The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP020089	Enterobacter cloacae strain PIMB10EC27 chromosome, complete genome	5272177	613679	641674	5272177	capsid,tRNA,integrase,transposase	Escherichia_phage(88.89%)	35	615340:615376	629022:629058
AVL17091.1|613679_614438_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
AVL17092.1|614468_615191_+	topoisomerase II	NA	NA	NA	NA	NA
615340:615376	attL	ACCGTAGAAATACGTGCCGGTTCGAGTCCGGCCTTCG	NA	NA	NA	NA
AVL17093.1|615924_616293_+	hypothetical protein	NA	NA	NA	NA	NA
AVL17094.1|616685_616898_-	hypothetical protein	NA	NA	NA	NA	NA
AVL17095.1|616887_617496_-|integrase	integrase	integrase	NA	NA	NA	NA
AVL17096.1|620467_620752_+	hypothetical protein	NA	NA	NA	NA	NA
AVL17097.1|621019_621256_+	hypothetical protein	NA	NA	NA	NA	NA
AVL17098.1|621245_621587_+	hypothetical protein	NA	NA	NA	NA	NA
AVL17099.1|622144_622372_+	hypothetical protein	NA	NA	NA	NA	NA
AVL17100.1|622376_622754_+	hypothetical protein	NA	NA	NA	NA	NA
AVL17101.1|622772_623810_+|capsid	major capsid protein E	capsid	NA	NA	NA	NA
AVL17102.1|623936_624131_+	hypothetical protein	NA	NA	NA	NA	NA
AVL17103.1|624130_625996_+	hypothetical protein	NA	A0A291LB80	Escherichia_phage	29.5	7.6e-36
AVL17104.1|625996_626674_+	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	73.0	5.7e-74
AVL17105.1|626707_627379_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AVL21224.1|627671_628898_-|integrase	integrase	integrase	NA	NA	NA	NA
AVL17106.1|629061_629934_-	restriction endonuclease	NA	NA	NA	NA	NA
629022:629058	attR	ACCGTAGAAATACGTGCCGGTTCGAGTCCGGCCTTCG	NA	NA	NA	NA
AVL17107.1|630867_631143_+	hypothetical protein	NA	NA	NA	NA	NA
AVL17108.1|631226_632432_+	chromosome partitioning protein ParA	NA	A0A077SL49	Escherichia_phage	68.8	1.5e-162
AVL17109.1|632431_633406_+	chromosome partitioning protein ParB	NA	Q38420	Escherichia_phage	54.1	5.0e-87
AVL17110.1|633561_634266_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	6.9e-139
AVL17111.1|634520_635021_+	ferritin	NA	NA	NA	NA	NA
AVL17112.1|635173_635299_+	ABC transporter	NA	NA	NA	NA	NA
AVL17113.1|635337_636318_-|transposase	IS5/IS1182 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
AVL17114.1|636595_636877_-	transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
AVL17115.1|636857_637187_-	toxin-antitoxin system, toxin component	NA	A0A2I6TCA4	Escherichia_phage	43.1	3.1e-17
AVL17116.1|637389_637845_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AVL17117.1|637916_638312_+	mercuric transport protein	NA	NA	NA	NA	NA
AVL17118.1|638327_638603_+	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AVL17119.1|638630_639056_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AVL17120.1|639094_640780_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.9	5.1e-39
AVL17121.1|640797_641163_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AVL17122.1|641159_641396_+	mercury resistance protein	NA	NA	NA	NA	NA
AVL21225.1|641379_641517_-	mercury resistance protein	NA	NA	NA	NA	NA
AVL17123.1|641461_641674_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP020089	Enterobacter cloacae strain PIMB10EC27 chromosome, complete genome	5272177	1196582	1302320	5272177	capsid,integrase,tail,terminase,tRNA,transposase,portal,plate	Enterobacteria_phage(40.48%)	108	1231092:1231114	1305807:1305829
AVL17589.1|1196582_1197653_+|integrase	integrase	integrase	NA	NA	NA	NA
AVL17590.1|1198315_1198582_+	hypothetical protein	NA	NA	NA	NA	NA
AVL17591.1|1198673_1199141_+	hypothetical protein	NA	NA	NA	NA	NA
AVL21241.1|1199960_1200101_-	pilus assembly protein	NA	A0A2L1IV26	Escherichia_phage	83.8	2.1e-07
AVL17592.1|1200317_1201001_-	hypothetical protein	NA	NA	NA	NA	NA
AVL17593.1|1201511_1202108_+	hypothetical protein	NA	NA	NA	NA	NA
AVL17594.1|1202130_1202487_+	hypothetical protein	NA	NA	NA	NA	NA
AVL17595.1|1204305_1205406_-	hypothetical protein	NA	NA	NA	NA	NA
AVL21242.1|1205744_1206365_+	resolvase	NA	NA	NA	NA	NA
AVL21243.1|1206579_1206810_+	hypothetical protein	NA	E8ZD70	Streptococcus_phage	63.0	1.8e-16
AVL17596.1|1207299_1207551_+	hypothetical protein	NA	NA	NA	NA	NA
AVL17597.1|1207547_1207763_+	hypothetical protein	NA	NA	NA	NA	NA
AVL17598.1|1207841_1209263_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AVL17599.1|1209348_1209960_+	hypothetical protein	NA	NA	NA	NA	NA
AVL17600.1|1210037_1211108_+	lac repressor	NA	C6ZCU4	Enterobacteria_phage	53.7	3.1e-90
AVL17601.1|1211211_1214277_+	beta-D-galactosidase	NA	L0N6M2	Herpes_simplex_virus	66.2	0.0e+00
AVL17602.1|1214310_1215132_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AVL17603.1|1215266_1215542_+	transcriptional repressor rcnR	NA	NA	NA	NA	NA
AVL17604.1|1215522_1217100_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AVL17605.1|1217331_1217592_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
AVL17606.1|1217594_1217735_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
AVL17607.1|1217731_1218442_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVL17608.1|1218543_1220004_+	DNA-binding protein	NA	A0A1X9I5H2	Streptococcus_phage	25.5	5.5e-13
AVL17609.1|1219975_1220443_-	hypothetical protein	NA	NA	NA	NA	NA
AVL17610.1|1220558_1221110_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
AVL17611.1|1221319_1221538_-	transcriptional regulator	NA	NA	NA	NA	NA
AVL17612.1|1221565_1221940_-	Hha toxicity attenuator	NA	NA	NA	NA	NA
AVL17613.1|1222452_1225599_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.5	6.8e-53
AVL17614.1|1225621_1226815_-	MexE family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVL17615.1|1226956_1227610_+	DNA-binding transcriptional repressor AcrR	NA	NA	NA	NA	NA
AVL17616.1|1227723_1231071_+	mechanosensitive channel MscK	NA	NA	NA	NA	NA
AVL17617.1|1231072_1231258_-	DUF2496 domain-containing protein	NA	NA	NA	NA	NA
1231092:1231114	attL	GGGAGAGGGTTAGGGTGAGGGCA	NA	NA	NA	NA
AVL17618.1|1231270_1231798_-	primosomal replication protein N''	NA	NA	NA	NA	NA
AVL17619.1|1231848_1232226_+	hypothetical protein	NA	NA	NA	NA	NA
AVL17620.1|1232377_1232929_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.9	1.6e-29
AVL17621.1|1233017_1234946_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	42.9	6.0e-44
AVL17622.1|1234999_1235332_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AVL17623.1|1235331_1235937_+	recombination protein RecR	NA	NA	NA	NA	NA
AVL17624.1|1236047_1237922_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.9	1.6e-113
AVL17625.1|1238117_1238762_+	adenylate kinase	NA	NA	NA	NA	NA
AVL17626.1|1238886_1239849_+	ferrochelatase	NA	NA	NA	NA	NA
AVL17627.1|1239911_1241216_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
AVL17628.1|1241306_1242983_-	Kef family K(+) transporter	NA	NA	NA	NA	NA
AVL17629.1|1243211_1244432_-	MFS transporter	NA	NA	NA	NA	NA
AVL17630.1|1244595_1246248_+	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
AVL17631.1|1246370_1246850_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AVL17632.1|1247049_1247844_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AVL17633.1|1247992_1250491_-	Cu+ exporting ATPase	NA	A0A218MNH6	uncultured_virus	37.4	1.5e-111
AVL17634.1|1250766_1250877_-	hypothetical protein	NA	NA	NA	NA	NA
AVL17635.1|1250963_1251944_+|transposase	IS5/IS1182 family transposase	transposase	Q38213	Escherichia_phage	98.5	1.2e-184
AVL17636.1|1252052_1252850_-	type VI secretion protein	NA	NA	NA	NA	NA
AVL17637.1|1252854_1253187_-	hypothetical protein	NA	NA	NA	NA	NA
AVL21244.1|1253299_1253548_-	hypothetical protein	NA	Q858U4	Yersinia_virus	50.0	4.0e-09
AVL17638.1|1253587_1254724_-	hypothetical protein	NA	B9A7A9	Serratia_phage	75.5	3.0e-160
AVL17639.1|1254876_1256058_+|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	76.5	3.8e-174
AVL17640.1|1256058_1256574_+|tail	phage tail protein	tail	A0A0A7NPV8	Enterobacteria_phage	64.7	1.4e-59
AVL17641.1|1256622_1256940_+|tail	phage tail protein	tail	B9A7B2	Serratia_phage	56.1	2.6e-21
AVL21246.1|1256945_1257101_+|tail	phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	2.7e-11
AVL21245.1|1257087_1260054_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	53.6	1.2e-261
AVL17642.1|1260068_1260557_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	74.1	5.4e-66
AVL17643.1|1260988_1261504_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	42.4	2.1e-12
AVL17644.1|1263704_1264232_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	75.0	7.6e-74
AVL17645.1|1264224_1265121_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	67.4	7.0e-104
AVL17646.1|1265107_1265476_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	64.3	1.3e-35
AVL17647.1|1265472_1266054_-|plate	baseplate assembly protein	plate	A0A0A7NRZ3	Enterobacteria_phage	67.9	3.2e-73
AVL17648.1|1266050_1266689_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	53.1	3.5e-57
AVL17649.1|1266681_1267152_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	68.0	2.9e-61
AVL17650.1|1267253_1267466_-	peptidase	NA	NA	NA	NA	NA
AVL17651.1|1267362_1267800_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AVL17652.1|1267796_1268342_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	41.7	1.2e-29
AVL17653.1|1268325_1268628_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVL17654.1|1268618_1268819_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	75.4	3.7e-21
AVL17655.1|1268818_1269343_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	53.5	1.4e-43
AVL17656.1|1269441_1270299_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	61.4	1.2e-68
AVL17657.1|1270344_1271394_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	53.0	5.1e-106
AVL17658.1|1271417_1272254_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	68.3	1.4e-101
AVL17659.1|1272413_1274144_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	75.5	4.0e-265
AVL17660.1|1274143_1275202_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.8	1.2e-142
AVL17661.1|1275413_1275638_+	hypothetical protein	NA	NA	NA	NA	NA
AVL17662.1|1275880_1278103_-	peptidase S8 and S53, subtilisin, kexin, sedolisin	NA	NA	NA	NA	NA
AVL17663.1|1278114_1279254_-	ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	27.4	4.1e-16
AVL17664.1|1279387_1281802_-	replication protein	NA	F1BUS0	Erwinia_phage	40.7	3.9e-133
AVL17665.1|1282011_1282998_-	adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	46.8	2.2e-66
AVL17666.1|1282990_1283218_-	hypothetical protein	NA	NA	NA	NA	NA
AVL17667.1|1283267_1283459_-	hypothetical protein	NA	NA	NA	NA	NA
AVL17668.1|1283519_1283702_-	DUF4761 domain-containing protein	NA	NA	NA	NA	NA
AVL21247.1|1283733_1284069_-	hypothetical protein	NA	NA	NA	NA	NA
AVL17669.1|1284317_1284617_+	transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	59.6	8.5e-30
AVL17670.1|1284686_1285709_+|integrase	integrase	integrase	A0A0F7LA05	Escherichia_phage	50.2	4.9e-93
AVL17671.1|1285795_1286206_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AVL17672.1|1286202_1286655_-	hypothetical protein	NA	NA	NA	NA	NA
AVL17673.1|1286651_1287566_-	paraslipin	NA	NA	NA	NA	NA
AVL17674.1|1287728_1288400_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	35.7	1.7e-25
AVL17675.1|1288392_1289175_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AVL17676.1|1289223_1290078_-	co-chaperone YbbN	NA	NA	NA	NA	NA
AVL17677.1|1290136_1290907_-	short-chain dehydrogenase/reductase	NA	NA	NA	NA	NA
AVL17678.1|1290935_1291559_-	arylesterase	NA	NA	NA	NA	NA
AVL17679.1|1291529_1292216_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	2.2e-33
AVL17680.1|1292212_1294627_+	ABC transporter permease	NA	NA	NA	NA	NA
AVL17681.1|1294809_1295955_+	hypothetical protein	NA	NA	NA	NA	NA
AVL17682.1|1296038_1297109_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AVL17683.1|1297204_1298272_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AVL17684.1|1298268_1298778_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AVL17685.1|1298938_1299124_-	hypothetical protein	NA	NA	NA	NA	NA
AVL17686.1|1299189_1299399_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVL17687.1|1299539_1300262_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AVL17688.1|1300265_1300760_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AVL17689.1|1300934_1302320_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	1.1e-44
1305807:1305829	attR	GGGAGAGGGTTAGGGTGAGGGCA	NA	NA	NA	NA
>prophage 3
CP020089	Enterobacter cloacae strain PIMB10EC27 chromosome, complete genome	5272177	1774433	1853238	5272177	capsid,head,integrase,tail,terminase,protease,tRNA,portal	Enterobacteria_phage(31.37%)	80	1768426:1768441	1827296:1827311
1768426:1768441	attL	GCGCTGATGCGTCCGC	NA	NA	NA	NA
AVL18092.1|1774433_1775213_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AVL18093.1|1775216_1776539_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
AVL18094.1|1776519_1777224_+	condensin subunit E	NA	NA	NA	NA	NA
AVL18095.1|1777223_1781672_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
AVL18096.1|1781851_1783675_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AVL18097.1|1783849_1784401_+	hypothetical protein	NA	NA	NA	NA	NA
AVL18098.1|1784421_1785069_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AVL18099.1|1785126_1786317_-	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AVL18100.1|1786501_1787590_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	53.1	1.0e-101
AVL18101.1|1788971_1790372_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.2	1.1e-79
AVL18102.1|1790537_1791740_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.6	4.9e-44
AVL18103.1|1791924_1793217_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	95.8	1.7e-244
AVL18104.1|1793261_1793519_-	excisionase	NA	S4TND0	Salmonella_phage	91.2	1.4e-36
AVL18105.1|1793502_1793889_-	hypothetical protein	NA	NA	NA	NA	NA
AVL18106.1|1793876_1794626_-	hypothetical protein	NA	A0A1B5FPC0	Escherichia_phage	88.0	4.8e-122
AVL18107.1|1794671_1795499_-|protease	serine protease	protease	Q8W654	Enterobacteria_phage	85.1	2.2e-112
AVL18108.1|1795495_1795690_-	hypothetical protein	NA	NA	NA	NA	NA
AVL18109.1|1795689_1796097_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	47.1	1.2e-23
AVL18110.1|1796093_1796315_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	66.7	1.9e-18
AVL18111.1|1796286_1796697_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	88.3	9.5e-48
AVL18112.1|1796677_1796881_-	hypothetical protein	NA	NA	NA	NA	NA
AVL18113.1|1796996_1797383_-	peptidase S24	NA	F1C5A0	Cronobacter_phage	59.1	1.1e-37
AVL18114.1|1797449_1797881_-	transcriptional regulator	NA	NA	NA	NA	NA
AVL18115.1|1798082_1798781_-	hypothetical protein	NA	G8C7U1	Escherichia_phage	62.5	3.0e-78
AVL21262.1|1798893_1799118_+	transcriptional regulator	NA	G8C7U2	Escherichia_phage	59.7	1.3e-19
AVL18116.1|1799143_1799440_+	transcriptional regulator	NA	NA	NA	NA	NA
AVL18117.1|1799436_1800348_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	59.2	4.5e-90
AVL18118.1|1800363_1801242_+	AAA family ATPase	NA	Q8W641	Enterobacteria_phage	61.8	8.2e-81
AVL18119.1|1801238_1802618_+	helicase	NA	Q8W640	Enterobacteria_phage	68.4	1.2e-174
AVL18120.1|1802645_1803482_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	80.7	1.4e-122
AVL18121.1|1803593_1804514_-	hypothetical protein	NA	A0A1B5FPA3	Escherichia_phage	72.9	1.7e-57
AVL18122.1|1804658_1805045_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	93.8	7.3e-58
AVL18123.1|1805031_1805313_+	hypothetical protein	NA	K7PKN9	Enterobacterial_phage	46.2	1.7e-19
AVL18124.1|1805312_1805855_+	hypothetical protein	NA	A0A0U2I1S0	Escherichia_phage	73.2	5.2e-78
AVL18125.1|1805851_1806121_+	hypothetical protein	NA	NA	NA	NA	NA
AVL21263.1|1806770_1806983_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	81.2	6.4e-16
AVL21264.1|1807510_1808035_+	hypothetical protein	NA	G8C7Q4	Escherichia_phage	68.7	4.8e-52
AVL18126.1|1808045_1808270_+	hypothetical protein	NA	NA	NA	NA	NA
AVL18127.1|1808290_1809748_+	glycosyltransferase	NA	K7PKP3	Enterobacterial_phage	92.0	2.6e-273
AVL18128.1|1809791_1810310_+	hypothetical protein	NA	K7PJS8	Enterobacterial_phage	53.8	1.7e-46
AVL18129.1|1810290_1810881_+	hypothetical protein	NA	S4TR53	Salmonella_phage	80.5	1.9e-94
AVL18130.1|1810880_1811231_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.9	1.6e-51
AVL18131.1|1811388_1811862_+|terminase	terminase	terminase	K7PHI2	Enterobacteria_phage	98.1	6.6e-85
AVL18132.1|1811861_1813598_+|terminase	terminase	terminase	K7PKT2	Enterobacteria_phage	98.8	0.0e+00
AVL18133.1|1813597_1814902_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	92.9	6.8e-233
AVL18134.1|1814915_1815764_+	peptidase S14	NA	K7PH05	Enterobacteria_phage	91.4	2.0e-137
AVL18135.1|1815773_1816985_+|capsid	capsid protein	capsid	K7PM57	Enterobacteria_phage	86.5	1.5e-194
AVL18136.1|1817027_1817354_+	hypothetical protein	NA	K7PKT4	Enterobacteria_phage	86.1	1.2e-50
AVL18137.1|1817350_1817695_+|head,tail	head-tail adaptor protein	head,tail	Q7Y406	Yersinia_phage	54.5	9.4e-25
AVL18138.1|1817675_1818065_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	57.4	1.9e-42
AVL18139.1|1818061_1818466_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	72.7	2.2e-44
AVL18140.1|1818498_1818954_+|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	78.1	8.9e-63
AVL18141.1|1819018_1819381_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	53.4	4.0e-26
AVL18142.1|1819404_1819620_+	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	67.6	2.5e-23
AVL18143.1|1819619_1822949_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	66.6	0.0e+00
AVL18144.1|1822951_1823290_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	75.9	4.6e-48
AVL18145.1|1823286_1824042_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	94.8	1.5e-139
AVL18146.1|1824043_1824754_+	peptidase P60	NA	K7PGV2	Enterobacterial_phage	97.9	2.2e-145
AVL18147.1|1824782_1825130_+	hypothetical protein	NA	NA	NA	NA	NA
AVL18148.1|1825156_1825747_+|tail	phage tail protein	tail	K7PHE5	Enterobacteria_phage	84.7	1.7e-90
AVL18149.1|1829635_1830601_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.5	9.7e-59
1827296:1827311	attR	GCGGACGCATCAGCGC	NA	NA	NA	NA
AVL18150.1|1830661_1831999_+	hypothetical protein	NA	K7PGY2	Enterobacteria_phage	40.3	3.3e-65
AVL18151.1|1832117_1832384_-	virulence protein MsgA	NA	K7PKR6	Enterobacteria_phage	96.6	2.1e-40
AVL18152.1|1832811_1835424_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	2.4e-19
AVL18153.1|1835475_1836246_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	1.2e-30
AVL18154.1|1836242_1837034_-	alkanesulfonate transporter permease subunit	NA	NA	NA	NA	NA
AVL18155.1|1837043_1838189_-	alkanesulfonate monooxygenase, FMNH(2)-dependent	NA	NA	NA	NA	NA
AVL18156.1|1838185_1839148_-	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVL18157.1|1839140_1839716_-	NAD(P)H-dependent FMN reductase	NA	NA	NA	NA	NA
AVL18158.1|1839965_1840976_+	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AVL18159.1|1841141_1841684_+	cell division protein ZapC	NA	NA	NA	NA	NA
AVL18160.1|1841680_1842790_-	hypothetical protein	NA	V5UTY8	Synechococcus_phage	42.0	8.4e-06
AVL18161.1|1842890_1844999_+	23S rRNA (guanine(2445)-N(2))/(guanine(2069)-N(7))- methyltransferase	NA	NA	NA	NA	NA
AVL18162.1|1845011_1846919_+	ABC transporter ATPase	NA	A0A2K9L3Z8	Tupanvirus	28.3	5.6e-50
AVL18163.1|1846932_1848186_+	paraquat-inducible membrane protein A	NA	NA	NA	NA	NA
AVL18164.1|1848190_1849831_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AVL18165.1|1849827_1850394_+	hypothetical protein	NA	NA	NA	NA	NA
AVL18166.1|1850650_1850818_+	ribosome modulation factor	NA	NA	NA	NA	NA
AVL18167.1|1850890_1851409_-	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AVL18168.1|1851477_1853238_-|protease	Lon protease	protease	NA	NA	NA	NA
>prophage 4
CP020089	Enterobacter cloacae strain PIMB10EC27 chromosome, complete genome	5272177	3245365	3296530	5272177	head,holin,integrase,tail,lysis,terminase,transposase	Salmonella_phage(42.86%)	71	3288050:3288064	3305139:3305153
AVL19395.1|3245365_3246532_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	86.0	1.1e-197
AVL19396.1|3246874_3247264_-	DNA polymerase V	NA	G8C7R9	Escherichia_phage	92.2	2.4e-64
AVL19397.1|3247346_3247613_+	virulence protein MsgA	NA	K7PKM2	Enterobacterial_phage	97.7	1.2e-40
AVL19398.1|3247731_3248964_-	hypothetical protein	NA	K7PGY2	Enterobacteria_phage	53.2	2.7e-90
AVL19399.1|3249026_3252884_-	hypothetical protein	NA	H6WRW4	Salmonella_phage	85.5	0.0e+00
AVL19400.1|3252893_3253427_-|tail	phage tail protein	tail	H6WRW3	Salmonella_phage	67.6	1.0e-54
AVL21310.1|3253369_3254089_-|tail	phage tail protein	tail	A0A1V0E5M9	Salmonella_phage	81.9	4.3e-120
AVL19401.1|3254088_3254793_-|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	96.6	4.3e-133
AVL19402.1|3254829_3255177_-|tail	phage tail protein	tail	H6WRV8	Salmonella_phage	93.9	2.7e-59
AVL19403.1|3255176_3258386_-	hypothetical protein	NA	R9TMK1	Aeromonas_phage	44.7	1.5e-119
AVL19404.1|3258442_3258757_-	hypothetical protein	NA	H6WRV4	Salmonella_phage	73.1	2.0e-37
AVL19405.1|3258858_3259212_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	100.0	4.2e-60
AVL19406.1|3259302_3259833_-	hypothetical protein	NA	A0A1V0E5P7	Salmonella_phage	85.2	2.2e-81
AVL19407.1|3260015_3260669_-	hypothetical protein	NA	I6R0Q2	Salmonella_phage	90.3	3.0e-112
AVL19408.1|3260710_3261445_-	hypothetical protein	NA	A0A1V0E5P2	Salmonella_phage	87.2	2.2e-116
AVL19409.1|3261460_3261847_-	hypothetical protein	NA	I6R9A6	Salmonella_phage	95.3	2.3e-64
AVL19410.1|3261843_3262281_-	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	97.9	7.4e-75
AVL19411.1|3262288_3262651_-	hypothetical protein	NA	A0A1V0E5P3	Salmonella_phage	90.8	3.0e-61
AVL19412.1|3262643_3262823_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	96.6	1.6e-28
AVL19413.1|3262822_3263224_-	hypothetical protein	NA	I6S619	Salmonella_phage	81.2	4.7e-60
AVL19414.1|3263286_3263571_-	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	74.2	1.1e-31
AVL19415.1|3263581_3264679_-	hypothetical protein	NA	G0ZND9	Cronobacter_phage	84.7	7.9e-182
AVL19416.1|3264691_3265153_-	hypothetical protein	NA	G0ZND8	Cronobacter_phage	81.1	2.6e-62
AVL19417.1|3265165_3266431_-	hypothetical protein	NA	H6WRT2	Salmonella_phage	94.5	7.8e-226
AVL19418.1|3266434_3267364_-|head	phage head morphogenesis protein	head	H6WRT1	Salmonella_phage	83.5	4.5e-138
AVL19419.1|3267317_3268670_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	77.1	2.1e-205
AVL19420.1|3268867_3270121_-|terminase	terminase	terminase	I6RSK1	Salmonella_phage	97.0	1.2e-213
AVL19421.1|3270117_3270552_-	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	74.8	2.2e-47
AVL19422.1|3270559_3270778_-	hypothetical protein	NA	NA	NA	NA	NA
AVL19423.1|3270848_3271112_-	hypothetical protein	NA	A0A1V0E5Q1	Salmonella_phage	84.7	5.5e-33
AVL21311.1|3271897_3272338_-|lysis	lysis protein	lysis	A0A2H4FNE5	Salmonella_phage	76.4	6.6e-55
AVL19424.1|3272370_3272859_-	HNH endonuclease	NA	A0A0K1YA40	Cronobacter_phage	41.5	1.9e-23
AVL19425.1|3272855_3273299_-	muraminidase	NA	A0A0M4R365	Salmonella_phage	75.7	6.0e-56
AVL19426.1|3273285_3273627_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	54.2	6.3e-29
AVL19427.1|3273928_3274618_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.5	7.1e-56
AVL19428.1|3274727_3275339_-	protein NinG	NA	M9NYX8	Enterobacteria_phage	51.2	3.4e-41
AVL19429.1|3275331_3275502_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	85.7	2.6e-20
AVL19430.1|3275494_3275944_-	protein ninB	NA	I6R9D0	Salmonella_phage	47.2	2.5e-33
AVL19431.1|3276190_3276430_-	hypothetical protein	NA	NA	NA	NA	NA
AVL19432.1|3276429_3276795_-	hypothetical protein	NA	A0A1V0E5M5	Salmonella_phage	41.7	7.7e-09
AVL21312.1|3276791_3277052_-	hypothetical protein	NA	S4TNP2	Salmonella_phage	68.9	2.9e-10
AVL19433.1|3277489_3277912_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	85.2	6.7e-65
AVL19434.1|3278440_3278737_-	nucleoside 2-deoxyribosyltransferase	NA	A0A222YYT7	Escherichia_phage	63.0	7.1e-29
AVL19435.1|3278733_3278982_-	hypothetical protein	NA	NA	NA	NA	NA
AVL19436.1|3278978_3279323_-	Ren protein	NA	G8C7U7	Escherichia_phage	92.9	7.4e-54
AVL19437.1|3279324_3280014_-	phage replication protein	NA	G8C7U6	Escherichia_phage	96.1	4.2e-125
AVL19438.1|3280010_3280874_-	hypothetical protein	NA	G8C7U5	Escherichia_phage	91.6	2.9e-147
AVL19439.1|3280873_3281566_-	hypothetical protein	NA	NA	NA	NA	NA
AVL19440.1|3281651_3282194_-	regulator	NA	M9NZI6	Enterobacteria_phage	77.2	1.2e-71
AVL19441.1|3282223_3282451_-	transcriptional regulator	NA	G8C7U2	Escherichia_phage	100.0	4.1e-37
AVL19442.1|3282561_3283251_+	hypothetical protein	NA	G8C7U1	Escherichia_phage	100.0	2.2e-126
AVL19443.1|3283439_3284387_+	hypothetical protein	NA	A9YX09	Burkholderia_phage	42.3	2.0e-61
AVL19444.1|3284475_3285684_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	1.6e-47
AVL19445.1|3285739_3285937_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	95.3	9.2e-25
AVL19446.1|3286283_3286475_+	hypothetical protein	NA	NA	NA	NA	NA
AVL19447.1|3286500_3286977_+	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	33.7	4.2e-07
AVL19448.1|3287023_3287662_+	hypothetical protein	NA	L0AQZ0	Klebsiella_phage	43.7	7.8e-49
AVL19449.1|3287796_3288036_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	43.0	1.5e-05
3288050:3288064	attL	CGGCAAGCTGACGCT	NA	NA	NA	NA
AVL19450.1|3288118_3288349_+	hypothetical protein	NA	NA	NA	NA	NA
AVL19451.1|3288348_3288579_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	95.5	7.7e-31
AVL19452.1|3288565_3289012_+	hypothetical protein	NA	NA	NA	NA	NA
AVL19453.1|3289082_3290051_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	98.8	2.7e-85
AVL19454.1|3290058_3290343_+	hypothetical protein	NA	G8C7T1	Escherichia_phage	92.6	9.4e-47
AVL19455.1|3290361_3291207_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	61.6	9.6e-71
AVL19456.1|3291203_3291884_+	exonuclease	NA	M9NZE1	Enterobacteria_phage	98.7	1.6e-129
AVL19457.1|3292347_3292989_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	90.4	3.0e-109
AVL19458.1|3292972_3293575_+	hypothetical protein	NA	A0A142IF90	Pseudomonas_phage	42.3	4.8e-24
AVL19459.1|3293571_3294666_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	66.1	4.6e-142
AVL19460.1|3294662_3294881_+	hypothetical protein	NA	NA	NA	NA	NA
AVL19461.1|3295179_3295371_+	AlpA family transcriptional regulator	NA	A0A0P0ZBL0	Stx2-converting_phage	93.7	5.4e-30
AVL19462.1|3295351_3296530_-|integrase	integrase	integrase	K7P703	Enterobacteria_phage	93.6	4.9e-222
3305139:3305153	attR	AGCGTCAGCTTGCCG	NA	NA	NA	NA
>prophage 5
CP020089	Enterobacter cloacae strain PIMB10EC27 chromosome, complete genome	5272177	3320663	3328626	5272177		Enterobacteria_phage(50.0%)	8	NA	NA
AVL19484.1|3320663_3321773_-	aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.8	2.1e-33
AVL19485.1|3321782_3322193_-	dTDP-6-deoxy-3,4-keto-hexulose isomerase	NA	NA	NA	NA	NA
AVL19486.1|3322192_3322741_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	51.9	5.7e-48
AVL19487.1|3322780_3323587_-	amylovoran biosynthesis protein AmsE	NA	NA	NA	NA	NA
AVL19488.1|3323719_3324601_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	64.5	1.6e-108
AVL19489.1|3324653_3325553_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.0	1.6e-26
AVL19490.1|3325552_3326638_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.8	2.2e-99
AVL19491.1|3326739_3328626_-	nucleoside-diphosphate sugar epimerase	NA	L7Y3T9	Megavirus	27.9	5.7e-23
>prophage 6
CP020089	Enterobacter cloacae strain PIMB10EC27 chromosome, complete genome	5272177	3535608	3544691	5272177	holin	Pseudomonas_phage(33.33%)	7	NA	NA
AVL19661.1|3535608_3537894_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	64.0	1.0e-284
AVL19662.1|3538001_3539132_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	6.0e-177
AVL19663.1|3539131_3539386_+	2Fe-2S ferredoxin	NA	G9IAA2	Pseudomonas_phage	67.9	5.1e-28
AVL19664.1|3539505_3541197_+|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0S9J5	Catovirus	30.3	6.1e-24
AVL19665.1|3541090_3542647_+|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0SI18	Klosneuvirus	28.0	2.9e-36
AVL19666.1|3542678_3543608_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVL19667.1|3543632_3544691_-	glycerophosphoryl diester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	7.7e-09
>prophage 7
CP020089	Enterobacter cloacae strain PIMB10EC27 chromosome, complete genome	5272177	4176926	4232966	5272177	protease,tRNA,integrase,transposase	Bacillus_phage(16.67%)	52	4176805:4176832	4192411:4192438
4176805:4176832	attL	AGATCTGGAGCGGGCGAAGGGAATCGAA	NA	NA	NA	NA
AVL20242.1|4176926_4178177_+|integrase	integrase	integrase	NA	NA	NA	NA
AVL20243.1|4178456_4179128_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AVL20244.1|4179161_4179839_-	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	72.4	9.7e-74
AVL21335.1|4179839_4181624_-	hypothetical protein	NA	NA	NA	NA	NA
AVL21336.1|4181701_4181896_-	hypothetical protein	NA	NA	NA	NA	NA
AVL20245.1|4182024_4182807_-	hypothetical protein	NA	NA	NA	NA	NA
AVL20246.1|4183009_4183273_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AVL20247.1|4183299_4184130_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.3e-51
AVL20248.1|4184310_4184601_-	hypothetical protein	NA	NA	NA	NA	NA
AVL20249.1|4184665_4184863_-	hypothetical protein	NA	NA	NA	NA	NA
AVL20250.1|4185491_4185833_-	hypothetical protein	NA	NA	NA	NA	NA
AVL20251.1|4185837_4186074_-	hypothetical protein	NA	NA	NA	NA	NA
AVL20252.1|4186343_4186628_-	hypothetical protein	NA	NA	NA	NA	NA
AVL20253.1|4186641_4187955_-	hypothetical protein	NA	NA	NA	NA	NA
AVL20254.1|4189799_4190378_+|integrase	integrase	integrase	A0A0S2GLG4	Bacillus_phage	25.8	7.7e-11
AVL20255.1|4190424_4191807_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	34.4	1.6e-09
AVL20256.1|4192569_4193313_-	hypothetical protein	NA	A0A7K9	Microcystis_virus	37.0	2.2e-10
4192411:4192438	attR	AGATCTGGAGCGGGCGAAGGGAATCGAA	NA	NA	NA	NA
AVL20257.1|4193475_4194018_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AVL20258.1|4194065_4195583_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.3	1.0e-86
AVL20259.1|4195592_4196621_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	2.9e-05
AVL20260.1|4196781_4198515_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.1e-60
AVL20261.1|4198520_4199234_-	thiol:disulfide interchange protein DsbC	NA	NA	NA	NA	NA
AVL20262.1|4199262_4200159_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.2	2.5e-29
AVL20263.1|4200260_4200782_+	flavodoxin FldB	NA	NA	NA	NA	NA
AVL20264.1|4200788_4201202_-	hypothetical protein	NA	NA	NA	NA	NA
AVL20265.1|4201182_4201449_-	hypothetical protein	NA	NA	NA	NA	NA
AVL20266.1|4201743_4202724_+	folate-binding protein	NA	NA	NA	NA	NA
AVL20267.1|4202833_4203493_-	hemolysin III family protein	NA	NA	NA	NA	NA
AVL20268.1|4203758_4204490_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AVL20269.1|4204606_4206040_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.4	1.4e-29
AVL20270.1|4206109_4206853_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVL20271.1|4206925_4209799_-	glycine dehydrogenase (aminomethyl-transferring)	NA	M4QFZ1	Prochlorococcus_phage	51.3	1.3e-260
AVL20272.1|4210332_4211427_-	glycine cleavage system protein T	NA	NA	NA	NA	NA
AVL20273.1|4211824_4213027_-	FAD-dependent 2-octaprenylphenol hydroxylase	NA	NA	NA	NA	NA
AVL20274.1|4213039_4214218_-	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
AVL20275.1|4214214_4215534_-	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AVL20276.1|4215559_4216138_-	hypothetical protein	NA	NA	NA	NA	NA
AVL20277.1|4216306_4216636_+	Z-ring-associated protein	NA	NA	NA	NA	NA
AVL20278.1|4216884_4217481_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
AVL20279.1|4217577_4218810_-	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.9	4.1e-102
AVL20280.1|4219078_4219738_-	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
AVL20281.1|4219865_4220759_+	transcriptional regulator ArgP	NA	NA	NA	NA	NA
AVL20282.1|4220807_4221548_-	oxidative stress defense protein	NA	NA	NA	NA	NA
AVL20283.1|4221640_4222276_-	arginine transporter	NA	NA	NA	NA	NA
AVL20284.1|4222421_4223276_-	mechanosensitive ion channel protein MscS	NA	NA	NA	NA	NA
AVL20285.1|4223461_4224541_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AVL20286.1|4224632_4225796_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AVL20287.1|4225845_4226865_-	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AVL20288.1|4227191_4229183_-	transketolase	NA	NA	NA	NA	NA
AVL20289.1|4229455_4230214_+|protease	metalloprotease	protease	NA	NA	NA	NA
AVL20290.1|4230424_4231693_+	porin	NA	NA	NA	NA	NA
AVL20291.1|4231811_4232966_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 8
CP020089	Enterobacter cloacae strain PIMB10EC27 chromosome, complete genome	5272177	4336223	4355727	5272177	transposase	Stx2-converting_phage(42.86%)	16	NA	NA
AVL20391.1|4336223_4337300_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVL20392.1|4337221_4337422_-|transposase	transposase	transposase	NA	NA	NA	NA
AVL20393.1|4338540_4338843_+	hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	39.0	3.2e-08
AVL20394.1|4338839_4339190_+|transposase	transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	65.5	9.6e-41
AVL20395.1|4341012_4341327_-	copper-binding protein	NA	NA	NA	NA	NA
AVL20396.1|4342724_4343693_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	6.9e-182
AVL20397.1|4343987_4345013_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVL20398.1|4345220_4346546_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.1	6.5e-114
AVL20399.1|4347789_4348311_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AVL20400.1|4348307_4349261_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AVL20401.1|4349347_4351672_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AVL20402.1|4351716_4352619_+	iron-dicitrate transporter substrate-binding subunit	NA	NA	NA	NA	NA
AVL20403.1|4352615_4353614_+	iron-dicitrate transporter permease subunit	NA	NA	NA	NA	NA
AVL20404.1|4353610_4354567_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	5.3e-17
AVL20405.1|4354567_4355335_+	ferric citrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
AVL21338.1|4355433_4355727_+|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	95.9	4.7e-49
>prophage 1
CP020090	Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-1, complete sequence	62470	17353	47021	62470	transposase	Escherichia_phage(38.46%)	31	NA	NA
AVL21387.1|17353_20341_-|transposase	DDE transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.6	9.9e-296
AVL21388.1|20507_21143_+	resolvase	NA	NA	NA	NA	NA
AVL21433.1|21170_22007_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AVL21389.1|22072_22471_-	glyoxalase	NA	NA	NA	NA	NA
AVL21390.1|22512_23622_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.1	3.7e-30
AVL21391.1|23652_23928_-	regulator protein FrmR	NA	NA	NA	NA	NA
AVL21392.1|24765_25020_+	hypothetical protein	NA	NA	NA	NA	NA
AVL21393.1|25037_25313_+	hypothetical protein	NA	NA	NA	NA	NA
AVL21434.1|25375_25588_+	hypothetical protein	NA	NA	NA	NA	NA
AVL21394.1|25545_25731_+	hypothetical protein	NA	NA	NA	NA	NA
AVL21395.1|27395_30413_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
AVL21396.1|30804_31617_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
AVL21397.1|31620_31986_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
AVL21398.1|31990_32629_+	N-(5'-phosphoribosyl)anthranilate isomerase	NA	NA	NA	NA	NA
AVL21399.1|32639_33671_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
AVL21400.1|33675_34005_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
AVL21401.1|34198_34489_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
AVL21402.1|34544_36185_+	molecular chaperone GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
AVL21403.1|36373_37903_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVL21404.1|37863_38058_-	hypothetical protein	NA	NA	NA	NA	NA
AVL21405.1|38418_39123_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVL21406.1|39350_39584_-	hypothetical protein	NA	NA	NA	NA	NA
AVL21407.1|39574_40336_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AVL21408.1|40356_41217_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AVL21409.1|41180_41363_-	hypothetical protein	NA	NA	NA	NA	NA
AVL21410.1|42568_43273_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVL21411.1|43306_43663_-	sOS mutagenesis and repair protein UmuD	NA	A0A222YZE2	Escherichia_phage	46.6	5.5e-20
AVL21412.1|43665_43905_-	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
AVL21413.1|44006_45227_+|transposase	ISL3 family transposase ISKox3	transposase	NA	NA	NA	NA
AVL21435.1|45315_45978_-	resolvase	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
AVL21414.1|46358_47021_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
>prophage 1
CP020091	Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-2, complete sequence	84602	3686	79295	84602	transposase,integrase,tRNA	Escherichia_phage(36.0%)	65	41217:41276	75947:76767
AVL21442.1|3686_4517_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.2	3.4e-52
AVL21443.1|4543_4807_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AVL21444.1|5598_5931_+	hypothetical protein	NA	NA	NA	NA	NA
AVL21445.1|7873_8869_-|integrase	integrase	integrase	A0A1P8DJ76	Virus_Rctr85	38.7	3.9e-47
AVL21509.1|9115_9283_+	ABC transporter	NA	NA	NA	NA	NA
AVL21446.1|9321_10302_-|transposase	IS5/IS1182 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AVL21447.1|10793_11000_+	hypothetical protein	NA	NA	NA	NA	NA
AVL21448.1|11014_11710_+	hypothetical protein	NA	NA	NA	NA	NA
AVL21449.1|11750_11990_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
AVL21450.1|12196_12565_+	hypothetical protein	NA	NA	NA	NA	NA
AVL21451.1|13257_13893_-	fimbrial protein	NA	NA	NA	NA	NA
AVL21452.1|16197_16398_+|transposase	transposase	transposase	NA	NA	NA	NA
AVL21453.1|18116_18470_-	hypothetical protein	NA	NA	NA	NA	NA
AVL21454.1|19694_20879_-	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
AVL21455.1|20974_21676_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVL21456.1|22484_23126_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
AVL21457.1|23275_23776_-	hypothetical protein	NA	NA	NA	NA	NA
AVL21458.1|23855_24512_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	98.9	3.7e-110
AVL21459.1|24610_25315_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVL21460.1|27512_27920_+	hypothetical protein	NA	NA	NA	NA	NA
AVL21461.1|27934_28822_+	hypothetical protein	NA	NA	NA	NA	NA
AVL21510.1|29318_30314_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.3	2.0e-19
AVL21462.1|30447_32586_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AVL21463.1|32582_34367_+	ATP-dependent DNA helicase	NA	A7KV33	Bacillus_phage	26.8	9.6e-20
AVL21464.1|34874_35795_+	hypothetical protein	NA	NA	NA	NA	NA
AVL21465.1|35896_36373_-	hypothetical protein	NA	NA	NA	NA	NA
AVL21466.1|36965_37154_+	hypothetical protein	NA	NA	NA	NA	NA
AVL21467.1|37297_37486_+	hypothetical protein	NA	NA	NA	NA	NA
AVL21468.1|37969_38164_-	hypothetical protein	NA	NA	NA	NA	NA
AVL21469.1|38164_38920_-	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
AVL21470.1|39931_40123_-	plasmid stabilization protein	NA	NA	NA	NA	NA
AVL21471.1|40131_40518_-	hypothetical protein	NA	NA	NA	NA	NA
AVL21472.1|41063_41324_+	hypothetical protein	NA	NA	NA	NA	NA
41217:41276	attL	GGGCACTGTTGCAAAGTTAGCGATGAGGCAGCGTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
AVL21473.1|41269_41974_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVL21474.1|42227_43232_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVL21475.1|43413_43590_-|integrase	integrase	integrase	T1S9J3	Salmonella_phage	68.6	1.0e-06
AVL21476.1|44795_45599_+	APH(3'') family aminoglycoside O-phosphotransferase	NA	NA	NA	NA	NA
AVL21477.1|45589_46507_+	3'-kinase	NA	NA	NA	NA	NA
AVL21478.1|47100_47691_+	hypothetical protein	NA	NA	NA	NA	NA
AVL21479.1|47827_48400_+	resolvase	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
AVL21480.1|49849_50287_+	resolvase	NA	A0A219YB42	Aeromonas_phage	43.8	5.2e-20
AVL21481.1|50605_51262_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
AVL21482.1|52858_53716_-	class A beta-lactamase LAP-2	NA	Q1MVP3	Enterobacteria_phage	61.1	2.0e-92
AVL21511.1|53780_55511_-	cell division protein FtsI	NA	NA	NA	NA	NA
AVL21483.1|55919_56780_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVL21484.1|56962_57520_-|transposase	transposase	transposase	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AVL21485.1|59471_60176_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AVL21486.1|61272_62133_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AVL21487.1|62145_62688_+	tunicamycin resistance protein	NA	NA	NA	NA	NA
AVL21488.1|63169_63361_-	hypothetical protein	NA	NA	NA	NA	NA
AVL21489.1|63366_63612_+	hypothetical protein	NA	NA	NA	NA	NA
AVL21490.1|63662_64790_+	hypothetical protein	NA	NA	NA	NA	NA
AVL21491.1|68052_68757_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVL21512.1|68781_69294_+	restriction endonuclease	NA	NA	NA	NA	NA
AVL21492.1|69298_69505_+	hypothetical protein	NA	NA	NA	NA	NA
AVL21493.1|69886_71320_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AVL21494.1|71353_72562_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AVL21495.1|72574_72787_-	resolvase	NA	NA	NA	NA	NA
AVL21496.1|72828_73593_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AVL21497.1|73735_74002_-	mobilization protein	NA	NA	NA	NA	NA
AVL21498.1|74222_74705_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	6.6e-16
AVL21499.1|74851_75865_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVL21500.1|75999_76704_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVL21501.1|77049_77358_+	hypothetical protein	NA	NA	NA	NA	NA
75947:76767	attR	GGGCACTGTTGCAAAGTTAGCGATGAGGCAGCGTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
AVL21502.1|78143_79295_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.7	6.7e-99
