The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019681	Salmonella enterica subsp. enterica serovar Enteritidis strain SE86 chromosome, complete genome	4685718	934408	941721	4685718	protease,integrase	Dickeya_phage(16.67%)	8	923146:923160	941939:941953
923146:923160	attL	AGCCTGCGAGGAGAC	NA	NA	NA	NA
AVL12900.1|934408_935527_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
AVL12901.1|935523_937470_+	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
AVL12902.1|937450_937645_+	hypothetical protein	NA	NA	NA	NA	NA
AVL12903.1|937599_937821_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AVL12904.1|938144_938465_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AVL12905.1|938495_940772_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AVL12906.1|940984_941182_-	hypothetical protein	NA	NA	NA	NA	NA
AVL12907.1|941343_941721_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
941939:941953	attR	GTCTCCTCGCAGGCT	NA	NA	NA	NA
>prophage 2
CP019681	Salmonella enterica subsp. enterica serovar Enteritidis strain SE86 chromosome, complete genome	4685718	1013000	1024225	4685718	tail	Salmonella_phage(36.36%)	12	NA	NA
AVL12959.1|1013000_1013411_-	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
AVL12960.1|1013431_1014061_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
AVL12961.1|1014044_1014671_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
AVL12962.1|1014667_1016377_+|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
AVL12963.1|1016376_1016958_+|tail	phage tail protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
AVL12964.1|1016961_1017210_-|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
AVL12965.1|1017435_1018404_+	secreted effector protein SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
AVL12966.1|1018671_1018920_+	hypothetical protein	NA	A0A0P0ZEB3	Stx2-converting_phage	68.8	1.5e-24
AVL12967.1|1019051_1019678_-	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
AVL12968.1|1020037_1020724_-	virulence protein	NA	NA	NA	NA	NA
AVL12969.1|1020994_1021186_-	DNA-damage-inducible protein I	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
AVL12970.1|1021612_1024225_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
>prophage 3
CP019681	Salmonella enterica subsp. enterica serovar Enteritidis strain SE86 chromosome, complete genome	4685718	1197800	1249900	4685718	tail,holin,integrase,terminase,lysis,tRNA	Enterobacteria_phage(22.22%)	59	1225926:1225955	1245547:1245576
AVL13154.1|1197800_1199573_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AVL13155.1|1199675_1200128_+	NUDIX pyrophosphatase	NA	NA	NA	NA	NA
AVL13156.1|1200157_1200898_+	transcriptional regulator	NA	NA	NA	NA	NA
AVL13157.1|1200934_1201456_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
AVL13158.1|1201457_1202057_-	hypothetical protein	NA	NA	NA	NA	NA
AVL16409.1|1202283_1202958_+	hypothetical protein	NA	NA	NA	NA	NA
AVL13159.1|1203317_1203929_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AVL13160.1|1203937_1204948_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.4	2.4e-07
AVL13161.1|1205026_1205812_-	zinc ABC transporter permease	NA	NA	NA	NA	NA
AVL13162.1|1205808_1206564_-	Mn2+/Zn2+ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	8.5e-18
AVL13163.1|1206627_1207587_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVL13164.1|1207602_1208922_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	2.6e-14
AVL13165.1|1208812_1209040_-	hypothetical protein	NA	NA	NA	NA	NA
AVL13166.1|1209038_1210010_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AVL13167.1|1210082_1211525_-	pyruvate kinase II	NA	NA	NA	NA	NA
AVL13168.1|1211648_1212518_-	transcriptional regulator HexR	NA	NA	NA	NA	NA
AVL13169.1|1212701_1212887_-	hypothetical protein	NA	NA	NA	NA	NA
AVL13170.1|1212859_1214335_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	2.6e-79
AVL13171.1|1214569_1216381_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AVL13172.1|1216418_1217060_+	keto-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
AVL13173.1|1217159_1218338_-	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
AVL13174.1|1218468_1218759_+	damage-inducible protein YebG	NA	NA	NA	NA	NA
AVL13175.1|1218826_1219180_+	hypothetical protein	NA	NA	NA	NA	NA
AVL13176.1|1219273_1219933_+	protein YebE	NA	NA	NA	NA	NA
AVL13177.1|1220145_1222197_+	oligopeptidase B	NA	NA	NA	NA	NA
AVL13178.1|1222233_1222932_-	DNA polymerase III subunit epsilon	NA	Q6UAU3	Klebsiella_phage	40.4	2.8e-07
AVL13179.1|1222955_1223612_-	carbon-nitrogen hydrolase	NA	NA	NA	NA	NA
AVL13180.1|1223719_1223950_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
AVL13181.1|1224081_1224462_+	hypothetical protein	NA	NA	NA	NA	NA
AVL13182.1|1224462_1225338_+	hypothetical protein	NA	NA	NA	NA	NA
AVL13183.1|1225354_1225708_+	hypothetical protein	NA	NA	NA	NA	NA
1225926:1225955	attL	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
AVL13184.1|1226090_1227170_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
AVL16410.1|1227144_1227417_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
AVL13185.1|1227836_1229816_+	hypothetical protein	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
AVL13186.1|1229833_1230025_-	hypothetical protein	NA	NA	NA	NA	NA
AVL13187.1|1230447_1230753_+	hypothetical protein	NA	NA	NA	NA	NA
AVL13188.1|1230816_1231416_+	hypothetical protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
AVL13189.1|1231412_1231640_+	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
AVL13190.1|1231769_1232459_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
AVL16411.1|1232555_1233080_+	hypothetical protein	NA	NA	NA	NA	NA
AVL13191.1|1233453_1233903_-	hypothetical protein	NA	NA	NA	NA	NA
AVL13192.1|1234263_1234950_-	virulence protein	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
AVL13193.1|1235219_1235555_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	4.1e-57
AVL13194.1|1235541_1235991_+	muraminidase	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
AVL16412.1|1236008_1236488_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
AVL13195.1|1236695_1237010_+	hypothetical protein	NA	Q8VNN8	Enterobacteria_phage	49.5	9.9e-21
AVL13196.1|1237382_1237916_-	Superoxide dismutase [Cu-Zn] 1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AVL13197.1|1238005_1238701_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
AVL13198.1|1238710_1238992_+	cell wall hydrolase	NA	A0A0N7KZA3	Stx2-converting_phage	66.3	1.0e-29
AVL13199.1|1242755_1243478_-	guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
AVL13200.1|1243957_1244758_-	hypothetical protein	NA	NA	NA	NA	NA
AVL13201.1|1246615_1247269_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	69.8	3.2e-29
1245547:1245576	attR	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
AVL13202.1|1247299_1247530_+	lytic enzyme	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
AVL13203.1|1247583_1248117_+	hypothetical protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
AVL13204.1|1248373_1248541_-	lytic enzyme	NA	NA	NA	NA	NA
AVL13205.1|1248605_1248794_-	hypothetical protein	NA	NA	NA	NA	NA
AVL13206.1|1248848_1249340_+	DNA breaking-rejoining protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
AVL13207.1|1249326_1249506_+|tail	phage tail protein	tail	Q9EYD1	Enterobacteria_phage	53.2	2.7e-07
AVL13208.1|1249525_1249900_+|terminase	terminase	terminase	Q8VNN7	Enterobacteria_phage	82.1	1.1e-58
>prophage 4
CP019681	Salmonella enterica subsp. enterica serovar Enteritidis strain SE86 chromosome, complete genome	4685718	1466630	1482574	4685718	integrase,tRNA	Escherichia_phage(64.71%)	24	1478271:1478284	1481724:1481737
AVL13417.1|1466630_1468004_+	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
AVL13418.1|1468047_1468983_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
AVL13419.1|1469299_1469917_-	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
AVL13420.1|1469944_1470262_-	hypothetical protein	NA	NA	NA	NA	NA
AVL13421.1|1470346_1470568_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
AVL13422.1|1470773_1470971_+	hypothetical protein	NA	NA	NA	NA	NA
AVL13423.1|1471005_1471527_+	hypothetical protein	NA	NA	NA	NA	NA
AVL13424.1|1471634_1471799_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	46.8	6.1e-06
AVL13425.1|1472174_1472642_-	transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
AVL13426.1|1472914_1473244_+	DNA-binding protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
AVL13427.1|1473405_1473960_-	hypothetical protein	NA	NA	NA	NA	NA
AVL13428.1|1473956_1474889_-	hypothetical protein	NA	NA	NA	NA	NA
AVL13429.1|1475258_1475471_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
AVL13430.1|1475994_1476594_+	hypothetical protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
AVL13431.1|1476593_1476884_+	hypothetical protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
AVL13432.1|1476880_1477417_+	antiterminator	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
1478271:1478284	attL	CAATATTTTTCGGG	NA	NA	NA	NA
AVL13433.1|1479587_1479983_+	hypothetical protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
AVL16426.1|1479904_1480093_+	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
AVL13434.1|1480082_1480364_+	hypothetical protein	NA	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
AVL13435.1|1480360_1480906_+	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
AVL13436.1|1481447_1481639_-|integrase	integrase	integrase	A0A0U2JGI6	Escherichia_phage	96.8	1.6e-29
AVL13437.1|1481606_1481759_+	multidrug transporter	NA	NA	NA	NA	NA
1481724:1481737	attR	CCCGAAAAATATTG	NA	NA	NA	NA
AVL13438.1|1481751_1482090_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AVL13439.1|1482139_1482574_-	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
>prophage 5
CP019681	Salmonella enterica subsp. enterica serovar Enteritidis strain SE86 chromosome, complete genome	4685718	2014765	2062261	4685718	portal,plate,capsid,integrase,terminase,tail,transposase	Salmonella_phage(78.18%)	65	2059654:2059668	2065980:2065994
AVL13951.1|2014765_2015788_-|transposase	IS110 family transposase ISSaen1	transposase	NA	NA	NA	NA
AVL13952.1|2016249_2017068_-	hypothetical protein	NA	NA	NA	NA	NA
AVL13953.1|2017094_2017472_-	hypothetical protein	NA	NA	NA	NA	NA
AVL13954.1|2017864_2018047_-	hypothetical protein	NA	NA	NA	NA	NA
AVL13955.1|2018410_2018632_-	DNA-binding protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
AVL13956.1|2018844_2019852_+	non-LEE encoded effector protein NleB	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
AVL13957.1|2020136_2020706_-|tail	phage tail protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
AVL13958.1|2020705_2022268_-|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	99.8	9.8e-287
AVL13959.1|2022254_2022842_-|tail	phage tail protein	tail	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
AVL13960.1|2022844_2023924_-|plate	phage baseplate protein	plate	A0A192Y6E4	Salmonella_phage	99.7	2.5e-204
AVL13961.1|2023916_2024330_-	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
AVL13962.1|2024334_2024868_-|plate	baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	99.4	2.1e-95
AVL13963.1|2024867_2025926_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
AVL13964.1|2025922_2027263_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.1	1.1e-249
AVL13965.1|2027296_2029225_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.5	0.0e+00
AVL13966.1|2029309_2029636_-|tail	phage tail protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
AVL13967.1|2029632_2029989_-|tail	phage tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
AVL13968.1|2029988_2031485_-|tail	phage tail protein	tail	Q8HAC5	Salmonella_phage	99.2	3.0e-277
AVL13969.1|2031474_2031639_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
AVL13970.1|2031642_2032203_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	99.5	3.0e-105
AVL13971.1|2032199_2032712_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	93.5	1.4e-85
AVL13972.1|2032683_2033088_-|tail	phage tail protein	tail	A0A192Y6C2	Salmonella_phage	96.3	1.5e-69
AVL13973.1|2033084_2033408_-	hypothetical protein	NA	Q8SBH7	Shigella_phage	72.0	2.6e-40
AVL13974.1|2033487_2034717_-|capsid	phage capsid protein	capsid	Q8SBH8	Shigella_phage	90.9	1.8e-206
AVL13975.1|2034726_2035329_-	peptidase	NA	Q8SBH9	Shigella_phage	91.5	2.0e-99
AVL13976.1|2035321_2036539_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	79.4	7.6e-194
AVL13977.1|2036687_2038418_-|terminase	terminase	terminase	Q8W631	Enterobacteria_phage	58.9	3.2e-198
AVL13978.1|2038417_2038855_-|terminase	terminase	terminase	A0A1J0GV10	Halomonas_phage	63.7	1.6e-32
AVL13979.1|2039001_2039352_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.1e-63
AVL13980.1|2039375_2039915_-	hypothetical protein	NA	A0A0A0P0G7	Enterobacteria_phage	37.2	5.3e-06
AVL13981.1|2039911_2040529_-	endolysin	NA	Q8HA86	Salmonella_phage	78.9	3.2e-92
AVL13982.1|2040528_2040810_-	hypothetical protein	NA	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
AVL13983.1|2040796_2041186_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	71.0	1.8e-40
AVL13984.1|2041274_2041847_-	hypothetical protein	NA	NA	NA	NA	NA
AVL13985.1|2041859_2042933_-	hypothetical protein	NA	NA	NA	NA	NA
AVL13986.1|2042982_2043735_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	1.9e-134
AVL13987.1|2043748_2044702_-	hypothetical protein	NA	A0A1C9IHZ5	Salmonella_phage	97.5	7.3e-184
AVL13988.1|2044745_2045606_-	DNA-binding protein	NA	A0A192Y6F8	Salmonella_phage	98.3	1.5e-159
AVL13989.1|2045622_2046012_-	hypothetical protein	NA	A0A1C9IIA0	Salmonella_phage	99.2	1.9e-69
AVL13990.1|2046020_2046902_-	DNA methylase	NA	A0A1C9II58	Salmonella_phage	96.2	8.3e-166
AVL13991.1|2046898_2047372_-	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	94.6	3.9e-53
AVL13992.1|2047368_2048343_-	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	97.8	1.2e-165
AVL13993.1|2048339_2048564_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
AVL13994.1|2048560_2049718_-	peptidase	NA	Q8HA97	Salmonella_phage	98.4	2.8e-214
AVL13995.1|2049714_2050269_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	98.9	3.4e-101
AVL13996.1|2050297_2050522_-	transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
AVL13997.1|2050460_2050646_-	hypothetical protein	NA	NA	NA	NA	NA
AVL13998.1|2050619_2051315_+	transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	2.7e-127
AVL13999.1|2051520_2051706_+	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
AVL16451.1|2051633_2051882_+	hypothetical protein	NA	NA	NA	NA	NA
AVL14000.1|2051781_2052033_-	bssS family protein	NA	NA	NA	NA	NA
AVL16452.1|2052042_2052504_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	84.5	2.9e-21
AVL14001.1|2052602_2053520_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	59.7	1.3e-97
AVL14002.1|2053614_2054154_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
AVL14003.1|2054224_2054455_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
AVL14004.1|2054451_2054967_+	hypothetical protein	NA	A0A2H4FWH2	Salmonella_phage	96.5	1.3e-94
AVL14005.1|2054963_2055323_+	Eaf protein	NA	T1SA95	Salmonella_phage	89.9	1.0e-58
AVL14006.1|2055594_2055888_+	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	100.0	1.5e-50
AVL14007.1|2055884_2056748_+	hypothetical protein	NA	S4TSR6	Salmonella_phage	49.2	5.2e-64
AVL14008.1|2056744_2057314_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	99.5	9.3e-110
AVL16453.1|2057353_2057581_+	hypothetical protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
AVL14009.1|2057582_2058572_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
AVL14010.1|2058863_2059661_+	protein MtfA	NA	NA	NA	NA	NA
2059654:2059668	attL	AACATTAATTCCTCA	NA	NA	NA	NA
AVL14011.1|2060032_2060323_+|integrase	integrase	integrase	H2BDA3	Pseudomonas_phage	49.1	1.2e-07
AVL16454.1|2060986_2062261_+	recombinase	NA	B7SYF8	Stenotrophomonas_phage	39.9	2.4e-73
2065980:2065994	attR	AACATTAATTCCTCA	NA	NA	NA	NA
>prophage 6
CP019681	Salmonella enterica subsp. enterica serovar Enteritidis strain SE86 chromosome, complete genome	4685718	2175184	2185691	4685718		Enterobacteria_phage(37.5%)	10	NA	NA
AVL14125.1|2175184_2176498_-	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AVL14126.1|2176524_2177604_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
AVL14127.1|2177608_2178382_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AVL14128.1|2178397_2179372_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AVL14129.1|2179377_2179929_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
AVL14130.1|2179929_2180808_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
AVL14131.1|2180855_2181755_-	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
AVL14132.1|2181754_2182840_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AVL14133.1|2183216_2184110_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AVL14134.1|2184287_2185691_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
>prophage 7
CP019681	Salmonella enterica subsp. enterica serovar Enteritidis strain SE86 chromosome, complete genome	4685718	2252889	2262060	4685718	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AVL14188.1|2252889_2254923_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AVL14189.1|2255163_2255622_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
AVL14190.1|2255793_2256324_+	lipoprotein	NA	NA	NA	NA	NA
AVL14191.1|2256380_2256848_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
AVL14192.1|2256894_2257614_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVL14193.1|2257610_2259296_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
AVL14194.1|2259518_2260250_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	86.9	2.5e-99
AVL14195.1|2260309_2260417_+	hypothetical protein	NA	NA	NA	NA	NA
AVL14196.1|2260397_2261129_-	ABC transporter permease	NA	NA	NA	NA	NA
AVL14197.1|2261112_2262060_-	ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
