protein	NA	A0A0S2SY61	Pseudomonas_phage	100.0	1.5e-50
AVK04436.1|4824201_4824993_-|tail	putative prophage PSPPH04, tail fiber domain protein	tail	A0A0S2SY45	Pseudomonas_phage	95.8	6.8e-135
AVK03025.1|4825673_4825958_-	hypothetical protein	NA	NA	NA	NA	NA
AVK08137.1|4825954_4829521_-	hypothetical protein	NA	A0A0S2SYC5	Pseudomonas_phage	87.9	0.0e+00
AVK08429.1|4829716_4829974_+	hypothetical protein	NA	NA	NA	NA	NA
AVK05419.1|4830084_4830663_-|tail	bacteriophage lambda tail assembly I family protein	tail	A0A0S2SYS2	Pseudomonas_phage	89.2	8.3e-90
AVK06552.1|4831271_4831403_-	hypothetical protein	NA	NA	NA	NA	NA
AVK03180.1|4831587_4832046_-	hypothetical protein	NA	NA	NA	NA	NA
AVK08044.1|4832038_4832566_-	hypothetical protein	NA	G1D3R9	Mycobacterium_virus	37.0	1.1e-29
AVK09008.1|4832610_4833558_-	antirepressor domain protein	NA	G9L6D8	Escherichia_phage	42.4	3.0e-36
AVK07046.1|4833550_4833697_-	arc-like DNA binding domain protein	NA	NA	NA	NA	NA
AVK03037.1|4833778_4833892_-	hypothetical protein	NA	NA	NA	NA	NA
AVK07060.1|4833940_4834108_+	hypothetical protein	NA	NA	NA	NA	NA
AVK06254.1|4834165_4834327_-	putative identified by MetaGeneAnnotator	NA	NA	NA	NA	NA
AVK04610.1|4834418_4834658_-	HIRAN domain protein	NA	A0A127KNU7	Pseudomonas_phage	98.7	3.2e-40
AVK07833.1|4835447_4836308_+	BRO family, N-terminal domain protein	NA	A0A0S2SY56	Pseudomonas_phage	96.5	2.5e-159
AVK03412.1|4836393_4836705_+	putative helix-turn-helix domain protein	NA	NA	NA	NA	NA
AVK05837.1|4837156_4839169_-	pectate lyase superfamily protein	NA	H2BD96	Pseudomonas_phage	78.1	3.9e-70
AVK08656.1|4839229_4841959_-|tail	phage tail family protein	tail	H2BD95	Pseudomonas_phage	97.5	0.0e+00
AVK08273.1|4841930_4842338_-	hypothetical protein	NA	J7HX80	Pseudomonas_phage	98.5	1.7e-73
AVK04884.1|4842342_4842834_-	hypothetical protein	NA	J7I404	Pseudomonas_phage	90.8	1.9e-82
AVK05711.1|4842817_4843285_-	hypothetical protein	NA	H2BD92	Pseudomonas_phage	99.4	1.4e-92
AVK04664.1|4843281_4845771_-	tape measure domain protein	NA	A0A127KNB7	Pseudomonas_phage	90.5	0.0e+00
AVK06065.1|4845770_4846388_-	hypothetical protein	NA	H2BD90	Pseudomonas_phage	98.5	7.4e-113
AVK03111.1|4846384_4847380_-|tail	phage major tail 2 family protein	tail	H2BD89	Pseudomonas_phage	93.4	1.1e-161
AVK03944.1|4847394_4847769_-	hypothetical protein	NA	J7I407	Pseudomonas_phage	98.4	2.4e-66
AVK04657.1|4848171_4848492_-	hypothetical protein	NA	J7I4I8	Pseudomonas_phage	95.3	1.6e-55
AVK03299.1|4848488_4848890_-	hypothetical protein	NA	J7HX89	Pseudomonas_phage	99.2	6.0e-71
AVK08199.1|4848974_4849433_-	hypothetical protein	NA	A0A125RNM4	Pseudomonas_phage	77.0	2.7e-51
AVK05474.1|4849443_4850535_-|coat	putative coat protein	coat	H2BD82	Pseudomonas_phage	90.7	5.6e-188
AVK03802.1|4850550_4851000_-	putative glycoprotein	NA	A0A125RNM2	Pseudomonas_phage	98.7	8.1e-77
AVK06534.1|4851003_4852275_-|coat	putative phage coat protein	coat	J7I4J0	Pseudomonas_phage	98.6	3.5e-210
AVK03794.1|4852284_4853136_-	phage Mu F like family protein	NA	A0A125RNM0	Pseudomonas_phage	98.9	1.7e-155
AVK07769.1|4853170_4854541_-	hypothetical protein	NA	A0A125RNL9	Pseudomonas_phage	98.7	7.1e-265
AVK08143.1|4854543_4854741_-	putative aldehyde dehydrogenase	NA	H2BD77	Pseudomonas_phage	100.0	2.3e-28
AVK07572.1|4854740_4855844_-|terminase	terminase-like family protein	terminase	G0ZND4	Cronobacter_phage	84.0	5.1e-181
AVK02744.1|4856193_4856778_-|terminase	terminase small subunit	terminase	A0A2P9HY59	Yersinia_phage	67.0	1.8e-60
AVK08637.1|4856768_4857041_-	putative membrane protein	NA	A0A125RNL4	Pseudomonas_phage	97.8	3.1e-39
AVK05565.1|4858034_4858175_-	hypothetical protein	NA	Q9XJ92	Pseudomonas_phage	96.9	3.0e-06
AVK05803.1|4858257_4858944_-	hypothetical protein	NA	A0A0S2SYA9	Pseudomonas_phage	93.4	2.3e-123
AVK04632.1|4859014_4859332_-	putative membrane protein	NA	Q9MC45	Pseudomonas_phage	92.4	2.0e-45
AVK02800.1|4859331_4859976_-	bacteriophage Lambda NinG family protein	NA	A0A0S2SY91	Pseudomonas_phage	93.9	2.8e-110
AVK04976.1|4859972_4860443_-	hypothetical protein	NA	A0A2H4J106	uncultured_Caudovirales_phage	71.8	2.3e-61
AVK04067.1|4860643_4861126_-	hypothetical protein	NA	H2BDI1	Pseudomonas_virus	99.4	1.2e-81
AVK06962.1|4861315_4863145_-	AAA domain protein	NA	A0A0U4B0G9	Pseudomonas_phage	95.2	0.0e+00
AVK03716.1|4863141_4864041_-	putative primosomal protein I	NA	A0A2H4JDG9	uncultured_Caudovirales_phage	84.8	3.1e-43
AVK03148.1|4864030_4864237_-	hypothetical protein	NA	A0A0U4IIX2	Pseudomonas_phage	95.6	5.3e-31
AVK06817.1|4864430_4864742_-	bacteriophage CII family protein	NA	Q37905	Pseudomonas_phage	44.7	2.0e-13
AVK08660.1|4864743_4864917_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	41.1	7.1e-05
AVK03016.1|4865487_4865754_+	peptidase S24-like family protein	NA	A0A059VA53	Pseudomonas_phage	69.7	5.8e-30
AVK06063.1|4865796_4865976_+	hypothetical protein	NA	NA	NA	NA	NA
AVK05523.1|4866316_4866496_+	hypothetical protein	NA	NA	NA	NA	NA
AVK03076.1|4866492_4866666_+	hypothetical protein	NA	NA	NA	NA	NA
AVK05605.1|4866640_4866919_+	hypothetical protein	NA	NA	NA	NA	NA
AVK08634.1|4867069_4868221_+	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	67.4	7.7e-63
AVK05755.1|4868656_4868923_+	hypothetical protein	NA	NA	NA	NA	NA
AVK03562.1|4868954_4869149_+	hypothetical protein	NA	NA	NA	NA	NA
AVK04465.1|4869694_4869832_+	hypothetical protein	NA	W6MVG2	Pseudomonas_phage	97.8	2.6e-18
AVK06927.1|4869840_4870206_+	hypothetical protein	NA	A0A125RNR9	Pseudomonas_phage	97.5	6.9e-66
AVK04321.1|4870202_4870316_+	putative membrane protein	NA	A0A125RNR6	Pseudomonas_phage	100.0	7.3e-11
AVK06355.1|4871558_4872011_+	hypothetical protein	NA	A0A2I6PHZ0	Pseudomonas_phage	31.9	2.4e-07
AVK06499.1|4872053_4873118_+	hypothetical protein	NA	A0A0S2SYC7	Pseudomonas_phage	97.5	4.6e-70
AVK04460.1|4873111_4873309_-	hypothetical protein	NA	NA	NA	NA	NA
AVK03836.1|4873426_4873651_+	AP2 domain protein	NA	C4NTD4	Sulfitobacter_phage	58.9	5.2e-08
AVK04052.1|4873712_4875224_-|transposase	putative transposase	transposase	A0A218MNE7	uncultured_virus	53.5	5.7e-122
AVK07529.1|4875287_4875623_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AVK04430.1|4875619_4875955_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AVK06174.1|4876037_4876754_+	ERF superfamily protein	NA	K4NWX3	Pseudomonas_phage	57.1	7.9e-50
AVK03304.1|4876822_4877395_+	yqaJ-like viral recombinase domain protein	NA	F8TUK8	EBPR_podovirus	35.4	1.8e-20
AVK06195.1|4877391_4877754_+	hypothetical protein	NA	A0A125RNR1	Pseudomonas_phage	98.2	7.8e-54
AVK05295.1|4877965_4878136_+	hypothetical protein	NA	A0A125RNQ9	Pseudomonas_phage	98.2	4.1e-21
AVK07370.1|4878249_4879764_+	hypothetical protein	NA	A0A1B0YZX1	Pseudomonas_phage	98.0	2.0e-50
AVK07329.1|4879879_4880023_+	hypothetical protein	NA	NA	NA	NA	NA
AVK06404.1|4880373_4880568_+	hypothetical protein	NA	NA	NA	NA	NA
AVK04543.1|4880638_4880770_+	hypothetical protein	NA	NA	NA	NA	NA
AVK07727.1|4880796_4881093_+	hypothetical protein	NA	H2BDE9	Pseudomonas_virus	87.5	1.9e-26
AVK06302.1|4881255_4881402_+	hypothetical protein	NA	Q9MC62	Pseudomonas_phage	97.9	2.8e-18
AVK08019.1|4881386_4881740_+	hypothetical protein	NA	Q9MC81	Pseudomonas_phage	66.7	2.8e-32
AVK06237.1|4881732_4882167_+	hypothetical protein	NA	J7I0U3	Pseudomonas_phage	64.5	1.0e-28
AVK05245.1|4882163_4882493_+	hypothetical protein	NA	A0A125RNP8	Pseudomonas_phage	76.9	4.2e-22
AVK04830.1|4882489_4882687_+	hypothetical protein	NA	B5WZV0	Pseudomonas_phage	92.2	4.7e-29
AVK04500.1|4882790_4883123_+	hypothetical protein	NA	A0A0U4IIZ7	Pseudomonas_phage	99.1	5.3e-57
AVK08694.1|4883274_4883616_+	DNA binding, excisionase family domain protein	NA	Q9MC86	Pseudomonas_phage	100.0	5.4e-49
AVK06734.1|4883654_4884611_+|integrase	phage integrase family protein	integrase	Q9T1P3	Pseudomonas_phage	98.4	1.1e-182
AVK02905.1|4885241_4886096_+	bifunctional protein FolD	NA	A0A249XZQ2	Enterococcus_phage	34.7	3.0e-27
4884756:4884841	attR	AATATGGGGTGGACGATGGGAATCGAACCCACGACACCAGGAGCCACAATCCTGTGCTCTACCAACTGAGCTACGCCCACCATATT	NA	NA	NA	NA
AVK05947.1|4886154_4887537_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	31.6	6.9e-42
AVK07379.1|4887546_4889217_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	60.1	1.4e-198
AVK04243.1|4889339_4889837_+	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	32.9	1.9e-13
AVK08142.1|4889841_4890564_+	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
AVK02850.1|4890696_4892028_+	SPFH domain / Band 7 family protein	NA	A0A0F6WCV7	Sinorhizobium_phage	28.1	6.9e-39
>prophage 10
CP027169	Pseudomonas aeruginosa strain AR_0356 chromosome, complete genome	6586916	5841427	5860584	6586916	plate,tRNA	Haemophilus_phage(50.0%)	22	NA	NA
AVK08428.1|5841427_5842378_-	methyltransferase, FkbM family domain protein	NA	A0A0A0V284	uncultured_virus	34.9	1.9e-14
AVK08891.1|5842531_5843512_-	phage Tail Collar domain protein	NA	Q7Y5S2	Haemophilus_phage	47.0	1.1e-28
AVK03888.1|5843508_5844162_-	hypothetical protein	NA	D0UIH4	Aggregatibacter_phage	51.6	5.2e-48
AVK03326.1|5844158_5845304_-|plate	baseplate J-like family protein	plate	Q7Y5S4	Haemophilus_phage	50.3	9.9e-95
AVK06070.1|5845400_5845754_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	53.6	1.6e-27
AVK02747.1|5845750_5846392_-	putative translation initiation factor IF-2	NA	D0UIH7	Aggregatibacter_phage	38.8	1.4e-34
AVK04158.1|5846384_5847227_-	hypothetical protein	NA	Q7Y5S8	Haemophilus_phage	44.3	7.6e-68
AVK07767.1|5847223_5847541_-	hypothetical protein	NA	Q7Y5S9	Haemophilus_phage	56.4	3.2e-27
AVK07670.1|5847537_5848287_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	35.9	3.9e-31
AVK05213.1|5848296_5850207_-	hypothetical protein	NA	D0UII2	Aggregatibacter_phage	35.5	3.5e-20
AVK07212.1|5850157_5850295_-	hypothetical protein	NA	NA	NA	NA	NA
AVK03974.1|5850321_5850720_-	hypothetical protein	NA	Q776V6	Haemophilus_phage	48.4	2.7e-23
AVK08189.1|5850722_5851154_-	hypothetical protein	NA	Q7Y5T4	Haemophilus_phage	60.6	1.0e-44
AVK02996.1|5851223_5852723_-	hypothetical protein	NA	Q7Y5T5	Haemophilus_phage	52.5	1.6e-137
AVK03184.1|5852724_5853258_-	hypothetical protein	NA	NA	NA	NA	NA
AVK06799.1|5853349_5853625_-	hypothetical protein	NA	A0A0U4J8T9	Pseudomonas_phage	52.1	2.2e-16
AVK05033.1|5853617_5853992_-	putative membrane protein	NA	H2BD73	Pseudomonas_phage	52.0	2.1e-25
AVK05369.1|5854156_5854687_-	hypothetical protein	NA	NA	NA	NA	NA
AVK05727.1|5854858_5855575_+	helix-turn-helix domain protein	NA	A0A1B0VRI7	Pseudomonas_phage	48.6	6.1e-58
AVK05470.1|5856203_5856389_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	68.6	9.9e-13
AVK08294.1|5856573_5857812_-	aspartate kinase, monofunctional class	NA	NA	NA	NA	NA
AVK04060.1|5857959_5860584_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.8	1.8e-75
>prophage 11
CP027169	Pseudomonas aeruginosa strain AR_0356 chromosome, complete genome	6586916	5950386	5998300	6586916	integrase,transposase	uncultured_virus(22.22%)	35	5963894:5963910	5993499:5993515
AVK03361.1|5950386_5952840_+|integrase	phage integrase family protein	integrase	A0A059XK29	uncultured_phage	22.5	7.8e-12
AVK03804.1|5953008_5954277_+|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
AVK07827.1|5955870_5956035_+	hypothetical protein	NA	NA	NA	NA	NA
AVK04393.1|5956551_5959593_-	SNF2 family N-terminal domain protein	NA	Q2NP48	Hyphantria_cunea_nuclear_polyhedrosis_virus	26.4	3.3e-28
AVK02865.1|5959592_5961692_-	hypothetical protein	NA	NA	NA	NA	NA
AVK06335.1|5961754_5962519_-	ompA family protein	NA	NA	NA	NA	NA
AVK04137.1|5962518_5964645_-	putative methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
5963894:5963910	attL	CGCTCGTGCAGCTCCTG	NA	NA	NA	NA
AVK02886.1|5964697_5965774_-	hypothetical protein	NA	NA	NA	NA	NA
AVK03856.1|5965791_5967486_-	type I restriction modification DNA specificity domain protein	NA	NA	NA	NA	NA
AVK07659.1|5967482_5968952_-	eco57I restriction-modification methylase family protein	NA	J7I0U9	Acinetobacter_phage	33.9	7.9e-28
AVK04796.1|5968954_5969896_-	HNH endonuclease family protein	NA	NA	NA	NA	NA
AVK06402.1|5970312_5972679_-	type I restriction enzyme R protein	NA	A0A2I5ARD8	Synechococcus_phage	27.2	1.8e-05
AVK08517.1|5972742_5972874_+	hypothetical protein	NA	NA	NA	NA	NA
AVK06362.1|5973071_5973719_-	hypothetical protein	NA	NA	NA	NA	NA
AVK04184.1|5973793_5973949_+	hypothetical protein	NA	NA	NA	NA	NA
AVK09094.1|5974202_5975078_+	WYL domain protein	NA	NA	NA	NA	NA
AVK08682.1|5975514_5975847_+	peptidase S24-like family protein	NA	NA	NA	NA	NA
AVK03645.1|5975839_5975974_+	impB/mucB/samB family protein	NA	A0A218MNF2	uncultured_virus	79.4	4.3e-10
AVK08042.1|5976072_5977230_+|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
AVK04568.1|5977270_5978848_+	hypothetical protein	NA	NA	NA	NA	NA
AVK07539.1|5978946_5980686_+|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
AVK07085.1|5980924_5981101_+	tetR family transcriptional regulator-like protein	NA	NA	NA	NA	NA
AVK02717.1|5981183_5982146_-	sdiA-regulated family protein	NA	NA	NA	NA	NA
AVK06156.1|5982191_5982545_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
AVK07221.1|5982550_5983402_-	universal stress family protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	63.3	6.7e-96
AVK03942.1|5983416_5984904_-	sulfate transporter family protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	87.9	1.1e-239
AVK08887.1|5985364_5986519_+	hypothetical protein	NA	I6RSM4	Salmonella_phage	46.8	1.3e-89
AVK06850.1|5986980_5987406_-	hypothetical protein	NA	NA	NA	NA	NA
AVK08382.1|5988034_5989072_+	WYL domain protein	NA	NA	NA	NA	NA
AVK07099.1|5989084_5990842_+	dynamin family protein	NA	NA	NA	NA	NA
AVK07653.1|5990838_5993076_+	interferon-inducible GTPase family protein	NA	NA	NA	NA	NA
AVK05994.1|5993072_5994956_+	dynamin family protein	NA	NA	NA	NA	NA
5993499:5993515	attR	CAGGAGCTGCACGAGCG	NA	NA	NA	NA
AVK04821.1|5994985_5995633_-	hypothetical protein	NA	NA	NA	NA	NA
AVK06161.1|5996389_5997901_-|transposase	putative transposase	transposase	A0A218MNE7	uncultured_virus	53.5	5.7e-122
AVK04665.1|5997964_5998300_-|transposase	putative transposase	transposase	NA	NA	NA	NA
>prophage 1
CP027168	Pseudomonas aeruginosa strain AR_0356 plasmid unnamed1, complete sequence	57053	36990	47094	57053	integrase	Escherichia_phage(33.33%)	9	38098:38112	48727:48741
AVK02627.1|36990_39987_-	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	48.3	9.1e-265
38098:38112	attL	GCCGGTGTTGCAGGC	NA	NA	NA	NA
AVK02683.1|39990_40401_-	toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
AVK02646.1|40400_40640_-	hypothetical protein	NA	NA	NA	NA	NA
AVK02637.1|40841_41768_+	resolvase, N terminal domain protein	NA	E5FFF9	Burkholderia_phage	46.4	1.8e-41
AVK02638.1|41895_42111_+	hypothetical protein	NA	NA	NA	NA	NA
AVK02655.1|42455_43775_+	hypothetical protein	NA	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AVK02679.1|44024_44906_-	carbapenem-hydrolyzing beta-lactamase Sme-1	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AVK02664.1|45292_46072_-	phoH-like family protein	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AVK02677.1|46068_47094_-|integrase	integrase core domain protein	integrase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
48727:48741	attR	GCCGGTGTTGCAGGC	NA	NA	NA	NA
>prophage 1
CP027170	Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence	438531	853	59857	438531	transposase,integrase	Salmonella_phage(23.08%)	51	24342:24357	61315:61330
AVK09157.1|853_2209_+|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
AVK09155.1|4328_5420_+	trfA family protein	NA	NA	NA	NA	NA
AVK09475.1|5451_6657_-	hypothetical protein	NA	J9Q6K3	Salmonella_phage	38.7	2.6e-08
AVK09284.1|6790_7825_-	plasmid replication region DNA-binding N-term family protein	NA	NA	NA	NA	NA
AVK09223.1|8602_8746_+	hypothetical protein	NA	NA	NA	NA	NA
AVK09215.1|9397_10705_+	hypothetical protein	NA	NA	NA	NA	NA
AVK09362.1|10735_10909_-	hypothetical protein	NA	NA	NA	NA	NA
AVK09305.1|11038_11677_+	hypothetical protein	NA	A0A218MNF5	uncultured_virus	39.4	6.7e-32
AVK09263.1|11972_12191_+	hypothetical protein	NA	NA	NA	NA	NA
AVK09296.1|12749_12866_-	hypothetical protein	NA	NA	NA	NA	NA
AVK09502.1|13343_13616_+	hypothetical protein	NA	NA	NA	NA	NA
AVK09412.1|13741_15022_+	DNA methylase family protein	NA	NA	NA	NA	NA
AVK09298.1|15176_16124_+	hypothetical protein	NA	NA	NA	NA	NA
AVK09299.1|16423_17026_+	hypothetical protein	NA	NA	NA	NA	NA
AVK09411.1|17108_17864_+	N-6 DNA Methylase family protein	NA	A0A2K9V411	Faecalibacterium_phage	32.3	4.3e-22
AVK09372.1|18011_18743_+	tonB family C-terminal domain protein	NA	NA	NA	NA	NA
AVK09126.1|18800_19595_+	hypothetical protein	NA	NA	NA	NA	NA
AVK09268.1|20159_21428_+	PLD-like domain protein	NA	NA	NA	NA	NA
AVK09418.1|21568_23149_+	phoD-like phosphatase family protein	NA	NA	NA	NA	NA
AVK09260.1|23228_23405_-	hypothetical protein	NA	NA	NA	NA	NA
AVK09121.1|23406_23766_-	hypothetical protein	NA	NA	NA	NA	NA
AVK09513.1|24028_24412_+	hypothetical protein	NA	NA	NA	NA	NA
24342:24357	attL	AATGTCCGAAGGGGCG	NA	NA	NA	NA
AVK09393.1|24558_25566_+|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
AVK09253.1|26597_27536_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
AVK09139.1|27614_30203_-	outer membrane autotransporter barrel domain protein	NA	NA	NA	NA	NA
AVK09254.1|30224_30485_+	hypothetical protein	NA	NA	NA	NA	NA
AVK09288.1|30741_33678_+	hypothetical protein	NA	NA	NA	NA	NA
AVK09137.1|33694_34075_-	hypothetical protein	NA	NA	NA	NA	NA
AVK09118.1|34394_35513_-	IMS HHH motif family protein	NA	A0A1W6JNT0	Morganella_phage	45.7	1.1e-82
AVK09395.1|36003_37491_+	sulfate transporter family protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	87.9	1.1e-239
AVK09391.1|37505_38357_+	universal stress family protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	63.3	6.7e-96
AVK09532.1|38362_38716_+	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
AVK09238.1|38761_39724_+	sdiA-regulated family protein	NA	NA	NA	NA	NA
AVK09301.1|40221_42063_-|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
AVK09209.1|42059_43637_-	hypothetical protein	NA	NA	NA	NA	NA
AVK09555.1|43677_44835_-|integrase	phage integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	24.4	1.1e-05
AVK09218.1|45058_45193_-	hypothetical protein	NA	NA	NA	NA	NA
AVK09557.1|45211_45325_+	hypothetical protein	NA	NA	NA	NA	NA
AVK09548.1|46025_46295_+	hypothetical protein	NA	NA	NA	NA	NA
AVK09217.1|46323_47316_-	hypothetical protein	NA	NA	NA	NA	NA
AVK09300.1|47299_48160_-	prepilin-type N-terminal cleavage/methylation domain protein	NA	NA	NA	NA	NA
AVK09553.1|48330_49038_+	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	45.3	9.1e-14
AVK09431.1|49065_49926_-	putative transmembrane protein	NA	NA	NA	NA	NA
AVK09201.1|50112_53079_-	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	96.7	0.0e+00
AVK09537.1|53082_53643_-	resolvase, N terminal domain protein	NA	A0A1B0V7I5	Salmonella_phage	96.8	1.8e-57
AVK09173.1|53652_53766_+	hypothetical protein	NA	NA	NA	NA	NA
AVK09550.1|54017_55031_-|integrase	integron integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
AVK09399.1|56088_56661_+	hypothetical protein	NA	NA	NA	NA	NA
AVK09303.1|57118_57958_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AVK09531.1|58085_58586_+	acetyltransferase domain protein	NA	NA	NA	NA	NA
AVK09258.1|59092_59857_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
61315:61330	attR	AATGTCCGAAGGGGCG	NA	NA	NA	NA
>prophage 2
CP027170	Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence	438531	406895	414349	438531		Acinetobacter_phage(33.33%)	8	NA	NA
AVK09521.1|406895_407654_+	putative trehalose 6-phosphatase	NA	A0A172Q0Q4	Acinetobacter_phage	26.8	2.5e-09
AVK09324.1|407646_408741_+	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	33.4	2.8e-38
AVK09242.1|408740_409688_+	putative aTP/GTP-binding protein	NA	NA	NA	NA	NA
AVK09438.1|410418_411012_+	bacterial stress family protein	NA	A0A2I7QY07	Vibrio_phage	36.8	1.8e-23
AVK09441.1|411008_412199_+	bacterial stress family protein	NA	NA	NA	NA	NA
AVK09450.1|412246_412696_+	terB	NA	Q1MVI3	Enterobacteria_phage	30.2	1.3e-10
AVK09202.1|412707_413742_+	integral membrane, TerC family protein	NA	K7QKE8	Escherichia_phage	47.2	3.1e-71
AVK09317.1|413770_414349_+	bacterial stress family protein	NA	A0A2L1IWC0	Streptomyces_phage	31.0	5.7e-06
