The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019980	Lysinibacillus sphaericus strain DSM 28 chromosome, complete genome	4681723	35386	46646	4681723	tRNA	Enterococcus_phage(33.33%)	10	NA	NA
AVK94821.1|35386_35917_-	Rossman fold protein, TIGR00730 family	NA	A0A1G5S9X4	Enterococcus_phage	38.0	5.2e-22
AVK94822.1|36117_36786_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	35.8	1.1e-24
AVK94823.1|36782_37421_-	deoxynucleoside kinase	NA	A0A1G5SAJ8	Enterococcus_phage	22.9	3.2e-10
AVK94824.1|37802_40214_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.3	2.7e-126
AVK94825.1|40295_40502_-	copper resistance protein CopZ	NA	NA	NA	NA	NA
AVK94826.1|40559_40892_-	CsoR family transcriptional regulator	NA	NA	NA	NA	NA
AVK94827.1|40968_41919_-	cation transporter	NA	NA	NA	NA	NA
AVK94828.1|41950_42286_-	transcriptional regulator	NA	A0A218MNF3	uncultured_virus	39.7	4.7e-05
AVK98955.1|42455_42941_+|tRNA	tRNA-specific adenosine deaminase	tRNA	NA	NA	NA	NA
AVK94829.1|43133_46646_+	peptidase S8	NA	A0A1B0T6A2	Bacillus_phage	36.9	1.8e-49
>prophage 2
CP019980	Lysinibacillus sphaericus strain DSM 28 chromosome, complete genome	4681723	595119	603664	4681723		Bacillus_phage(28.57%)	9	NA	NA
AVK95311.1|595119_595836_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	77.0	9.1e-46
AVK95312.1|596148_597123_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	51.5	6.9e-89
AVK95313.1|597198_597951_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AVK95314.1|597947_598679_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.7	9.7e-19
AVK95315.1|598798_599299_+	cysteine methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.7	3.2e-21
AVK95316.1|599392_600688_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	40.3	2.8e-69
AVK95317.1|600701_601043_-	transcriptional regulator	NA	NA	NA	NA	NA
AVK95318.1|601354_602824_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	46.1	7.2e-114
AVK95319.1|602839_603664_+	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.2	5.9e-73
>prophage 3
CP019980	Lysinibacillus sphaericus strain DSM 28 chromosome, complete genome	4681723	627620	636126	4681723		Synechococcus_phage(50.0%)	8	NA	NA
AVK95336.1|627620_628916_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	24.6	1.1e-17
AVK95337.1|629044_629755_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	41.5	6.9e-46
AVK95338.1|629757_630006_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AVK95339.1|630008_630692_+	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
AVK95340.1|630678_632913_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	43.1	1.6e-157
AVK95341.1|632888_634313_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	5.8e-52
AVK95342.1|634501_635557_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	43.3	2.5e-60
AVK95343.1|635556_636126_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.0	6.2e-21
>prophage 4
CP019980	Lysinibacillus sphaericus strain DSM 28 chromosome, complete genome	4681723	882023	946352	4681723	tail,portal,integrase,holin,protease,capsid,head,terminase,coat	Bacillus_phage(20.0%)	78	912968:912983	948035:948050
AVK95555.1|882023_882611_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	59.3	2.3e-55
AVK95556.1|883500_884295_+	basic amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVK95557.1|884389_885094_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVK95558.1|885090_885813_+	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	8.9e-33
AVK95559.1|885869_886484_-|coat	spore coat protein	coat	NA	NA	NA	NA
AVK95560.1|886641_887223_+	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	37.9	3.3e-22
AVK95561.1|887222_887981_+	hypothetical protein	NA	NA	NA	NA	NA
AVK95562.1|887988_888246_-	hypothetical protein	NA	NA	NA	NA	NA
AVK95563.1|888208_890485_+	S9 family peptidase	NA	NA	NA	NA	NA
AVK95564.1|890651_890879_+	thioredoxin family protein	NA	NA	NA	NA	NA
AVK95565.1|891617_892646_+	hypothetical protein	NA	NA	NA	NA	NA
AVK95566.1|892683_893700_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AVK95567.1|894121_895306_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
AVK95568.1|895361_896123_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
AVK95569.1|896115_897657_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVK95570.1|897659_898952_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	70.1	5.8e-168
AVK95571.1|899210_899438_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AVK95572.1|899642_900389_+	carboxylesterase	NA	NA	NA	NA	NA
AVK95573.1|900426_902874_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	37.9	4.9e-83
AVK95574.1|902935_903403_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	56.9	1.5e-44
AVK95575.1|903672_904212_+	hypothetical protein	NA	NA	NA	NA	NA
AVK95576.1|904192_905557_+	hypothetical protein	NA	NA	NA	NA	NA
AVK95577.1|906226_907309_-|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	53.4	5.3e-98
AVK95578.1|907390_907846_-	hypothetical protein	NA	Q0H245	Geobacillus_phage	50.7	3.9e-34
AVK95579.1|907860_908316_-	transcriptional regulator	NA	A0A0S2SXM8	Bacillus_phage	65.2	5.4e-44
AVK95580.1|908493_908739_+	transcriptional regulator	NA	A0A0S2SXX9	Bacillus_phage	83.5	2.5e-32
AVK95581.1|908791_908980_+	transcriptional regulator	NA	NA	NA	NA	NA
AVK95582.1|909338_909575_+	hypothetical protein	NA	A0A2H4J246	uncultured_Caudovirales_phage	61.5	3.1e-11
AVK95583.1|909571_909796_+	hypothetical protein	NA	NA	NA	NA	NA
AVK95584.1|909814_910075_+	hypothetical protein	NA	NA	NA	NA	NA
AVK95585.1|910086_910344_+	hypothetical protein	NA	A0A2I7SC16	Paenibacillus_phage	72.0	4.3e-14
AVK95586.1|910356_910620_+	hypothetical protein	NA	A0A0A7S062	Clostridium_phage	41.5	6.1e-08
AVK95587.1|910860_911331_+	hypothetical protein	NA	NA	NA	NA	NA
AVK95588.1|911327_912503_+	hypothetical protein	NA	H7BVP9	unidentified_phage	50.5	2.8e-100
AVK95589.1|912529_913342_+	hypothetical protein	NA	I1TLG4	Bacillus_phage	39.6	1.1e-26
912968:912983	attL	GCAGGTAAAAAGGGTG	NA	NA	NA	NA
AVK95590.1|913338_915309_+	hypothetical protein	NA	H7BVQ1	unidentified_phage	58.4	9.4e-218
AVK95591.1|915321_915747_+	hypothetical protein	NA	NA	NA	NA	NA
AVK98991.1|915765_918180_+	virulence-associated protein E	NA	A0A1S7FZ15	Listeria_phage	42.7	6.6e-189
AVK95592.1|918493_918769_+	nuclease	NA	A0A1B0RXC4	Streptococcus_phage	44.4	4.9e-16
AVK95593.1|918771_920148_+	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	54.3	3.0e-146
AVK95594.1|920161_920692_+	hypothetical protein	NA	S5MNT8	Brevibacillus_phage	32.0	3.2e-11
AVK95595.1|920913_921834_+	DUF4868 domain-containing protein	NA	Q24LC1	Clostridium_phage	47.1	2.3e-65
AVK95596.1|921852_922410_+	hypothetical protein	NA	A0A1Q1PW40	Staphylococcus_phage	26.2	1.8e-12
AVK95597.1|922492_922882_+	hypothetical protein	NA	U3PD10	Staphylococcus_phage	40.7	7.0e-08
AVK95598.1|922966_923428_+|terminase	terminase	terminase	A0A0A7RUQ4	Clostridium_phage	64.2	2.1e-48
AVK95599.1|923424_925104_+|terminase	terminase	terminase	A0A0A7RUM0	Clostridium_phage	43.3	4.3e-123
AVK98992.1|925185_926370_+|portal	phage portal protein	portal	U3PFW0	Lactobacillus_phage	48.7	4.8e-100
AVK95600.1|926359_926965_+	peptidase U35	NA	A0A2H4J861	uncultured_Caudovirales_phage	68.5	1.3e-64
AVK95601.1|926966_928136_+|capsid	phage capsid protein	capsid	F7V9A6	Lactobacillus_virus	50.6	5.0e-102
AVK95602.1|928319_928610_+	hypothetical protein	NA	F7V9A8	Lactobacillus_virus	38.9	1.4e-08
AVK95603.1|928619_928949_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AVK95604.1|928945_929374_+	hypothetical protein	NA	NA	NA	NA	NA
AVK95605.1|929370_929868_+	hypothetical protein	NA	NA	NA	NA	NA
AVK95606.1|929871_930930_+|tail	phage tail sheath protein	tail	A0A0A7S0D2	Clostridium_phage	44.5	4.6e-70
AVK95607.1|930944_931379_+|terminase	terminase	terminase	A0A0A8WF55	Clostridium_phage	41.0	7.7e-16
AVK95608.1|931403_931799_+	hypothetical protein	NA	NA	NA	NA	NA
AVK95609.1|931798_931978_+	hypothetical protein	NA	NA	NA	NA	NA
AVK95610.1|932008_934132_+	hypothetical protein	NA	A0A0S2SXL7	Bacillus_phage	44.8	4.0e-73
AVK95611.1|934145_934568_+	hypothetical protein	NA	A0A0N7ACL7	Bacillus_phage	27.2	4.6e-05
AVK95612.1|934567_935545_+	hypothetical protein	NA	NA	NA	NA	NA
AVK95613.1|935546_935906_+	hypothetical protein	NA	NA	NA	NA	NA
AVK95614.1|935905_936352_+	hypothetical protein	NA	NA	NA	NA	NA
AVK95615.1|936352_937393_+	hypothetical protein	NA	A0A0A7RUN3	Clostridium_phage	35.2	1.0e-50
AVK95616.1|937389_937737_+	hypothetical protein	NA	A0A1B1INQ1	uncultured_Mediterranean_phage	34.2	2.0e-06
AVK95617.1|937747_938566_+	hypothetical protein	NA	NA	NA	NA	NA
AVK95618.1|938565_938898_+	hypothetical protein	NA	NA	NA	NA	NA
AVK95619.1|938898_939504_+	hypothetical protein	NA	NA	NA	NA	NA
AVK95620.1|939500_939725_+	hypothetical protein	NA	NA	NA	NA	NA
AVK95621.1|939968_940268_+	hypothetical protein	NA	NA	NA	NA	NA
AVK95622.1|940339_940654_+	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	41.3	1.7e-12
AVK95623.1|940643_940904_+|holin	phage holin	holin	A0A1Q1PW49	Staphylococcus_phage	54.7	2.4e-20
AVK95624.1|940900_941569_+	peptidoglycan L-alanyl-D-glutamate endopeptidase	NA	A0A2D1GQ84	Lysinibacillus_phage	53.4	2.5e-58
AVK95625.1|941613_942075_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98993.1|942094_942247_-	hypothetical protein	NA	NA	NA	NA	NA
AVK95626.1|942709_943201_-	hypothetical protein	NA	NA	NA	NA	NA
AVK95627.1|943218_943431_-	transcriptional regulator	NA	NA	NA	NA	NA
AVK95628.1|943801_944692_+	helix-turn-helix domain-containing protein	NA	A0A288WFZ2	Bacillus_phage	27.1	6.1e-07
AVK95629.1|945188_946352_-|integrase	site-specific integrase	integrase	A5GYP9	Lactococcus_phage	35.9	4.6e-55
948035:948050	attR	GCAGGTAAAAAGGGTG	NA	NA	NA	NA
>prophage 5
CP019980	Lysinibacillus sphaericus strain DSM 28 chromosome, complete genome	4681723	2103716	2149274	4681723	tail,portal,holin,head,terminase,coat	uncultured_Caudovirales_phage(14.29%)	63	NA	NA
AVK99046.1|2103716_2104133_+|holin	holin	holin	S6AVT9	Thermus_phage	55.9	2.1e-31
AVK96677.1|2104129_2104819_+	peptidoglycan L-alanyl-D-glutamate endopeptidase	NA	A0A2D1GQ84	Lysinibacillus_phage	47.2	2.0e-50
AVK99047.1|2104948_2105137_-	hypothetical protein	NA	NA	NA	NA	NA
AVK99048.1|2105340_2106345_-	hypothetical protein	NA	A0A1P8BL30	Lactococcus_phage	32.0	8.9e-07
AVK96678.1|2107125_2108364_-	hypothetical protein	NA	S6C485	Thermus_phage	37.9	5.8e-56
AVK96679.1|2108332_2108824_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	41.9	2.9e-27
AVK96680.1|2108880_2109615_-	hypothetical protein	NA	A0A088F7U1	Mycobacterium_phage	46.0	7.6e-56
AVK96681.1|2109662_2110835_-	hypothetical protein	NA	NA	NA	NA	NA
AVK96682.1|2111046_2112150_-	endonuclease	NA	A0A1S5SAB0	Streptococcus_phage	50.5	3.4e-100
AVK96683.1|2112278_2112641_-	transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	52.5	2.1e-19
AVK96684.1|2112750_2113122_-	transcriptional regulator	NA	A0A1L2BY72	Clostridium_phage	39.0	1.3e-08
AVK96685.1|2113211_2113574_-	transcriptional regulator	NA	O03970	Lactobacillus_phage	52.1	2.8e-11
AVK96686.1|2113734_2113929_+	transcriptional regulator	NA	NA	NA	NA	NA
AVK96687.1|2114069_2114801_+	hypothetical protein	NA	A0A2I7SCV5	Paenibacillus_phage	60.4	2.2e-39
AVK96688.1|2114816_2115161_+	hypothetical protein	NA	NA	NA	NA	NA
AVK96689.1|2115273_2115540_+	transcriptional regulator	NA	S5MNZ7	Brevibacillus_phage	50.7	8.4e-13
AVK96690.1|2115527_2115755_+	hypothetical protein	NA	NA	NA	NA	NA
AVK96691.1|2115758_2115950_+	hypothetical protein	NA	NA	NA	NA	NA
AVK96692.1|2116142_2116367_+	hypothetical protein	NA	NA	NA	NA	NA
AVK96693.1|2116436_2117366_+	hypothetical protein	NA	A0A0A7RWR9	Clostridium_phage	46.7	6.2e-79
AVK96694.1|2117368_2118175_+	recombinase RecT	NA	S6AVW6	Thermus_phage	48.4	6.2e-59
AVK96695.1|2118110_2118341_+	hypothetical protein	NA	A0A290G4G7	Caldibacillus_phage	59.2	1.8e-11
AVK96696.1|2118384_2118789_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
AVK96697.1|2118915_2119731_+	hypothetical protein	NA	A0A1C8E9B4	Bacillus_phage	64.3	8.5e-32
AVK99049.1|2119660_2120497_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	42.9	1.6e-49
AVK96698.1|2120531_2120867_+	hypothetical protein	NA	NA	NA	NA	NA
AVK96699.1|2120935_2121127_+	hypothetical protein	NA	NA	NA	NA	NA
AVK96700.1|2121119_2121344_+	hypothetical protein	NA	A0A2D1GQB9	Lysinibacillus_phage	58.0	1.2e-12
AVK96701.1|2121325_2121514_+	hypothetical protein	NA	NA	NA	NA	NA
AVK96702.1|2121756_2122176_-	ATPase	NA	NA	NA	NA	NA
AVK96703.1|2122294_2122531_-	hypothetical protein	NA	NA	NA	NA	NA
AVK96704.1|2122614_2122806_-	hypothetical protein	NA	NA	NA	NA	NA
AVK96705.1|2122944_2123382_+	hypothetical protein	NA	A0A2P1JTX0	Anoxybacillus_phage	28.6	3.7e-10
AVK96706.1|2123564_2125094_+	hypothetical protein	NA	NA	NA	NA	NA
AVK96707.1|2125918_2126656_+	hypothetical protein	NA	NA	NA	NA	NA
AVK96708.1|2126822_2127005_+	DUF2758 domain-containing protein	NA	NA	NA	NA	NA
AVK96709.1|2127078_2127402_+	hypothetical protein	NA	NA	NA	NA	NA
AVK96710.1|2127432_2127963_+	transcriptional regulator	NA	A0A1B1P7B5	Bacillus_phage	50.6	4.1e-43
AVK96711.1|2127959_2128985_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1B1P7C6	Bacillus_phage	65.5	3.1e-132
AVK96712.1|2129116_2129350_+	hypothetical protein	NA	NA	NA	NA	NA
AVK96713.1|2129395_2130244_+	hypothetical protein	NA	C9E2I6	Enterococcus_phage	34.8	6.8e-24
AVK96714.1|2130243_2131452_+|terminase	terminase	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	70.5	3.6e-172
AVK96715.1|2131464_2132868_+|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	52.6	1.0e-133
AVK96716.1|2132864_2133875_+|head	phage head morphogenesis protein	head	A0A1Q1PVS0	Bacillus_phage	41.1	9.2e-52
AVK96717.1|2134096_2134552_+	hypothetical protein	NA	NA	NA	NA	NA
AVK96718.1|2134836_2135361_+	hypothetical protein	NA	NA	NA	NA	NA
AVK96719.1|2135541_2136027_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AVK96720.1|2136192_2136564_-	transcriptional regulator	NA	A0A290GJU0	Caldibacillus_phage	43.6	5.4e-18
AVK96721.1|2136756_2136966_+	transcriptional regulator	NA	NA	NA	NA	NA
AVK96722.1|2136962_2137745_+	hypothetical protein	NA	A0A0N7BS22	Escherichia_phage	37.8	1.1e-12
AVK96723.1|2137891_2138179_+	hypothetical protein	NA	NA	NA	NA	NA
AVK96724.1|2138462_2139983_+	hypothetical protein	NA	NA	NA	NA	NA
AVK96725.1|2140276_2140942_+	hypothetical protein	NA	A0A1L2K2N1	Aeribacillus_phage	53.0	2.1e-52
AVK96726.1|2140971_2141838_+|coat	P22 coat protein - protein 5 domain protein	coat	A0A1L2JY55	Aeribacillus_phage	73.7	1.2e-121
AVK96727.1|2142014_2142341_+	hypothetical protein	NA	A0A2H4JHC4	uncultured_Caudovirales_phage	33.3	3.4e-08
AVK96728.1|2142327_2142651_+	hypothetical protein	NA	NA	NA	NA	NA
AVK96729.1|2142650_2143076_+	hypothetical protein	NA	Q4ZCE4	Staphylococcus_virus	44.4	6.6e-28
AVK96730.1|2143072_2143516_+	hypothetical protein	NA	NA	NA	NA	NA
AVK96731.1|2143558_2144338_+|tail	phage major tail protein, TP901-1 family	tail	B8QTT6	Erwinia_phage	54.7	9.3e-12
AVK96732.1|2144398_2144869_+	hypothetical protein	NA	Q4ZBQ7	Staphylococcus_phage	34.3	3.4e-17
AVK96733.1|2144919_2145213_+	hypothetical protein	NA	NA	NA	NA	NA
AVK96734.1|2145212_2148362_+	hypothetical protein	NA	Q4ZC60	Staphylococcus_virus	26.1	5.6e-47
AVK96735.1|2148365_2149274_+	hypothetical protein	NA	A0A0U4B037	Exiguobacterium_phage	31.7	2.0e-26
>prophage 6
CP019980	Lysinibacillus sphaericus strain DSM 28 chromosome, complete genome	4681723	4325415	4358764	4681723	tail,portal,integrase,holin,head,capsid,terminase	uncultured_Caudovirales_phage(30.77%)	46	4321533:4321592	4358922:4359060
4321533:4321592	attL	TTTGAGGAGTGGTGGTTTAAAACTTTCTATAATAACTACGGCATACGCGGCTTTTAACTT	NA	NA	NA	NA
AVK98628.1|4325415_4325676_-|holin	phage holin	holin	A0A1Q1PW49	Staphylococcus_phage	51.2	2.0e-19
AVK98629.1|4325665_4325935_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98630.1|4326005_4326188_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98631.1|4326200_4326476_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98632.1|4326488_4327319_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98633.1|4327318_4327651_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98634.1|4327650_4328469_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98635.1|4328479_4328827_-	hypothetical protein	NA	A0A1B1INQ1	uncultured_Mediterranean_phage	35.1	9.0e-07
AVK98636.1|4328823_4329864_-	hypothetical protein	NA	A0A0A7RUN3	Clostridium_phage	34.9	4.0e-50
AVK98637.1|4329864_4330311_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98638.1|4330310_4330670_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98639.1|4330670_4331648_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98640.1|4331647_4332070_-	hypothetical protein	NA	A0A0N7ACL7	Bacillus_phage	28.1	2.7e-05
AVK98641.1|4332083_4334207_-	hypothetical protein	NA	A0A0S2SXL7	Bacillus_phage	45.1	5.2e-73
AVK98642.1|4334237_4334417_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98643.1|4334416_4334812_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98644.1|4334840_4335275_-|terminase	terminase	terminase	A0A0A8WF55	Clostridium_phage	41.5	1.0e-15
AVK98645.1|4335291_4336350_-|tail	phage tail sheath protein	tail	A0A0A7S0D2	Clostridium_phage	44.2	2.3e-69
AVK98646.1|4336353_4336851_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98647.1|4336847_4337276_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98648.1|4337272_4337602_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AVK98649.1|4337611_4337902_-	hypothetical protein	NA	F7V9A8	Lactobacillus_virus	38.9	1.4e-08
AVK98650.1|4338086_4339256_-|capsid	phage capsid protein	capsid	F7V9A6	Lactobacillus_virus	50.6	6.6e-102
AVK98651.1|4339257_4339863_-	peptidase U35	NA	A0A2H4J861	uncultured_Caudovirales_phage	71.5	6.9e-63
AVK98652.1|4339852_4341106_-|portal	phage portal protein	portal	U3PFW0	Lactobacillus_phage	48.7	3.0e-100
AVK98653.1|4341118_4342798_-|terminase	terminase	terminase	A0A0A7RUM0	Clostridium_phage	42.8	2.4e-121
AVK98654.1|4342794_4343256_-|terminase	terminase	terminase	A0A0A7RUQ4	Clostridium_phage	64.7	3.3e-49
AVK98655.1|4343340_4343730_-	HNH endonuclease	NA	NA	NA	NA	NA
AVK98656.1|4343797_4345087_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98657.1|4345656_4346091_-	hypothetical protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	57.6	1.4e-36
AVK99140.1|4346444_4348316_-	DNA primase	NA	A0A060ADU2	Enterococcus_phage	29.0	1.8e-08
AVK99141.1|4348558_4348921_-	hypothetical protein	NA	A0A2H4JBP0	uncultured_Caudovirales_phage	57.5	1.4e-31
AVK98658.1|4348991_4350710_-	DNA polymerase B	NA	A0A1B1P7M5	Bacillus_phage	31.8	3.8e-74
AVK98659.1|4350711_4351509_-	hypothetical protein	NA	E5KY11	Escherichia_phage	44.1	3.3e-20
AVK98660.1|4351505_4352582_-	alpha/beta hydrolase	NA	A0A1B0YEB5	Lactobacillus_phage	46.3	1.1e-58
AVK98661.1|4352584_4353496_-	endonuclease	NA	A0A2H4JA52	uncultured_Caudovirales_phage	22.8	9.9e-05
AVK98662.1|4353496_4353796_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98663.1|4353801_4355010_-	DNA helicase	NA	A0A2H4J064	uncultured_Caudovirales_phage	30.5	3.3e-40
AVK98664.1|4354999_4355296_-	recombinase RecB	NA	A0A2H4J095	uncultured_Caudovirales_phage	51.3	3.8e-14
AVK98665.1|4355524_4355788_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98666.1|4355788_4356019_-	hypothetical protein	NA	A0A2H4J246	uncultured_Caudovirales_phage	61.5	4.0e-11
AVK98667.1|4356015_4356198_-	excisionase	NA	U5P0W4	Brevibacillus_phage	48.2	1.2e-07
AVK98668.1|4356215_4356431_-	transcriptional regulator	NA	NA	NA	NA	NA
AVK98669.1|4356615_4357017_+	hypothetical protein	NA	A0A2H4JDE4	uncultured_Caudovirales_phage	58.0	4.6e-15
AVK98670.1|4357153_4357372_+	transcriptional regulator	NA	NA	NA	NA	NA
AVK98671.1|4357570_4358764_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	41.6	7.0e-75
4358922:4359060	attR	TTTGAGGAGTGGTGGTTTAAAACTTTCTATAATAACTACGGCATACGCGGCTTTTAACTTTACCATTAGAGCCTCAAGGCTTCAAAGCGACTCACCCTTCTTTATTGGAGGGTGAGTTTTTTATGTAAAAAACAACGTT	NA	NA	NA	NA
>prophage 7
CP019980	Lysinibacillus sphaericus strain DSM 28 chromosome, complete genome	4681723	4566217	4613149	4681723	portal,tRNA,integrase,capsid,terminase	uncultured_Caudovirales_phage(25.58%)	76	4567733:4567751	4610059:4610077
AVK98823.1|4566217_4567711_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.3	3.9e-91
4567733:4567751	attL	TGTCCGCGTTTACGTCCAT	NA	NA	NA	NA
AVK98824.1|4567964_4568615_+	hypothetical protein	NA	NA	NA	NA	NA
AVK98825.1|4568675_4568954_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98826.1|4568934_4569303_-	aconitate hydratase	NA	NA	NA	NA	NA
AVK99151.1|4569295_4569634_-	hypothetical protein	NA	A0A2H4JAP8	uncultured_Caudovirales_phage	35.9	6.2e-05
AVK98827.1|4569652_4569922_-	hypothetical protein	NA	A0A2I7SCS8	Paenibacillus_phage	43.2	1.2e-11
AVK98828.1|4570041_4570725_-	XlyB	NA	A0A2H4IZS3	uncultured_Caudovirales_phage	85.8	8.3e-81
AVK98829.1|4570721_4571195_-	hypothetical protein	NA	A0A2K5B2A2	Erysipelothrix_phage	32.6	5.9e-09
AVK98830.1|4571421_4571646_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98831.1|4571642_4572248_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98832.1|4572248_4572572_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98833.1|4572587_4573229_-	hypothetical protein	NA	A0A1L2JZ80	Aeribacillus_phage	50.2	3.6e-54
AVK98834.1|4573221_4574403_-	hypothetical protein	NA	E5DV64	Deep-sea_thermophilic_phage	49.1	1.4e-96
AVK98835.1|4574389_4574743_-	hypothetical protein	NA	A0A2H4J4S8	uncultured_Caudovirales_phage	36.2	6.1e-11
AVK98836.1|4574742_4575207_-	hypothetical protein	NA	A0A1L2JY64	Aeribacillus_phage	30.7	7.3e-12
AVK98837.1|4575203_4576004_-	hypothetical protein	NA	E5DV61	Deep-sea_thermophilic_phage	45.6	8.6e-61
AVK98838.1|4575996_4576320_-	hypothetical protein	NA	E5DV60	Deep-sea_thermophilic_phage	53.1	1.6e-21
AVK98839.1|4576322_4576919_-	hypothetical protein	NA	A0A2H4JD33	uncultured_Caudovirales_phage	38.9	2.1e-27
AVK98840.1|4576922_4579058_-	hypothetical protein	NA	A0A2P1JUK2	Bacillus_phage	29.9	3.7e-26
AVK98841.1|4579238_4579580_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98842.1|4579623_4580028_-	DUF3277 domain-containing protein	NA	A0A1L2K2P1	Aeribacillus_phage	50.0	4.1e-27
AVK98843.1|4580041_4581052_-	hypothetical protein	NA	A0A2H4J8B9	uncultured_Caudovirales_phage	50.6	1.1e-81
AVK98844.1|4581051_4581558_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98845.1|4581550_4581898_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98846.1|4581894_4582404_-	hypothetical protein	NA	A0A2H4J4S5	uncultured_Caudovirales_phage	49.1	1.2e-39
AVK98847.1|4582407_4582767_-	hypothetical protein	NA	A0A1L2JY52	Aeribacillus_phage	37.0	6.6e-05
AVK98848.1|4582705_4583011_-	hypothetical protein	NA	NA	NA	NA	NA
AVK99152.1|4583067_4583988_-|capsid	major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	62.0	3.3e-101
AVK98849.1|4584072_4584663_-	hypothetical protein	NA	A0A1L2K2N1	Aeribacillus_phage	38.8	2.4e-12
AVK98850.1|4584802_4585723_-	hypothetical protein	NA	E5DV54	Deep-sea_thermophilic_phage	40.8	3.8e-52
AVK98851.1|4585646_4587083_-|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	53.9	3.0e-133
AVK99153.1|4587093_4588260_-|terminase	terminase	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	75.6	6.0e-180
AVK98852.1|4588292_4589081_-	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	36.8	2.4e-31
AVK98853.1|4589391_4589679_-	hypothetical protein	NA	A0A1X9HVT2	Ruegeria_phage	50.0	5.5e-18
AVK98854.1|4590599_4591370_-	hypothetical protein	NA	A0A0A7S0U2	Clostridium_phage	29.0	3.6e-16
AVK98855.1|4591371_4591665_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98856.1|4591648_4592785_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98857.1|4592921_4593335_-	hypothetical protein	NA	A0A290FZR5	Caldibacillus_phage	48.4	9.3e-27
AVK98858.1|4593635_4593848_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98859.1|4594042_4594297_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98860.1|4594281_4594704_-	hypothetical protein	NA	S6B1L9	Thermus_phage	51.1	7.5e-32
AVK98861.1|4594700_4595351_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98862.1|4595428_4595668_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98863.1|4595701_4595881_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98864.1|4595903_4596413_-	single-stranded DNA-binding protein	NA	A0A059T5E0	Listeria_phage	51.7	7.4e-42
AVK98865.1|4596409_4596685_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98866.1|4596681_4596978_-	hypothetical protein	NA	R4JMS5	Bacillus_phage	55.7	1.6e-17
AVK98867.1|4597057_4597246_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98868.1|4597238_4597664_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98869.1|4597670_4598228_-	hypothetical protein	NA	A0A0A7AR03	Bacillus_phage	55.2	6.2e-10
AVK98870.1|4598244_4598430_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98871.1|4598465_4599284_-	hypothetical protein	NA	A6XMI1	Bacillus_virus	43.9	5.2e-45
AVK98872.1|4599219_4600011_-	hypothetical protein	NA	A0A1C8E9B4	Bacillus_phage	60.8	1.9e-28
AVK98873.1|4600026_4600395_-	hypothetical protein	NA	A0A2H4J4P5	uncultured_Caudovirales_phage	48.8	2.5e-15
AVK98874.1|4600444_4600972_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98875.1|4601027_4601231_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVK98876.1|4601406_4602219_-	recombinase RecT	NA	S6AVW6	Thermus_phage	45.3	1.5e-52
AVK98877.1|4602221_4602401_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98878.1|4602403_4603345_-	hypothetical protein	NA	A8ATY5	Listeria_phage	50.8	3.0e-81
AVK98879.1|4603414_4603693_-	hypothetical protein	NA	A0A2D1GQ57	Lysinibacillus_phage	57.7	9.3e-15
AVK98880.1|4603704_4604010_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98881.1|4604296_4604548_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98882.1|4604544_4605063_-	transcriptional regulator	NA	NA	NA	NA	NA
AVK98883.1|4605229_4605526_-	hypothetical protein	NA	A0A0B5CYM2	Listeria_phage	45.9	2.8e-09
AVK98884.1|4605548_4605788_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98885.1|4605787_4606543_-	hypothetical protein	NA	A0A2I7SDG8	Paenibacillus_phage	44.6	1.4e-44
AVK98886.1|4606613_4606859_-	hypothetical protein	NA	NA	NA	NA	NA
AVK98887.1|4606909_4607215_+	hypothetical protein	NA	S6B1N1	Thermus_phage	39.4	2.4e-11
AVK98888.1|4607411_4607633_-	transcriptional regulator	NA	NA	NA	NA	NA
AVK98889.1|4607797_4608262_+	transcriptional regulator	NA	Q786F1	Bacillus_phage	38.2	3.0e-18
AVK98890.1|4608287_4608728_+	ImmA/IrrE family metallo-endopeptidase	NA	S6B1N5	Thermus_phage	47.5	8.9e-28
AVK98891.1|4608772_4609972_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	42.9	2.9e-81
AVK98892.1|4610261_4611302_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
4610059:4610077	attR	TGTCCGCGTTTACGTCCAT	NA	NA	NA	NA
AVK98893.1|4611408_4611930_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AVK98894.1|4611929_4612295_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AVK98895.1|4612294_4613149_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	30.8	3.1e-24
