The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019981	Pediococcus inopinatus strain DSM 20285 chromosome, complete genome	2137091	233860	294069	2137091	tRNA,transposase	Streptococcus_phage(31.25%)	50	NA	NA
AVK99372.1|233860_235036_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AVK99373.1|235123_235828_+	haloacid dehalogenase	NA	NA	NA	NA	NA
AVK99374.1|236163_237549_-	hemolysin	NA	NA	NA	NA	NA
AVK99375.1|237794_240533_+	magnesium-transporting ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	30.3	7.0e-70
AVK99376.1|240608_240989_+	hypothetical protein	NA	NA	NA	NA	NA
AVK99377.1|241221_241650_+	hypothetical protein	NA	NA	NA	NA	NA
AVK99378.1|241840_242785_+	aldo/keto reductase	NA	NA	NA	NA	NA
AVK99379.1|242981_243551_-	hypothetical protein	NA	NA	NA	NA	NA
AVK99380.1|243557_243893_-	hypothetical protein	NA	NA	NA	NA	NA
AVK99381.1|244045_244588_+	hypothetical protein	NA	NA	NA	NA	NA
AVK99382.1|244991_246392_+	acetaldehyde dehydrogenase	NA	NA	NA	NA	NA
AVK99383.1|246535_248095_+	hypothetical protein	NA	NA	NA	NA	NA
AVK99384.1|248095_249625_+	hypothetical protein	NA	NA	NA	NA	NA
AVK99385.1|249694_251050_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	41.6	4.3e-97
AVK99386.1|251155_251587_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVL01037.1|251620_252124_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AVK99387.1|252246_252969_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVL01038.1|253459_255844_+	phosphoketolase	NA	NA	NA	NA	NA
AVK99388.1|256034_257318_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.9	4.0e-44
AVK99389.1|257483_257954_+	hypothetical protein	NA	A0A0M7RDN2	Lactobacillus_phage	38.6	1.5e-17
AVK99390.1|258011_258758_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AVK99391.1|258782_259673_-	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AVK99392.1|259746_260205_-	universal stress protein UspA	NA	NA	NA	NA	NA
AVK99393.1|260852_261311_+	hypothetical protein	NA	NA	NA	NA	NA
AVK99394.1|261319_261964_+	hypothetical protein	NA	NA	NA	NA	NA
AVK99395.1|262230_263469_-|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	24.3	4.0e-09
AVK99396.1|265271_265898_-	alkaline phosphatase	NA	NA	NA	NA	NA
AVL01039.1|266210_267062_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVK99397.1|267101_267527_-	transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	31.7	1.1e-06
AVK99398.1|267786_268722_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVK99399.1|268786_270784_-	sodium:proton antiporter	NA	NA	NA	NA	NA
AVK99400.1|270930_271890_-	nucleoside hydrolase	NA	NA	NA	NA	NA
AVK99401.1|272614_273598_+	ferredoxin--NADP(+) reductase	NA	G3MA85	Bacillus_virus	26.6	1.9e-17
AVK99402.1|273658_275818_-	alkaline phosphatase	NA	W6LM83	Streptococcus_phage	49.5	9.7e-176
AVK99403.1|275984_276425_+	hypothetical protein	NA	NA	NA	NA	NA
AVK99404.1|277584_278349_+	hypothetical protein	NA	NA	NA	NA	NA
AVK99405.1|278504_279746_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	22.6	2.0e-08
AVK99406.1|279845_282539_-	hypothetical protein	NA	NA	NA	NA	NA
AVK99407.1|282670_283606_-	hypothetical protein	NA	NA	NA	NA	NA
AVL01040.1|283854_284514_+	hypothetical protein	NA	S5MAL1	Bacillus_phage	43.7	9.6e-34
AVK99408.1|284742_285063_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	42.7	2.0e-21
AVK99409.1|285067_285967_+	hypothetical protein	NA	NA	NA	NA	NA
AVK99410.1|286015_286831_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
AVK99411.1|286989_287820_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.6	8.4e-43
AVK99412.1|287816_289064_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	53.6	1.5e-107
AVK99413.1|289133_289511_-	VOC family virulence protein	NA	NA	NA	NA	NA
AVK99414.1|289650_291198_+	ABC transporter ATP-binding protein	NA	A0A2H4UUX5	Bodo_saltans_virus	27.8	9.1e-43
AVK99415.1|291258_291744_+|transposase	transposase	transposase	NA	NA	NA	NA
AVK99416.1|291764_292613_+	hypothetical protein	NA	A0A1B1P773	Bacillus_phage	37.7	3.6e-41
AVK99417.1|292827_294069_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	22.6	2.6e-08
>prophage 2
CP019981	Pediococcus inopinatus strain DSM 20285 chromosome, complete genome	2137091	321563	383303	2137091	transposase,integrase	Bacillus_phage(16.67%)	59	333627:333644	368964:368981
AVK99441.1|321563_322238_+|transposase	transposase	transposase	NA	NA	NA	NA
AVK99442.1|322234_323128_+|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	29.2	6.1e-23
AVK99443.1|323237_324515_-	GTPase HflX	NA	NA	NA	NA	NA
AVK99444.1|324855_326490_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVK99445.1|326789_328427_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVK99446.1|328782_330411_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVK99447.1|330531_331461_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AVK99448.1|331465_332488_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AVK99449.1|332500_333628_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	7.9e-20
333627:333644	attL	AAAGGAGGCTAATCATGG	NA	NA	NA	NA
AVK99450.1|333640_334594_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	6.1e-21
AVK99451.1|334727_335969_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	22.6	2.0e-08
AVK99452.1|337605_337917_-	hypothetical protein	NA	NA	NA	NA	NA
AVK99453.1|338205_338556_+	hypothetical protein	NA	NA	NA	NA	NA
AVK99454.1|338665_338848_-	hypothetical protein	NA	NA	NA	NA	NA
AVK99455.1|338899_340318_-	PTS glucitol transporter subunit IIA	NA	NA	NA	NA	NA
AVK99456.1|340427_340733_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
AVK99457.1|340790_341282_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AVK99458.1|341523_342312_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AVK99459.1|342308_342737_+	galactose-6-phosphate isomerase	NA	NA	NA	NA	NA
AVK99460.1|343034_343553_+	galactose-6-phosphate isomerase	NA	NA	NA	NA	NA
AVK99461.1|343728_344724_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
AVK99462.1|344788_345466_+	DUF4867 domain-containing protein	NA	NA	NA	NA	NA
AVK99463.1|345724_346213_+	hypothetical protein	NA	NA	NA	NA	NA
AVK99464.1|346187_347627_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	23.6	2.0e-12
AVK99465.1|347825_348260_+	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AVK99466.1|348284_348800_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AVK99467.1|349111_349813_-	hypothetical protein	NA	NA	NA	NA	NA
AVK99468.1|349845_350724_-	galactose mutarotase	NA	NA	NA	NA	NA
AVK99469.1|350899_351712_+	hypothetical protein	NA	NA	NA	NA	NA
AVK99470.1|351885_352338_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVK99471.1|352349_353324_+	hypothetical protein	NA	NA	NA	NA	NA
AVK99472.1|353793_354834_+	Zn-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	29.6	4.9e-08
AVK99473.1|355568_356147_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AVK99474.1|356143_356359_-	hypothetical protein	NA	NA	NA	NA	NA
AVK99475.1|356382_356598_-	hypothetical protein	NA	NA	NA	NA	NA
AVK99476.1|357433_357802_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AVK99477.1|357919_359554_-	amino acid permease	NA	NA	NA	NA	NA
AVK99478.1|359574_360240_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AVK99479.1|360427_362284_-	potassium transporter	NA	NA	NA	NA	NA
AVK99480.1|362528_364823_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
AVK99481.1|364842_365769_+	pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	33.2	4.5e-29
AVK99482.1|365906_367460_+	GMP synthase (glutamine-hydrolyzing)	NA	A0A1V0SH76	Hokovirus	28.0	4.6e-18
AVK99483.1|367495_368719_-|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	31.6	6.8e-41
AVK99484.1|368715_368967_-	hypothetical protein	NA	NA	NA	NA	NA
AVK99485.1|369455_369815_+	transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	46.4	6.2e-19
368964:368981	attR	CCATGATTAGCCTCCTTT	NA	NA	NA	NA
AVK99486.1|369801_370161_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AVK99487.1|370241_371972_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AVK99488.1|372047_373343_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	64.4	1.1e-147
AVK99489.1|373681_374011_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AVK99490.1|374034_375435_+	CoA-disulfide reductase	NA	NA	NA	NA	NA
AVK99491.1|375637_375994_+	transcriptional regulator	NA	NA	NA	NA	NA
AVK99492.1|376019_376634_+	cadmium transporter	NA	NA	NA	NA	NA
AVK99493.1|377286_377487_-	hypothetical protein	NA	NA	NA	NA	NA
AVK99494.1|377565_377958_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AVK99495.1|378402_379575_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AVK99496.1|379678_380149_+	hypothetical protein	NA	NA	NA	NA	NA
AVK99497.1|380220_380598_+	hypothetical protein	NA	NA	NA	NA	NA
AVK99498.1|380584_380836_+	hypothetical protein	NA	NA	NA	NA	NA
AVK99499.1|382226_383303_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	36.1	5.6e-39
>prophage 3
CP019981	Pediococcus inopinatus strain DSM 20285 chromosome, complete genome	2137091	406089	415446	2137091		Streptococcus_phage(100.0%)	9	NA	NA
AVL01045.1|406089_407085_-	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	57.8	2.5e-102
AVK99519.1|407077_409108_-	FUSC family protein	NA	A0A1S5SF30	Streptococcus_phage	52.0	6.0e-151
AVK99520.1|409108_411562_-	ATP/GTP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	66.1	0.0e+00
AVK99521.1|411558_411939_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	65.6	1.0e-40
AVK99522.1|412006_412510_-	antirestriction protein ArdA	NA	NA	NA	NA	NA
AVK99523.1|412535_412757_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.6	4.9e-27
AVK99524.1|413643_413937_-	hypothetical protein	NA	NA	NA	NA	NA
AVK99525.1|413929_414250_-	hypothetical protein	NA	NA	NA	NA	NA
AVK99526.1|414246_415446_-	Cro/Cl family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	45.8	8.0e-95
>prophage 4
CP019981	Pediococcus inopinatus strain DSM 20285 chromosome, complete genome	2137091	1204053	1215388	2137091	tRNA,transposase	Bacillus_phage(28.57%)	11	NA	NA
AVL00236.1|1204053_1205253_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	30.4	4.3e-24
AVL00237.1|1205252_1206776_-	D-alanine--poly(phosphoribitol) ligase	NA	A0A2K9KZV5	Tupanvirus	28.3	2.5e-45
AVL00238.1|1206805_1206955_-	D-alanyl-lipoteichoic acid biosynthesis protein	NA	NA	NA	NA	NA
AVL00239.1|1207166_1208039_-	hypothetical protein	NA	A0A1B1P773	Bacillus_phage	42.3	3.1e-48
AVL00240.1|1208044_1208581_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	35.9	1.4e-14
AVL00241.1|1208678_1208990_-	thioredoxin	NA	A0A1V0SD63	Indivirus	34.9	2.8e-07
AVL00242.1|1209074_1211432_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	54.9	6.3e-27
AVL00243.1|1211585_1211882_-	hypothetical protein	NA	NA	NA	NA	NA
AVL00244.1|1211891_1212332_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AVL00245.1|1212328_1212628_-	hypothetical protein	NA	NA	NA	NA	NA
AVL00246.1|1212748_1215388_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.8	6.5e-65
>prophage 5
CP019981	Pediococcus inopinatus strain DSM 20285 chromosome, complete genome	2137091	1361876	1473190	2137091	capsid,portal,transposase,integrase,tRNA,protease,terminase	Streptococcus_phage(25.58%)	114	1423159:1423218	1473312:1473325
AVL00383.1|1361876_1362473_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	54.8	2.1e-56
AVL00384.1|1362539_1363469_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.4	2.1e-50
AVL00385.1|1363529_1364540_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	55.3	7.9e-96
AVL00386.1|1364536_1365430_-	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	2.6e-10
AVL00387.1|1365631_1368499_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.8	6.0e-306
AVL00388.1|1368510_1370514_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AVL00389.1|1370623_1371253_-	hydrolase	NA	NA	NA	NA	NA
AVL00390.1|1371293_1373021_-	phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	56.2	4.0e-188
AVL00391.1|1373233_1374175_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	48.5	1.7e-79
AVL00392.1|1374351_1375269_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	50.0	8.6e-73
AVL00393.1|1375298_1376315_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AVL00394.1|1376382_1377225_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AVL00395.1|1377240_1378182_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
AVL00396.1|1378215_1378575_-	hypothetical protein	NA	NA	NA	NA	NA
AVL00397.1|1378594_1378936_-	hypothetical protein	NA	NA	NA	NA	NA
AVL00398.1|1379239_1379917_-	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
AVL00399.1|1379935_1380691_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.3e-21
AVL00400.1|1380705_1381509_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.4	2.7e-14
AVL00401.1|1381524_1382412_-	phosphate ABC transporter, permease protein PstA	NA	NA	NA	NA	NA
AVL00402.1|1382408_1383332_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AVL00403.1|1383337_1384204_-	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVL00404.1|1384390_1385821_-	hypothetical protein	NA	W8CYF6	Bacillus_phage	31.0	1.4e-26
AVL00405.1|1385789_1386509_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.5	4.9e-39
AVL00406.1|1386541_1387648_-	peptide chain release factor 2	NA	NA	NA	NA	NA
AVL00407.1|1387751_1390118_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AVL00408.1|1390430_1390997_-	ribosomal subunit interface protein	NA	NA	NA	NA	NA
AVL00409.1|1391139_1391829_-	hypothetical protein	NA	NA	NA	NA	NA
AVL00410.1|1391806_1393144_-	DNA/RNA helicase	NA	A0A1X9I5S6	Streptococcus_phage	41.3	1.4e-79
AVL00411.1|1393192_1393831_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.6	6.4e-43
AVL00412.1|1393888_1395100_-	undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
AVL00413.1|1395432_1397268_-	amino acid permease	NA	NA	NA	NA	NA
AVL00414.1|1397556_1399188_-	molecular chaperone GroEL	NA	A0A240F766	uncultured_virus	55.7	4.0e-158
AVL00415.1|1399221_1399503_-	co-chaperone GroES	NA	A7KV50	Bacillus_phage	31.9	6.5e-08
AVL00416.1|1399690_1400347_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVL00417.1|1400347_1400971_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
AVL00418.1|1401094_1403032_+	multidrug ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.9	1.0e-51
AVL00419.1|1403096_1404092_-	serine hydrolase	NA	NA	NA	NA	NA
AVL00420.1|1404112_1405150_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.0	5.9e-62
AVL00421.1|1405157_1405733_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AVL00422.1|1405716_1406442_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AVL00423.1|1406557_1407553_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	34.6	9.1e-44
AVL00424.1|1407618_1408377_-	hypothetical protein	NA	NA	NA	NA	NA
AVL00425.1|1408475_1409369_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	57.3	1.0e-83
AVL00426.1|1409381_1409726_-	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
AVL00427.1|1409764_1410772_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	30.7	2.7e-35
AVL00428.1|1410793_1411123_-	hypothetical protein	NA	NA	NA	NA	NA
AVL01092.1|1411128_1411785_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	51.2	5.0e-51
AVL00429.1|1411817_1412417_-	recombination protein RecR	NA	NA	NA	NA	NA
AVL00430.1|1412432_1412753_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AVL00431.1|1412767_1414543_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	43.0	2.4e-55
AVL00432.1|1414736_1415252_-|tRNA	tRNA-specific adenosine deaminase	tRNA	NA	NA	NA	NA
AVL00433.1|1415241_1415865_-	16S rRNA methyltransferase	NA	NA	NA	NA	NA
AVL00434.1|1416157_1416388_+	NrdH-redoxin	NA	X2KRY7	Enterococcus_phage	44.0	1.2e-12
AVL00435.1|1416498_1418664_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.9	2.1e-255
AVL00436.1|1418688_1419705_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	60.7	2.3e-111
AVL00437.1|1419791_1420685_-|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	29.2	6.1e-23
AVL00438.1|1420681_1421356_-|transposase	transposase	transposase	NA	NA	NA	NA
AVL00439.1|1421517_1422759_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	22.6	2.6e-08
1423159:1423218	attL	TGTTGTTCGCCAGTGATAATGTCTTAACTAATTGGTCAGCAAAAATGTCTCGCAAATATG	NA	NA	NA	NA
AVL00440.1|1423241_1424684_+|integrase	integrase	integrase	NA	NA	NA	NA
1423159:1423218	attL	TGTTGTTCGCCAGTGATAATGTCTTAACTAATTGGTCAGCAAAAATGTCTCGCAAATATG	NA	NA	NA	NA
AVL00441.1|1424834_1426277_+|integrase	integrase	integrase	NA	NA	NA	NA
AVL00441.1|1424834_1426277_+|integrase	integrase	integrase	NA	NA	NA	NA
1424752:1424833	attR	TGTTGTTCGCCAGTGATAATGTCTTAACTAATTGGTCAGCAAAAATGTCTCGCAAATATGTTTCACCTCCGGCAAAATAGTT	NA	NA	NA	NA
AVL00442.1|1426467_1426836_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
1424752:1424833	attR	TGTTGTTCGCCAGTGATAATGTCTTAACTAATTGGTCAGCAAAAATGTCTCGCAAATATGTTTCACCTCCGGCAAAATAGTT	NA	NA	NA	NA
AVL00443.1|1426878_1427385_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
AVL00444.1|1427579_1428269_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
AVL00445.1|1428357_1428783_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
AVL00446.1|1428945_1429491_-	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
AVL00447.1|1429616_1429784_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
AVL00448.1|1429797_1429947_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AVL00449.1|1430071_1430668_-	hypothetical protein	NA	NA	NA	NA	NA
AVL00450.1|1430820_1431609_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AVL00451.1|1431595_1432015_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
AVL00452.1|1432018_1433425_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	31.2	1.6e-49
AVL00453.1|1433578_1435066_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L0I5	Tupanvirus	33.6	7.5e-10
AVL00454.1|1435191_1436322_-	hypothetical protein	NA	NA	NA	NA	NA
AVL00455.1|1436598_1437969_-	DNA repair protein RadA	NA	NA	NA	NA	NA
AVL00456.1|1438050_1438587_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	52.5	7.8e-42
AVL00457.1|1438777_1439116_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVL00458.1|1439102_1439789_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
AVL00459.1|1439842_1441225_+	aminopeptidase	NA	A0A2H4UTL8	Bodo_saltans_virus	28.6	1.9e-44
AVL00460.1|1441647_1442319_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
AVL00461.1|1442321_1443389_-	EamA family transporter	NA	NA	NA	NA	NA
AVL00462.1|1443516_1444470_-	malate transporter	NA	NA	NA	NA	NA
AVL00463.1|1444584_1445742_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AVL00464.1|1445786_1446566_-	carboxyltransferase	NA	NA	NA	NA	NA
AVL00465.1|1446558_1447356_-	hypothetical protein	NA	NA	NA	NA	NA
AVL00466.1|1447339_1448683_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AVL00467.1|1448675_1449071_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
AVL00468.1|1449084_1450065_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
AVL00469.1|1450270_1450771_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
AVL00470.1|1450773_1451184_-	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
AVL00471.1|1451214_1451586_-	hypothetical protein	NA	NA	NA	NA	NA
AVL00472.1|1451606_1452020_-	hypothetical protein	NA	NA	NA	NA	NA
AVL00473.1|1452159_1453074_-	PTS mannose family transporter subunit IID	NA	NA	NA	NA	NA
AVL00474.1|1453093_1453909_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AVL00475.1|1453941_1454913_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AVL00476.1|1455162_1458051_-	transcription antiterminator BglG	NA	NA	NA	NA	NA
AVL00477.1|1458313_1459207_-|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	29.2	6.1e-23
AVL00478.1|1459203_1459878_-|transposase	transposase	transposase	NA	NA	NA	NA
AVL00479.1|1460420_1460702_-	DNA-packaging protein	NA	Q6J1Y1	Lactobacillus_phage	37.6	6.5e-08
AVL00480.1|1460767_1462279_-|capsid	capsid protein	capsid	I7B7B0	Enterococcus_phage	34.4	1.5e-37
AVL00481.1|1462275_1463427_-|portal	phage portal protein	portal	A0A1W6JPW5	Staphylococcus_phage	35.7	1.8e-56
AVL00482.1|1463429_1463609_-	hypothetical protein	NA	NA	NA	NA	NA
AVL01093.1|1463574_1465284_-|terminase	terminase	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.5	7.8e-120
AVL00483.1|1465276_1465750_-	hypothetical protein	NA	M1PKP2	Streptococcus_phage	30.5	3.1e-10
AVL00484.1|1466008_1466386_-	hypothetical protein	NA	A0A0S2GLI5	Bacillus_phage	36.3	1.8e-16
AVL00485.1|1466382_1466718_-	hypothetical protein	NA	NA	NA	NA	NA
AVL00486.1|1466736_1466937_-	hypothetical protein	NA	NA	NA	NA	NA
AVL00487.1|1466929_1467133_-	hypothetical protein	NA	NA	NA	NA	NA
AVL00488.1|1467565_1469167_-	hypothetical protein	NA	V5USD1	Enterococcus_phage	27.6	3.3e-27
AVL00489.1|1469179_1470001_-	hypothetical protein	NA	A0A0B5A5U2	Streptococcus_phage	24.6	7.1e-10
AVL00490.1|1469997_1470351_-	hypothetical protein	NA	NA	NA	NA	NA
AVL00491.1|1470575_1470845_-	hypothetical protein	NA	NA	NA	NA	NA
AVL00492.1|1470887_1471160_-	hypothetical protein	NA	A0A2H4JFN1	uncultured_Caudovirales_phage	42.6	5.4e-07
AVL00493.1|1471133_1471811_+	hypothetical protein	NA	NA	NA	NA	NA
AVL00494.1|1472038_1473190_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	33.9	4.4e-58
1473312:1473325	attR	ATGCACCCAAGAAG	NA	NA	NA	NA
>prophage 6
CP019981	Pediococcus inopinatus strain DSM 20285 chromosome, complete genome	2137091	1585075	1590830	2137091		Lactobacillus_phage(50.0%)	6	NA	NA
AVL00585.1|1585075_1586533_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	27.0	1.7e-35
AVL00586.1|1586641_1587337_-	peptidase M23	NA	A0A288TY55	Enterococcus_phage	70.0	5.8e-05
AVL00587.1|1587605_1588253_-	hypothetical protein	NA	A0A2K9V574	Lactobacillus_phage	46.4	1.1e-13
AVL00588.1|1588603_1589251_-	hypothetical protein	NA	A0A2K9V574	Lactobacillus_phage	46.4	1.1e-13
AVL00589.1|1589703_1590354_-	hypothetical protein	NA	Q6J1X2	Lactobacillus_phage	51.0	1.5e-55
AVL00590.1|1590572_1590830_-	hypothetical protein	NA	A0A1P8CWP5	Bacillus_phage	47.7	1.2e-13
>prophage 7
CP019981	Pediococcus inopinatus strain DSM 20285 chromosome, complete genome	2137091	1891387	1896961	2137091		Bacillus_phage(83.33%)	8	NA	NA
AVL00837.1|1891387_1892221_-	hypothetical protein	NA	A0A1P8CWQ3	Bacillus_phage	48.3	3.5e-65
AVL00838.1|1892256_1892514_-	hypothetical protein	NA	A0A1P8CWP5	Bacillus_phage	47.1	1.0e-15
AVL00839.1|1892749_1893286_+	hypothetical protein	NA	NA	NA	NA	NA
AVL00840.1|1893337_1893595_+	hypothetical protein	NA	A0A1P8CWP5	Bacillus_phage	47.7	1.2e-13
AVL00841.1|1893813_1894464_+	hypothetical protein	NA	Q6J1X2	Lactobacillus_phage	51.0	1.5e-55
AVL00842.1|1894814_1895165_+	hypothetical protein	NA	NA	NA	NA	NA
AVL00843.1|1895834_1896092_+	hypothetical protein	NA	A0A1P8CWP5	Bacillus_phage	47.1	1.0e-15
AVL00844.1|1896127_1896961_+	hypothetical protein	NA	A0A1P8CWQ3	Bacillus_phage	48.3	2.1e-65
>prophage 8
CP019981	Pediococcus inopinatus strain DSM 20285 chromosome, complete genome	2137091	2000692	2069177	2137091	tRNA,bacteriocin,transposase,integrase	Mycobacterium_phage(30.77%)	60	2031241:2031256	2071622:2071637
AVL00926.1|2000692_2001019_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AVL00927.1|2001070_2001505_+	hypothetical protein	NA	A0A1X9I6I8	Streptococcus_phage	36.8	8.5e-23
AVL00928.1|2001598_2002348_-	anion permease	NA	Q6EVM7	Oenoccocus_phage	50.4	2.0e-56
AVL00929.1|2002434_2002755_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AVL00930.1|2002772_2003204_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVL00931.1|2003406_2004186_+	hypothetical protein	NA	NA	NA	NA	NA
AVL00932.1|2004207_2004792_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
AVL00933.1|2005009_2006833_+	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	34.3	4.3e-15
AVL00934.1|2006899_2007502_+	transcriptional regulator	NA	NA	NA	NA	NA
AVL00935.1|2007507_2009088_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	27.1	7.4e-24
AVL00936.1|2009218_2010106_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVL00937.1|2010106_2010694_+	hypothetical protein	NA	NA	NA	NA	NA
AVL00938.1|2010851_2011361_+	hypothetical protein	NA	NA	NA	NA	NA
AVL00939.1|2011376_2012120_+	oxidoreductase	NA	NA	NA	NA	NA
AVL00940.1|2012161_2012575_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
AVL00941.1|2012578_2012902_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AVL00942.1|2012964_2013831_+	hydrogenase	NA	NA	NA	NA	NA
AVL00943.1|2013830_2014997_+	plastocyanin	NA	NA	NA	NA	NA
AVL00944.1|2015062_2015512_-	hypothetical protein	NA	NA	NA	NA	NA
AVL00945.1|2016448_2016649_-	hypothetical protein	NA	NA	NA	NA	NA
AVL00946.1|2017598_2017802_+	hypothetical protein	NA	NA	NA	NA	NA
AVL00947.1|2017888_2018101_+	hypothetical protein	NA	NA	NA	NA	NA
AVL00948.1|2018180_2018486_+	hypothetical protein	NA	NA	NA	NA	NA
AVL00949.1|2018795_2019020_+	hypothetical protein	NA	NA	NA	NA	NA
AVL00950.1|2019040_2019682_-	transcriptional regulator	NA	S5MUV6	Brevibacillus_phage	37.0	3.1e-05
AVL00951.1|2021186_2022569_+	hypothetical protein	NA	NA	NA	NA	NA
AVL00952.1|2022587_2023736_+	glycosyltransferase	NA	NA	NA	NA	NA
AVL00953.1|2023924_2025166_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	22.6	2.0e-08
AVL00954.1|2025237_2027235_-	PTS N-acetylglucosamine transporter subunit IIABC	NA	NA	NA	NA	NA
AVL00955.1|2027646_2028486_+	transcription antiterminator BglG	NA	NA	NA	NA	NA
AVL00956.1|2028579_2030481_+	PTS beta-glucoside transporter subunit EIIBCA	NA	NA	NA	NA	NA
AVL00957.1|2030495_2031938_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
2031241:2031256	attL	ATCCGGTTAACCAATT	NA	NA	NA	NA
AVL00958.1|2032078_2033908_+	hypothetical protein	NA	NA	NA	NA	NA
AVL00959.1|2034036_2034684_+	hypothetical protein	NA	NA	NA	NA	NA
AVL00960.1|2034987_2035566_+	elongation factor P	NA	NA	NA	NA	NA
AVL00961.1|2035650_2036892_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	23.0	4.1e-09
AVL00962.1|2037132_2038008_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
AVL00963.1|2038081_2038486_-	hypothetical protein	NA	NA	NA	NA	NA
AVL00964.1|2038838_2041076_-	hypothetical protein	NA	NA	NA	NA	NA
AVL00965.1|2043200_2044661_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AVL00966.1|2044808_2045465_+	ABC transporter	NA	A0A1V0SJ29	Klosneuvirus	23.0	8.7e-11
AVL00967.1|2045574_2046261_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.4	1.9e-29
AVL00968.1|2046260_2047529_+	sensor histidine kinase	NA	B5LWN0	Feldmannia_species_virus	29.7	1.6e-16
AVL00969.1|2047678_2047939_+	hypothetical protein	NA	NA	NA	NA	NA
AVL00970.1|2048087_2048891_+	hypothetical protein	NA	NA	NA	NA	NA
AVL00971.1|2048956_2049379_-	hypothetical protein	NA	NA	NA	NA	NA
AVL00972.1|2049569_2050163_-	hypothetical protein	NA	NA	NA	NA	NA
AVL00973.1|2050283_2051330_-	hypothetical protein	NA	NA	NA	NA	NA
AVL01119.1|2051541_2051994_+	RNA-binding protein	NA	NA	NA	NA	NA
AVL00974.1|2051990_2052488_-	hypothetical protein	NA	NA	NA	NA	NA
AVL00975.1|2052580_2053291_+	branched-chain amino acid transporter AzlC	NA	NA	NA	NA	NA
AVL00976.1|2053275_2053602_+	branched-chain amino acid ABC transporter	NA	NA	NA	NA	NA
AVL00977.1|2053916_2055170_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.3	1.9e-86
AVL00978.1|2055593_2056499_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVL00979.1|2056629_2057823_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AVL00980.1|2063484_2064861_+	hypothetical protein	NA	NA	NA	NA	NA
AVL00981.1|2064882_2066139_+	cytosine deaminase	NA	NA	NA	NA	NA
AVL00982.1|2066169_2066844_+|transposase	transposase	transposase	NA	NA	NA	NA
AVL00983.1|2067294_2068536_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	22.6	2.0e-08
AVL00984.1|2068604_2069177_+|integrase	integrase	integrase	A0A0N9SIX5	Staphylococcus_phage	27.5	6.6e-07
2071622:2071637	attR	ATCCGGTTAACCAATT	NA	NA	NA	NA
>prophage 1
CP019982	Pediococcus inopinatus strain DSM 20285 plasmid pLDW-12, complete sequence	89354	6779	58439	89354	transposase,protease	Staphylococcus_phage(23.53%)	49	NA	NA
AVL01125.1|6779_8018_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.4	1.2e-40
AVL01126.1|8304_8520_-	hypothetical protein	NA	NA	NA	NA	NA
AVL01127.1|8526_9312_-	ATPase	NA	F0PIG8	Enterococcus_phage	35.6	2.0e-30
AVL01128.1|9890_11000_+	plasmid replication initiation protein	NA	NA	NA	NA	NA
AVL01129.1|11403_11685_+	damage-inducible protein J	NA	NA	NA	NA	NA
AVL01130.1|11731_11917_+	hypothetical protein	NA	NA	NA	NA	NA
AVL01131.1|11913_12594_+	ATPase	NA	NA	NA	NA	NA
AVL01132.1|12583_12862_-	hypothetical protein	NA	NA	NA	NA	NA
AVL01133.1|12884_13112_-	hypothetical protein	NA	NA	NA	NA	NA
AVL01134.1|13364_15428_+	nickase	NA	NA	NA	NA	NA
AVL01135.1|15620_16157_-|transposase	transposase	transposase	NA	NA	NA	NA
AVL01136.1|17624_18020_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
AVL01137.1|18085_18913_-	hypothetical protein	NA	NA	NA	NA	NA
AVL01138.1|19141_20224_-	glycosyl transferase family 1	NA	NA	NA	NA	NA
AVL01139.1|21013_21943_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	33.7	1.1e-24
AVL01140.1|22154_22922_-|transposase	transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	1.0e-34
AVL01141.1|22960_23224_-	hypothetical protein	NA	A0A0C5AJ30	Paenibacillus_phage	37.5	5.2e-07
AVL01142.1|24025_25342_-	ammonia permease	NA	H8ZJB2	Ostreococcus_tauri_virus	29.6	4.3e-33
AVL01143.1|26776_27706_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	33.7	9.7e-24
AVL01144.1|27732_27996_+	hypothetical protein	NA	NA	NA	NA	NA
AVL01199.1|28075_28807_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVL01145.1|28946_30317_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AVL01146.1|30326_31640_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
AVL01147.1|32183_33026_+|transposase	transposase	transposase	Q6J1X2	Lactobacillus_phage	99.3	7.9e-158
AVL01148.1|33902_35186_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.9	4.0e-44
AVL01149.1|35237_35453_-	CsbD family protein	NA	NA	NA	NA	NA
AVL01150.1|35802_36054_-	hypothetical protein	NA	NA	NA	NA	NA
AVL01151.1|36068_36320_-	hypothetical protein	NA	NA	NA	NA	NA
AVL01152.1|36334_36877_-	stress response regulator Gls24	NA	NA	NA	NA	NA
AVL01153.1|36904_37090_-	hypothetical protein	NA	NA	NA	NA	NA
AVL01154.1|37101_37662_-	hypothetical protein	NA	NA	NA	NA	NA
AVL01155.1|37839_40338_+	hypothetical protein	NA	NA	NA	NA	NA
AVL01156.1|41071_42244_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	32.1	7.4e-29
AVL01157.1|42499_43054_+	resolvase	NA	A0A1J1J8Z4	Escherichia_phage	45.1	5.2e-33
AVL01158.1|43283_43463_-	hypothetical protein	NA	NA	NA	NA	NA
AVL01159.1|43468_44644_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.6	8.2e-28
AVL01160.1|44692_45190_+	hypothetical protein	NA	NA	NA	NA	NA
AVL01161.1|45365_46325_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVL01162.1|46330_47203_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	35.4	1.1e-16
AVL01163.1|47422_47692_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
AVL01164.1|47713_47863_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AVL01165.1|47885_48188_-	hypothetical protein	NA	NA	NA	NA	NA
AVL01166.1|48214_48394_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
AVL01167.1|49164_49557_-	hypothetical protein	NA	NA	NA	NA	NA
AVL01168.1|49710_50886_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.6	8.2e-28
AVL01169.1|51095_53210_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.0	1.4e-118
AVL01170.1|54347_54986_+	resolvase	NA	Q71TD8	Escherichia_phage	30.6	9.7e-15
AVL01171.1|55077_55572_+	hypothetical protein	NA	NA	NA	NA	NA
AVL01172.1|57413_58439_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	1.6e-40
