The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	96701	158168	5277316	integrase,tail,protease,capsid,portal,holin,terminase,lysis	Enterobacteria_phage(44.9%)	77	92517:92531	113456:113470
92517:92531	attL	AAACAAGAACACGGT	NA	NA	NA	NA
AVL28977.1|96701_97832_-|integrase	integrase	integrase	O21940	Phage_21	51.4	4.4e-103
AVL28978.1|97809_98058_-	excisionase	NA	NA	NA	NA	NA
AVL28979.1|98122_100594_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.2	1.8e-56
AVL28980.1|100686_100878_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVL28981.1|100874_101063_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AVL33814.1|101412_101628_+	hypothetical protein	NA	NA	NA	NA	NA
AVL28982.1|101557_101824_+	hypothetical protein	NA	NA	NA	NA	NA
AVL33815.1|101812_102151_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
AVL33816.1|102162_102315_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
AVL28983.1|102611_103031_-	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
AVL28984.1|103110_103365_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
AVL28985.1|103361_103787_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AVL33817.1|103809_104772_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
AVL28986.1|104812_105238_+	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	1.3e-63
AVL28987.1|105412_106078_+	hypothetical protein	NA	NA	NA	NA	NA
AVL28988.1|106258_106471_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
AVL28989.1|106512_106692_-	hypothetical protein	NA	NA	NA	NA	NA
AVL28990.1|106638_106911_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
AVL28991.1|106912_107959_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	5.9e-110
AVL28992.1|107971_108346_+	hypothetical protein	NA	V5URS4	Shigella_phage	63.6	5.8e-36
AVL28993.1|108342_109164_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
AVL28994.1|109390_109588_+	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	96.9	1.4e-28
AVL28995.1|109738_110788_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
AVL28996.1|111224_111551_+	hypothetical protein	NA	NA	NA	NA	NA
AVL28997.1|111998_112334_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
AVL28998.1|112594_114448_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	90.5	0.0e+00
113456:113470	attR	AAACAAGAACACGGT	NA	NA	NA	NA
AVL28999.1|114598_114814_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
AVL29000.1|114818_115625_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	94.8	3.3e-145
AVL29001.1|115667_116201_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	8.7e-102
AVL29002.1|116278_116491_+	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	60.5	2.7e-06
AVL33818.1|116755_116842_+	hypothetical protein	NA	NA	NA	NA	NA
AVL29003.1|116843_117311_+|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	81.5	2.6e-62
AVL29004.1|117298_117451_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	98.0	2.8e-21
AVL29005.1|117529_117817_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	58.9	4.0e-29
AVL29006.1|117910_118135_+	hypothetical protein	NA	NA	NA	NA	NA
AVL29007.1|118270_118675_+	hypothetical protein	NA	NA	NA	NA	NA
AVL33819.1|118802_118994_+	DNA-packaging protein	NA	NA	NA	NA	NA
AVL29008.1|119075_119624_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
AVL29009.1|119553_121524_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	1.6e-262
AVL29010.1|121507_121714_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AVL29011.1|121710_123303_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.8e-185
AVL29012.1|125237_126266_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	60.4	2.8e-112
AVL29013.1|126317_126686_+	hypothetical protein	NA	NA	NA	NA	NA
AVL29014.1|126678_127032_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	3.0e-42
AVL29015.1|127046_127622_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.3	9.2e-49
AVL29016.1|127618_128014_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AVL29017.1|128021_128774_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	6.7e-132
AVL29018.1|128787_129219_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
AVL29019.1|129245_129659_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
AVL29020.1|129639_132213_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.9	0.0e+00
AVL29021.1|132209_132539_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
AVL29022.1|132538_133237_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
AVL29023.1|133241_133985_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	1.8e-145
AVL29024.1|133882_134524_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.0	8.6e-96
AVL29025.1|134656_134842_-	hypothetical protein	NA	NA	NA	NA	NA
AVL29026.1|135002_138482_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
AVL29027.1|138548_139148_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
AVL29028.1|139299_142134_+|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	59.1	5.7e-83
AVL29029.1|142133_142718_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	1.7e-103
AVL29030.1|142690_142828_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AVL33820.1|142772_143399_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVL29031.1|143497_143767_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	77.8	2.7e-19
AVL29032.1|144540_145047_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AVL29033.1|145092_145593_-	YciE/YciF family protein	NA	NA	NA	NA	NA
AVL29034.1|145678_145858_-	hypothetical protein	NA	NA	NA	NA	NA
AVL29035.1|146238_147045_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AVL29036.1|147044_148238_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AVL33821.1|148249_149608_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
AVL29037.1|149611_151207_-	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AVL29038.1|151206_152769_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AVL33822.1|152860_152905_-	trp operon leader peptide	NA	NA	NA	NA	NA
AVL29039.1|153042_153924_+	phosphatase	NA	NA	NA	NA	NA
AVL29040.1|153920_154541_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AVL29041.1|154641_155514_+	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AVL29042.1|155553_156144_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AVL29043.1|156140_156899_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
AVL29044.1|157118_158168_+|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 2
CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	446016	512988	5277316	integrase,tail,capsid,portal,holin,terminase,lysis,bacteriocin	Escherichia_phage(43.42%)	84	488479:488496	516529:516546
AVL29302.1|446016_448443_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.3e-213
AVL33831.1|448503_450927_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.8e-209
AVL29303.1|450937_451051_+	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	72.0	2.1e-05
AVL29304.1|451458_452094_+	phage antirepressor Ant	NA	A0A088CBR4	Shigella_phage	81.0	2.8e-91
AVL29305.1|452141_452363_+	conjugal transfer protein TraR	NA	V5USD3	Shigella_phage	98.6	2.9e-35
AVL29306.1|452359_452644_+	DUF4752 domain-containing protein	NA	A0A088CD82	Shigella_phage	98.9	6.1e-46
AVL29307.1|452630_453467_+	hypothetical protein	NA	A0A2I6TD51	Escherichia_phage	87.7	6.1e-126
AVL33832.1|453696_453984_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	100.0	9.5e-55
AVL29308.1|453980_454484_+	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	98.2	2.6e-95
AVL29309.1|454485_454761_-	hypothetical protein	NA	A0A088CD78	Shigella_phage	89.3	4.0e-18
AVL29310.1|454884_463236_-	hypothetical protein	NA	Q08J70	Stx2-converting_phage	95.8	0.0e+00
AVL29311.1|463304_464570_-	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	95.0	1.5e-192
AVL29312.1|464580_464832_-|bacteriocin	bacteriocin	bacteriocin	A0A0P0ZDW9	Stx2-converting_phage	97.5	7.9e-13
AVL29313.1|464841_465288_-	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	100.0	4.0e-76
AVL29314.1|465290_465947_-	hypothetical protein	NA	A0A0H4IPM7	Shigella_phage	99.1	7.4e-103
AVL29315.1|466038_466440_-	hypothetical protein	NA	Q08J75	Stx2-converting_phage	98.5	5.0e-70
AVL29316.1|466496_466637_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	97.8	2.0e-18
AVL29317.1|466716_466941_+	hypothetical protein	NA	Q7Y2U2	Escherichia_phage	78.8	5.4e-21
AVL29318.1|466871_467609_-	hypothetical protein	NA	A0A2L1IV31	Escherichia_phage	80.8	1.2e-109
AVL29319.1|467688_468306_-	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	6.3e-120
AVL29320.1|468311_468590_-	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
AVL29321.1|468604_469873_-	host specificity protein J	NA	A0A0N7C124	Escherichia_phage	94.3	1.6e-218
AVL29322.1|469869_471495_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	96.7	0.0e+00
AVL29323.1|471835_472063_-	hypothetical protein	NA	A0A088CBQ7	Shigella_phage	98.7	2.6e-39
AVL29324.1|472075_472621_-	hypothetical protein	NA	A0A088CD67	Shigella_phage	99.4	2.0e-93
AVL29325.1|472703_474611_-|tail	phage tail protein	tail	V5USF3	Shigella_phage	66.0	4.2e-82
AVL29326.1|474607_475258_-	hypothetical protein	NA	A0A2L1IV63	Escherichia_phage	99.1	1.5e-119
AVL29327.1|475257_475821_-	hypothetical protein	NA	A0A2L1IV64	Escherichia_phage	99.5	8.3e-103
AVL29328.1|475804_476266_-	hypothetical protein	NA	A0A2L1IV43	Escherichia_phage	99.3	6.9e-71
AVL29329.1|476316_476706_-	hypothetical protein	NA	V5UT93	Shigella_phage	97.7	1.9e-61
AVL29330.1|476760_477975_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2L1IV46	Escherichia_phage	99.0	1.8e-232
AVL29331.1|477997_479005_-	hypothetical protein	NA	A0A2L1IV47	Escherichia_phage	93.4	1.2e-168
AVL29332.1|479162_481307_-|portal	portal protein	portal	A0A088CE71	Shigella_phage	99.6	0.0e+00
AVL29333.1|481306_483013_-|terminase	terminase	terminase	A0A2L1IV76	Escherichia_phage	99.1	0.0e+00
AVL29334.1|482993_483809_-|terminase	terminase	terminase	A0A2L1IV66	Escherichia_phage	99.6	6.6e-125
AVL33833.1|484411_484993_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	100.0	6.7e-47
AVL33834.1|485126_485312_-|lysis	lysis protein	lysis	A0A0P0ZDR7	Stx2-converting_phage	96.7	2.8e-23
AVL29335.1|485533_485647_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
AVL29336.1|485867_486401_-	lysozyme	NA	A0A088CC28	Shigella_phage	91.5	5.6e-93
AVL29337.1|486405_486621_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AVL29338.1|486697_486943_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	87.7	1.1e-14
AVL29339.1|486968_487151_-	DUF1378 domain-containing protein	NA	S5MBZ5	Escherichia_phage	91.7	1.6e-23
AVL29340.1|487289_489200_-	DUF1737 domain-containing protein	NA	A0A0N7CGH9	Escherichia_phage	74.8	6.4e-280
488479:488496	attL	AACAGCACATTTTTCGGG	NA	NA	NA	NA
AVL29341.1|489731_489977_+	hypothetical protein	NA	Q7Y2J1	Escherichia_phage	93.8	1.3e-31
AVL29342.1|489965_490400_-	antitermination protein	NA	G9L695	Escherichia_phage	98.6	2.4e-81
AVL29343.1|490392_490587_-	protein ninH	NA	A0A088CC23	Shigella_phage	100.0	1.4e-30
AVL29344.1|490586_490949_-	hypothetical protein	NA	A0A088CBJ1	Shigella_phage	98.3	9.2e-63
AVL29345.1|490945_491236_-	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	96.9	9.3e-50
AVL29346.1|491259_491451_-	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	87.7	8.9e-25
AVL29347.1|491447_491858_-	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	98.5	3.9e-70
AVL29348.1|491912_492584_-	hypothetical protein	NA	A0A088CD42	Shigella_phage	82.6	9.0e-96
AVL29349.1|493290_493608_+	transcriptional regulator	NA	NA	NA	NA	NA
AVL29350.1|493658_494144_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
AVL29351.1|494162_494342_-	hypothetical protein	NA	NA	NA	NA	NA
AVL29352.1|494551_494764_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	62.9	8.4e-16
AVL29353.1|494808_494964_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	81.1	4.2e-09
AVL29354.1|494952_495057_-	hypothetical protein	NA	NA	NA	NA	NA
AVL29355.1|495172_495757_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
AVL29356.1|495813_496209_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	52.9	2.0e-31
AVL29357.1|496224_496995_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	82.4	8.1e-109
AVL29358.1|497020_497761_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	87.4	2.3e-121
AVL29359.1|497767_498850_-	DNA-binding protein	NA	V5URT9	Shigella_phage	96.4	2.8e-200
AVL29360.1|498870_499089_-	hypothetical protein	NA	A0A088CC17	Shigella_phage	100.0	1.1e-21
AVL29361.1|499103_499400_-	hypothetical protein	NA	A0A088CBI6	Shigella_phage	98.0	3.4e-47
AVL29362.1|499538_499739_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	97.0	1.3e-29
AVL29363.1|499839_500553_+	LexA family transcriptional repressor	NA	A4KWV9	Enterobacteria_phage	99.6	4.1e-131
AVL29364.1|500599_501142_+	hypothetical protein	NA	NA	NA	NA	NA
AVL29365.1|501129_501906_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
AVL29366.1|502400_502784_+	antitermination protein	NA	G9L671	Escherichia_phage	99.2	6.7e-64
AVL29367.1|503195_503501_+	hypothetical protein	NA	A0A088CC14	Shigella_phage	98.0	2.5e-45
AVL29368.1|503532_503892_+	hypothetical protein	NA	A0A088CBI5	Shigella_phage	72.6	2.3e-37
AVL29369.1|503860_504070_-	hypothetical protein	NA	NA	NA	NA	NA
AVL29370.1|504526_504748_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	94.4	1.1e-34
AVL29371.1|504831_505218_+	hypothetical protein	NA	V5USC5	Shigella_phage	78.9	9.5e-50
AVL29372.1|505325_507398_+	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	87.4	0.0e+00
AVL29373.1|507394_507691_+	host-nuclease inhibitor protein Gam	NA	V5URU8	Shigella_phage	93.9	5.8e-47
AVL29374.1|507696_508482_+	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	97.3	9.4e-145
AVL29375.1|508478_509159_+	exonuclease	NA	A0A0P0ZBV6	Stx2-converting_phage	98.2	1.5e-130
AVL29376.1|509206_509458_+	DUF4222 domain-containing protein	NA	A0A088CBN9	Shigella_phage	100.0	1.3e-39
AVL29377.1|509492_509864_+	DNA-binding protein	NA	B9UDM0	Salmonella_phage	74.8	7.8e-41
AVL29378.1|509719_510883_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.7	3.8e-227
AVL29379.1|510920_511475_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	57.7	1.4e-62
AVL29380.1|511476_512331_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AVL29381.1|512373_512988_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
516529:516546	attR	AACAGCACATTTTTCGGG	NA	NA	NA	NA
>prophage 3
CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	640393	698973	5277316	integrase,tail,capsid,portal,tRNA,holin,terminase,transposase,plate	Enterobacteria_phage(79.17%)	74	636386:636402	688593:688609
636386:636402	attL	GAGCTGGCGCGCAAATT	NA	NA	NA	NA
AVL29503.1|640393_641143_-	vitamin B12 import ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
AVL29504.1|641142_641694_-	glutathione peroxidase	NA	NA	NA	NA	NA
AVL29505.1|641756_642737_-	vitamin B12 import system permease BtuC	NA	NA	NA	NA	NA
AVL29506.1|642926_643322_-	hypothetical protein	NA	NA	NA	NA	NA
AVL29507.1|643332_644268_-|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.5	4.8e-79
AVL29508.1|644356_644668_-	XRE family transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	8.8e-22
AVL29509.1|644759_645038_+	DNA-binding protein	NA	NA	NA	NA	NA
AVL29510.1|645052_645391_+	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	85.3	2.2e-50
AVL29511.1|645401_645689_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.9	2.7e-33
AVL29512.1|645700_645943_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AVL29513.1|646141_646462_+	hypothetical protein	NA	NA	NA	NA	NA
AVL29514.1|646451_646655_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	94.0	3.4e-30
AVL29515.1|646651_646897_+	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	87.7	8.4e-36
AVL29516.1|646893_647193_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	6.2e-41
AVL29517.1|647515_647746_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	93.4	5.0e-30
AVL29518.1|647818_648208_+	inositol monophosphatase	NA	NA	NA	NA	NA
AVL29519.1|648204_651045_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	89.4	0.0e+00
AVL29520.1|651121_652081_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.3e-180
AVL29521.1|652085_652400_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	3.5e-18
AVL29522.1|652419_652851_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	43.3	4.7e-21
AVL29523.1|652852_653116_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	1.1e-30
AVL33839.1|653138_653483_-	hypothetical protein	NA	NA	NA	NA	NA
AVL29524.1|653627_654674_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
AVL29525.1|654673_656425_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
AVL29526.1|656579_657416_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	1.8e-149
AVL29527.1|657439_658492_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
AVL29528.1|658537_659338_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
AVL29529.1|659439_659934_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
AVL29530.1|659933_660134_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
AVL29531.1|660136_660460_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
AVL29532.1|660456_660849_+	peptidase M15	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	6.4e-70
AVL29533.1|660845_661253_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	1.2e-63
AVL29534.1|661391_663272_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	81.0	3.8e-301
AVL29535.1|663295_663763_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	96.1	2.1e-83
AVL29536.1|663755_664391_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	5.3e-114
AVL29537.1|664387_664969_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.2e-101
AVL29538.1|664965_665316_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
AVL29539.1|665319_666216_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	5.7e-154
AVL29540.1|666208_666739_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
AVL29541.1|666741_668874_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.4	1.2e-130
AVL29542.1|668873_669452_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	7.7e-96
AVL33840.1|669495_669972_-	serine acetyltransferase	NA	NA	NA	NA	NA
AVL29543.1|670224_670719_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	5.2e-85
AVL29544.1|670725_673533_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.5	0.0e+00
AVL29545.1|673519_673756_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	1.9e-21
AVL29546.1|673683_674049_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.4e-55
AVL29547.1|674103_674616_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	2.7e-92
AVL29548.1|674615_675800_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	3.8e-222
AVL29549.1|675957_677067_+	late control protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.8	3.7e-195
AVL33841.1|677158_678241_-	hypothetical protein	NA	NA	NA	NA	NA
AVL29550.1|678585_679566_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
AVL29551.1|679759_680020_+	hypothetical protein	NA	NA	NA	NA	NA
AVL29552.1|680210_680351_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
AVL29553.1|680652_680952_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AVL29554.1|680956_683344_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AVL29555.1|683358_684342_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
AVL33842.1|684624_684669_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AVL29556.1|684791_685148_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVL29557.1|685200_685398_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVL29558.1|685494_686037_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
AVL29559.1|686040_687969_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	5.5e-130
AVL29560.1|688492_689608_+	enterotoxin	NA	NA	NA	NA	NA
688593:688609	attR	AATTTGCGCGCCAGCTC	NA	NA	NA	NA
AVL29561.1|689629_690391_+	hypothetical protein	NA	NA	NA	NA	NA
AVL29562.1|690566_690674_+	hypothetical protein	NA	NA	NA	NA	NA
AVL29563.1|690726_691485_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
AVL29564.1|691771_692701_+	6-phosphofructokinase II	NA	NA	NA	NA	NA
AVL29565.1|692801_693092_+	endoribonuclease GhoS	NA	NA	NA	NA	NA
AVL29566.1|693197_694058_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
AVL29567.1|694098_694635_-	hypothetical protein	NA	NA	NA	NA	NA
AVL29568.1|694781_695450_+	2-deoxyglucose-6-phosphate phosphatase	NA	NA	NA	NA	NA
AVL29569.1|695612_696203_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AVL29570.1|696335_697727_+	L-cystine transporter	NA	NA	NA	NA	NA
AVL33843.1|697730_697967_-	hypothetical protein	NA	NA	NA	NA	NA
AVL29571.1|697992_698973_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
>prophage 4
CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	800072	890120	5277316	head,integrase,tail,protease,capsid,portal,tRNA,terminase,lysis	Enterobacteria_phage(36.62%)	112	819945:819960	894162:894177
AVL29679.1|800072_800954_-|protease	protease HtpX	protease	NA	NA	NA	NA
AVL29680.1|801145_803194_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
AVL29681.1|803213_803912_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AVL29682.1|804008_804506_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AVL29683.1|804635_805919_+	paraquat-inducible membrane protein A	NA	NA	NA	NA	NA
AVL29684.1|805887_808521_+	MCE family protein	NA	NA	NA	NA	NA
AVL33847.1|808600_810040_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AVL29685.1|810157_810394_+	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
AVL33848.1|810498_810690_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVL29686.1|810690_811347_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
AVL29687.1|811742_812084_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AVL29688.1|812096_812969_-	copper resistance protein D	NA	NA	NA	NA	NA
AVL29689.1|812972_813347_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AVL29690.1|813485_813716_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
AVL29691.1|813817_814474_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AVL29692.1|814497_815160_+	DNA polymerase III subunit epsilon	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
AVL29693.1|815156_817217_-	oligopeptidase B	NA	NA	NA	NA	NA
AVL29694.1|817425_818085_-	DUF533 domain-containing protein	NA	NA	NA	NA	NA
AVL29695.1|818411_818768_-	protein YebF	NA	NA	NA	NA	NA
AVL29696.1|818834_819125_-	damage-inducible protein YebG	NA	NA	NA	NA	NA
AVL29697.1|819258_820437_+	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
819945:819960	attL	CTACCGTGAATCCTGG	NA	NA	NA	NA
AVL29698.1|820492_821134_-	KHG/KDPG aldolase	NA	NA	NA	NA	NA
AVL29699.1|821170_822982_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AVL29700.1|823216_824692_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
AVL29701.1|825029_825899_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AVL29702.1|826026_827469_+	pyruvate kinase	NA	NA	NA	NA	NA
AVL29703.1|827599_828571_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AVL29704.1|828690_830013_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
AVL33849.1|830028_830961_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVL29705.1|831039_831795_+	Mn2+/Zn2+ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
AVL29706.1|831791_832577_+	zinc ABC transporter permease	NA	NA	NA	NA	NA
AVL29707.1|832723_833734_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AVL29708.1|833742_834354_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AVL33850.1|834492_834558_-	hypothetical protein	NA	NA	NA	NA	NA
AVL29709.1|834628_835231_+	hypothetical protein	NA	NA	NA	NA	NA
AVL29710.1|835232_835754_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
AVL29711.1|835788_836529_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AVL29712.1|836557_837010_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AVL29713.1|837002_838775_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AVL29714.1|839084_839651_+	hydrolase	NA	NA	NA	NA	NA
AVL33851.1|839732_839849_-	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
AVL29715.1|840005_840254_+	damage-inducible protein DinI	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
AVL33852.1|840250_840346_-|capsid	capsid protein	capsid	NA	NA	NA	NA
AVL29716.1|840389_840650_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AVL33853.1|840792_841326_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	47.2	5.4e-35
AVL29717.1|841409_842948_-|tail	phage tail protein	tail	A0A2D1UII2	Escherichia_phage	92.2	8.8e-54
AVL29718.1|843099_843699_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
AVL29719.1|843766_847162_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.6	0.0e+00
AVL29720.1|847222_847894_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	3.1e-104
AVL29721.1|847791_848535_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
AVL29722.1|848539_849238_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
AVL29723.1|849237_849567_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	90.8	8.7e-52
AVL29724.1|849563_852176_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	87.1	0.0e+00
AVL29725.1|852156_852570_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.2	2.1e-42
AVL29726.1|852596_853019_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.1	1.1e-70
AVL29727.1|853032_853785_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.5e-133
AVL29728.1|853792_854188_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AVL29729.1|854184_854760_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	6.4e-50
AVL29730.1|854774_855128_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.1e-41
AVL29731.1|855120_855504_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
AVL29732.1|855555_856584_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.1e-113
AVL29733.1|856641_856989_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
AVL29734.1|857025_858531_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.3e-99
AVL29735.1|858520_860113_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	4.2e-184
AVL29736.1|860109_860316_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AVL29737.1|860299_862228_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	7.4e-260
AVL29738.1|862199_862748_-|terminase	phage terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
AVL29739.1|863142_863328_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
AVL29740.1|863460_863601_-	hypothetical protein	NA	NA	NA	NA	NA
AVL33854.1|863951_864419_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	83.8	1.5e-65
AVL29741.1|864567_864783_-	hypothetical protein	NA	NA	NA	NA	NA
AVL29742.1|864748_864964_+	hypothetical protein	NA	Q8VNN9	Enterobacteria_phage	88.5	7.2e-23
AVL29743.1|864906_865440_-	lysozyme	NA	Q08J98	Stx2-converting_phage	96.6	1.1e-101
AVL29744.1|865568_865883_+	hypothetical protein	NA	Q08J99	Stx2-converting_phage	100.0	4.7e-55
AVL33855.1|865892_866699_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	99.6	4.8e-152
AVL29745.1|867067_868921_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	90.6	0.0e+00
AVL29746.1|869712_870762_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	91.4	3.1e-188
AVL29747.1|870913_871117_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
AVL29748.1|871381_872308_+	hypothetical protein	NA	NA	NA	NA	NA
AVL29749.1|872294_872843_+	hypothetical protein	NA	NA	NA	NA	NA
AVL29750.1|872855_873197_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
AVL29751.1|873214_874204_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.4e-193
AVL29752.1|874211_875027_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.6	2.2e-149
AVL29753.1|875189_875585_-	hypothetical protein	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
AVL29754.1|875581_875908_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	2.7e-53
AVL29755.1|875904_876558_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
AVL29756.1|876557_877052_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	1.5e-84
AVL29757.1|877048_877867_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.1	2.8e-123
AVL29758.1|877863_878088_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	95.9	2.4e-37
AVL29759.1|878084_879230_-	peptidase	NA	A5LH69	Enterobacteria_phage	83.5	3.1e-173
AVL29760.1|879226_879784_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	94.1	5.3e-94
AVL29761.1|879776_880037_-	XRE family transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
AVL29762.1|880008_880161_-	amino acid permease	NA	NA	NA	NA	NA
AVL29763.1|880134_880827_+	XRE family transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	6.4e-121
AVL29764.1|880906_881161_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	97.4	2.7e-13
AVL29765.1|881262_881457_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	96.9	7.1e-30
AVL29766.1|881529_881892_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	94.2	7.5e-57
AVL29767.1|881957_882782_+	hypothetical protein	NA	K7PJQ6	Enterobacteria_phage	98.9	1.1e-148
AVL29768.1|882909_883446_+	HD family hydrolase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
AVL29769.1|883436_883799_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.5	6.8e-66
AVL29770.1|883795_883999_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
AVL29771.1|883991_884231_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	94.9	1.6e-34
AVL29772.1|884227_884776_+	hypothetical protein	NA	A0A1I9LJM5	Stx_converting_phage	97.5	1.4e-59
AVL33856.1|885005_885293_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	97.9	1.4e-53
AVL29773.1|885289_886048_+	dTDP-6-deoxy-L-hexose 3-O-methyltransferase	NA	A0A1U9AJ59	Stx1_converting_phage	82.0	2.7e-109
AVL29774.1|886132_886375_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
AVL29775.1|886378_886525_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	1.6e-21
AVL29776.1|886533_886770_+	excisionase	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
AVL29777.1|886825_888136_+|integrase	integrase	integrase	Q8W658	Enterobacteria_phage	95.4	3.0e-244
AVL29778.1|888117_888888_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
AVL29779.1|888940_889336_+	hypothetical protein	NA	NA	NA	NA	NA
AVL29780.1|889376_890120_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
894162:894177	attR	CCAGGATTCACGGTAG	NA	NA	NA	NA
>prophage 5
CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	1189050	1198492	5277316		Enterobacteria_phage(85.71%)	10	NA	NA
AVL30040.1|1189050_1190187_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
AVL30041.1|1190183_1192184_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
AVL30042.1|1192308_1192770_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AVL30043.1|1192810_1193281_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AVL30044.1|1193327_1194047_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVL30045.1|1194043_1195729_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AVL30046.1|1195950_1196682_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AVL30047.1|1196741_1196849_+	hypothetical protein	NA	NA	NA	NA	NA
AVL30048.1|1196829_1197561_-	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AVL30049.1|1197565_1198492_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 6
CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	1399220	1464252	5277316	head,integrase,tail,protease,capsid,portal,tRNA,terminase,transposase	Enterobacteria_phage(43.24%)	71	1429025:1429041	1466705:1466721
AVL30230.1|1399220_1400033_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AVL30231.1|1400032_1401046_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AVL30232.1|1401111_1402248_-	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	2.6e-23
AVL30233.1|1402346_1403342_+	flagella biosynthesis regulator	NA	NA	NA	NA	NA
AVL30234.1|1403338_1404517_-	MFS transporter	NA	NA	NA	NA	NA
AVL30235.1|1404458_1404680_+	hypothetical protein	NA	NA	NA	NA	NA
AVL30236.1|1404800_1406021_-	3-oxoacyl-ACP synthase I	NA	NA	NA	NA	NA
AVL30237.1|1406179_1408186_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AVL30238.1|1408306_1408585_-	YfcL family protein	NA	NA	NA	NA	NA
AVL30239.1|1408618_1409167_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AVL30240.1|1409166_1409976_-	hypothetical protein	NA	NA	NA	NA	NA
AVL30241.1|1409975_1410800_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AVL30242.1|1410803_1411889_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
AVL30243.1|1411923_1412856_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVL30244.1|1413021_1413573_+	endonuclease SmrB	NA	NA	NA	NA	NA
AVL30245.1|1413766_1414747_-|transposase	IS110 family transposase IS621	transposase	NA	NA	NA	NA
AVL30246.1|1414973_1415831_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
AVL30247.1|1415832_1416357_-	fimbrial protein	NA	NA	NA	NA	NA
AVL30248.1|1416353_1416824_-	fimbrial protein	NA	NA	NA	NA	NA
AVL30249.1|1416820_1417435_-	fimbrial protein	NA	NA	NA	NA	NA
AVL30250.1|1417343_1418096_-	fimbrial protein	NA	NA	NA	NA	NA
AVL30251.1|1418115_1420758_-	outer membrane usher protein	NA	NA	NA	NA	NA
AVL30252.1|1420839_1421403_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AVL30253.1|1422077_1422563_-	phosphohistidine phosphatase	NA	NA	NA	NA	NA
AVL30254.1|1422765_1424910_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AVL30255.1|1424909_1426220_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AVL30256.1|1426399_1426684_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
AVL30257.1|1426768_1427020_-	hypothetical protein	NA	NA	NA	NA	NA
AVL30258.1|1427055_1428396_+	long-chain fatty acid transporter	NA	NA	NA	NA	NA
AVL30259.1|1428761_1429820_+	hypothetical protein	NA	NA	NA	NA	NA
1429025:1429041	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
AVL30260.1|1430001_1430757_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AVL30261.1|1430782_1430953_-	hypothetical protein	NA	NA	NA	NA	NA
AVL30262.1|1431050_1431983_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
AVL30263.1|1432294_1433452_+|integrase	integrase	integrase	A5VW56	Enterobacteria_phage	100.0	5.3e-221
AVL30264.1|1433680_1435591_+	acyltransferase	NA	C6ZR20	Salmonella_phage	32.6	4.7e-57
AVL30265.1|1435661_1437641_-|tail	phage tail protein	tail	A5VW57	Enterobacteria_phage	93.5	6.2e-60
AVL30266.1|1437741_1438620_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	78.1	5.8e-95
AVL30267.1|1438852_1438993_-	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	56.8	7.5e-05
AVL30268.1|1439098_1439350_+	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	93.9	1.5e-35
AVL30269.1|1439346_1439661_+	hypothetical protein	NA	NA	NA	NA	NA
AVL30270.1|1439686_1440172_+	lipoprotein	NA	NA	NA	NA	NA
AVL30271.1|1440186_1442031_-	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	73.8	4.0e-247
AVL30272.1|1442030_1443497_-	acyltransferase	NA	B6SCW4	Bacteriophage	62.0	8.4e-139
AVL30273.1|1443506_1444199_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
AVL30274.1|1444201_1444657_-	hypothetical protein	NA	Q716G5	Shigella_phage	98.7	5.7e-86
AVL30275.1|1444656_1445505_-	hypothetical protein	NA	Q716G6	Shigella_phage	97.5	3.4e-100
AVL30276.1|1445504_1446923_-	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	98.9	3.9e-274
AVL30277.1|1446931_1447414_-	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	99.4	8.4e-88
AVL30278.1|1447388_1447574_-	hypothetical protein	NA	Q716G9	Shigella_phage	100.0	2.7e-26
AVL30279.1|1447616_1448888_-|head	head protein	head	Q9AYZ7	Salmonella_phage	99.5	1.2e-239
AVL30280.1|1448899_1449784_-|capsid	phage capsid protein	capsid	Q716H1	Shigella_phage	99.0	2.0e-143
AVL30281.1|1449797_1451924_-|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.0	0.0e+00
AVL30282.1|1451926_1453339_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	9.8e-278
AVL30283.1|1453335_1453776_-|terminase	terminase	terminase	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
AVL30284.1|1453778_1454021_-	DUF2560 domain-containing protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AVL30285.1|1455067_1455199_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
AVL30286.1|1455183_1455336_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
AVL30287.1|1455592_1456198_+	recombinase	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
AVL30288.1|1456197_1456581_+	hypothetical protein	NA	K7P7R8	Enterobacteria_phage	97.6	1.2e-65
AVL30289.1|1456604_1456901_+	RecBCD nuclease inhibitor	NA	A5VWB0	Enterobacteria_phage	99.0	3.9e-51
AVL30290.1|1456911_1457202_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	99.0	2.4e-45
AVL30291.1|1457198_1457366_+	DUF2737 domain-containing protein	NA	Q716F2	Shigella_phage	98.2	8.6e-24
AVL30292.1|1457362_1458034_+	hypothetical protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	73.2	3.0e-83
AVL30293.1|1458206_1458395_+	hypothetical protein	NA	Q286W7	Escherichia_phage	92.6	6.3e-23
AVL30294.1|1458396_1458606_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.2	1.3e-32
AVL30295.1|1458602_1459232_+	DUF550 domain-containing protein	NA	K7P7E3	Enterobacteria_phage	58.6	1.1e-55
AVL30296.1|1459328_1459508_+	Eag protein	NA	K7PL40	Enterobacteria_phage	100.0	2.5e-29
AVL30297.1|1459639_1459840_+	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AVL30298.1|1460369_1461617_-	MFS transporter	NA	NA	NA	NA	NA
AVL30299.1|1461688_1462603_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
AVL30300.1|1462818_1464252_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
1466705:1466721	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 7
CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	1824854	1831994	5277316		Escherichia_phage(83.33%)	6	NA	NA
AVL30623.1|1824854_1827416_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
AVL30624.1|1827521_1828178_+	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.8	1.5e-50
AVL30625.1|1828228_1828996_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AVL30626.1|1829191_1830100_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AVL30627.1|1830096_1831359_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AVL30628.1|1831355_1831994_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 8
CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	2084914	2123082	5277316	tRNA,integrase,protease,transposase	Pseudomonas_phage(18.18%)	29	2077022:2077036	2099342:2099356
2077022:2077036	attL	TCAATAATTCAAACA	NA	NA	NA	NA
AVL30858.1|2084914_2085634_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AVL30859.1|2085703_2085841_+	adenine glycosylase	NA	NA	NA	NA	NA
AVL30860.1|2085794_2086847_+	adenine DNA glycosylase	NA	NA	NA	NA	NA
AVL30861.1|2086874_2087150_+	Fe(2+)-trafficking protein	NA	NA	NA	NA	NA
AVL30862.1|2087214_2088294_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
AVL30863.1|2088495_2089752_+	nucleoside permease NupG	NA	NA	NA	NA	NA
AVL30864.1|2089801_2091937_-	ornithine decarboxylase	NA	NA	NA	NA	NA
AVL30865.1|2092016_2092220_-	hypothetical protein	NA	NA	NA	NA	NA
AVL30866.1|2092334_2093042_+	hypothetical protein	NA	NA	NA	NA	NA
AVL30867.1|2093420_2094683_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	6.9e-81
AVL30868.1|2095817_2096027_+	hypothetical protein	NA	NA	NA	NA	NA
AVL30869.1|2096180_2096396_-	hypothetical protein	NA	NA	NA	NA	NA
AVL30870.1|2096662_2097181_-	DUF2931 domain-containing protein	NA	NA	NA	NA	NA
AVL33898.1|2097183_2097366_-	hypothetical protein	NA	NA	NA	NA	NA
AVL30871.1|2097666_2100516_+	helicase SNF2	NA	A0A2H4J643	uncultured_Caudovirales_phage	39.6	2.2e-183
2099342:2099356	attR	TGTTTGAATTATTGA	NA	NA	NA	NA
AVL30872.1|2100541_2101522_+	ATP-binding protein	NA	A0A1B2RW50	Lymphocystis_disease_virus	30.2	4.2e-17
AVL30873.1|2101531_2103919_+|protease	serine protease	protease	NA	NA	NA	NA
AVL30874.1|2103928_2105557_+	site-specific DNA-methyltransferase	NA	A0A0K1LNZ9	Escherichia_phage	42.6	4.6e-85
AVL30875.1|2105559_2108430_+	restriction endonuclease subunit R	NA	NA	NA	NA	NA
AVL30876.1|2108518_2108812_+	hypothetical protein	NA	NA	NA	NA	NA
AVL30877.1|2108881_2109232_+	hypothetical protein	NA	Q716C1	Shigella_phage	98.9	1.8e-39
AVL30878.1|2109151_2110303_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	3.4e-42
AVL30879.1|2110725_2111157_-	hypothetical protein	NA	NA	NA	NA	NA
AVL30880.1|2111450_2112974_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
AVL33899.1|2113839_2114535_+	peptidase	NA	Q9LA58	Enterobacterial_phage	57.6	2.2e-65
AVL30881.1|2118786_2119224_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
AVL30882.1|2119600_2121214_+|transposase	IS66 family transposase ISEc43	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
AVL30883.1|2121546_2121909_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	62.5	6.4e-40
AVL30884.1|2121948_2123082_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 9
CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	2933212	2963298	5277316	tRNA,integrase,transposase	Escherichia_phage(27.27%)	26	2947476:2947505	2969350:2969379
AVL31658.1|2933212_2933902_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
AVL31659.1|2933907_2935989_+	DNA helicase RecG	NA	NA	NA	NA	NA
AVL31660.1|2936154_2937360_-	sodium/glutamate symport carrier protein	NA	NA	NA	NA	NA
AVL31661.1|2937639_2939031_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
AVL31662.1|2939151_2940861_+	AsmA family protein	NA	NA	NA	NA	NA
AVL31663.1|2940913_2943232_-	alpha-xylosidase	NA	NA	NA	NA	NA
AVL31664.1|2943241_2944624_-	inner membrane symporter YicJ	NA	NA	NA	NA	NA
AVL31665.1|2945310_2946495_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	69.9	3.4e-162
AVL31666.1|2947344_2947434_-	acetyltransferase	NA	NA	NA	NA	NA
2947476:2947505	attL	CTCAGAAAACGGAAAATAAAGCACGCTAAG	NA	NA	NA	NA
AVL31667.1|2947500_2950467_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AVL31668.1|2950469_2951030_-	DNA resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AVL31669.1|2951155_2951770_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AVL31670.1|2951708_2952722_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVL33933.1|2952879_2953353_+	trimethoprim-resistant dihydrofolate reductase DfrA7	NA	A0A1B2IBQ4	Erwinia_phage	32.0	8.4e-16
AVL31671.1|2953582_2953930_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVL31672.1|2953923_2954703_+	dihydropteroate synthase	NA	NA	NA	NA	NA
AVL31673.1|2954736_2955441_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVL31674.1|2955940_2956801_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVL31675.1|2956950_2957352_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVL31676.1|2957398_2958103_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVL31677.1|2958164_2958872_+	hypothetical protein	NA	NA	NA	NA	NA
AVL31678.1|2958858_2959710_+	replication protein	NA	NA	NA	NA	NA
AVL31679.1|2960017_2960833_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
AVL31680.1|2960893_2961697_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
AVL31681.1|2961696_2962533_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AVL31682.1|2962593_2963298_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
2969350:2969379	attR	CTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
>prophage 10
CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	3542005	3618605	5277316	protease,integrase,tRNA,transposase	Enterobacteria_phage(21.43%)	59	3550074:3550089	3590803:3590818
AVL32200.1|3542005_3543130_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.3e-199
AVL32201.1|3543707_3544920_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.3	6.0e-167
AVL32202.1|3544960_3546103_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVL32203.1|3546842_3547769_+	shiE	NA	NA	NA	NA	NA
AVL32204.1|3547718_3548912_-	MFS transporter	NA	NA	NA	NA	NA
AVL32205.1|3548984_3550772_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
3550074:3550089	attL	CTGTTTGCCCTGCGTG	NA	NA	NA	NA
AVL32206.1|3550772_3551720_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVL32207.1|3551719_3553462_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
AVL32208.1|3553458_3554796_+	lysine 6-monooxygenase	NA	NA	NA	NA	NA
AVL32209.1|3554717_3556997_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AVL32210.1|3557961_3559485_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
AVL32211.1|3559778_3560150_+	hypothetical protein	NA	NA	NA	NA	NA
AVL32212.1|3561155_3561581_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	4.4e-48
AVL32213.1|3565478_3566060_-	hypothetical protein	NA	NA	NA	NA	NA
AVL32214.1|3566106_3569964_-|protease	serine protease	protease	Q9LA58	Enterobacterial_phage	38.3	2.4e-225
AVL32215.1|3570143_3570335_+	hypothetical protein	NA	NA	NA	NA	NA
AVL32216.1|3570324_3571362_-	type IX secretion system membrane protein PorP/SprF	NA	NA	NA	NA	NA
AVL32217.1|3576039_3576303_+	hypothetical protein	NA	NA	NA	NA	NA
AVL32218.1|3576403_3577666_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	38.3	9.3e-78
AVL32219.1|3578045_3578621_-	transcriptional regulator	NA	NA	NA	NA	NA
AVL32220.1|3578657_3580355_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
AVL32221.1|3580330_3580669_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
AVL32222.1|3580784_3582086_-	C4-dicarboxylate transporter	NA	NA	NA	NA	NA
AVL32223.1|3582203_3583640_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
AVL32224.1|3583976_3584453_+	membrane protein FxsA	NA	NA	NA	NA	NA
AVL32225.1|3584468_3585725_-	amino acid permease	NA	NA	NA	NA	NA
AVL32226.1|3586000_3586294_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
AVL32227.1|3586337_3587984_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
AVL32228.1|3588121_3588475_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
AVL32229.1|3588677_3589547_-	hypothetical protein	NA	NA	NA	NA	NA
AVL32230.1|3589936_3590965_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
3590803:3590818	attR	CACGCAGGGCAAACAG	NA	NA	NA	NA
AVL32231.1|3591006_3591573_+	elongation factor P	NA	NA	NA	NA	NA
AVL32232.1|3591624_3591750_+	entericidin A	NA	NA	NA	NA	NA
AVL32233.1|3591860_3592007_+	entericidin B	NA	NA	NA	NA	NA
AVL32234.1|3592181_3592499_+	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
AVL32235.1|3592495_3593029_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
AVL32236.1|3593117_3594251_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
AVL32237.1|3594313_3594673_-	fumarate reductase subunit D	NA	NA	NA	NA	NA
AVL32238.1|3594683_3595079_-	fumarate reductase subunit C	NA	NA	NA	NA	NA
AVL32239.1|3595089_3595824_-	fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AVL32240.1|3595816_3597625_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
AVL32241.1|3597949_3598927_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
AVL32242.1|3599145_3600648_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
AVL32243.1|3600699_3601014_+	hypothetical protein	NA	NA	NA	NA	NA
AVL32244.1|3601010_3601325_+	hypothetical protein	NA	NA	NA	NA	NA
AVL32245.1|3601353_3604677_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
AVL32246.1|3604698_3605667_-	phosphatidylserine decarboxylase proenzyme	NA	NA	NA	NA	NA
AVL32247.1|3605763_3606816_-	ribosome small subunit-dependent GTPase	NA	NA	NA	NA	NA
AVL32248.1|3606910_3607456_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
AVL33961.1|3608198_3608252_+	hypothetical protein	NA	NA	NA	NA	NA
AVL32249.1|3608234_3609374_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
AVL32250.1|3609372_3610920_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AVL32251.1|3610891_3611353_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
AVL32252.1|3611371_3612709_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
AVL32253.1|3612718_3614566_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.6	2.6e-60
AVL32254.1|3614558_3615509_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AVL32255.1|3615594_3615903_+	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AVL32256.1|3615979_3617260_+	GTPase HflX	NA	NA	NA	NA	NA
AVL32257.1|3617345_3618605_+|protease	protease modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 11
CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	4059267	4121590	5277316	protease,transposase,tRNA,plate	Emiliania_huxleyi_virus(12.5%)	53	NA	NA
AVL32667.1|4059267_4060620_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
AVL32668.1|4060649_4063082_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AVL32669.1|4063203_4063689_+	chaperone protein Skp	NA	NA	NA	NA	NA
AVL32670.1|4063692_4064718_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AVL32671.1|4064822_4065278_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AVL32672.1|4065281_4066070_+	acyl-[acyl-carrier-protein]--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AVL32673.1|4066069_4067218_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AVL32674.1|4067214_4067811_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
AVL32675.1|4067847_4071330_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
AVL32676.1|4071342_4072302_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AVL32677.1|4072400_4074542_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
AVL32678.1|4074598_4074988_+	VOC family protein	NA	NA	NA	NA	NA
AVL32679.1|4075052_4076351_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
AVL33982.1|4076399_4076654_-	protein rof	NA	NA	NA	NA	NA
AVL32680.1|4076646_4076847_-	hypothetical protein	NA	NA	NA	NA	NA
AVL32681.1|4077012_4077558_+	hypothetical protein	NA	NA	NA	NA	NA
AVL32682.1|4077554_4077977_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AVL32683.1|4077990_4078701_+	copper homeostasis/adhesion lipoprotein NlpE	NA	NA	NA	NA	NA
AVL32684.1|4078707_4078959_-	hypothetical protein	NA	NA	NA	NA	NA
AVL32685.1|4078950_4079931_+|transposase	IS110 family transposase IS621	transposase	NA	NA	NA	NA
AVL32686.1|4081010_4082729_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AVL32687.1|4082840_4083548_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AVL32688.1|4083544_4083949_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
AVL32689.1|4084066_4084882_-	methionine ABC transporter substrate-binding protein MetQ	NA	NA	NA	NA	NA
AVL32690.1|4084921_4085575_-	methionine ABC transporter	NA	NA	NA	NA	NA
AVL32691.1|4085567_4086599_-	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
AVL32692.1|4086786_4087359_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AVL32693.1|4093253_4094057_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
AVL32694.1|4094053_4094968_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVL32695.1|4095208_4096009_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AVL32696.1|4096086_4096857_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVL32697.1|4096904_4098263_-	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AVL32698.1|4098334_4099090_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AVL32699.1|4099123_4099846_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVL32700.1|4099842_4100310_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AVL33983.1|4100374_4101106_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
AVL32701.1|4101045_4101225_-	hypothetical protein	NA	NA	NA	NA	NA
AVL32702.1|4101641_4102427_+	aminopeptidase	NA	NA	NA	NA	NA
AVL32703.1|4102563_4103043_-	hypothetical protein	NA	NA	NA	NA	NA
AVL32704.1|4103052_4103967_-	hypothetical protein	NA	NA	NA	NA	NA
AVL32705.1|4104010_4104493_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AVL32706.1|4104516_4105869_-	hypothetical protein	NA	NA	NA	NA	NA
AVL33984.1|4105879_4109344_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AVL32707.1|4109422_4110838_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AVL32708.1|4110842_4111586_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AVL32709.1|4111582_4114342_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	9.4e-83
AVL32710.1|4114350_4115112_-	hypothetical protein	NA	NA	NA	NA	NA
AVL32711.1|4115116_4116448_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVL32712.1|4116450_4116975_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AVL32713.1|4116971_4118252_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AVL32714.1|4118276_4119359_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVL32715.1|4119322_4121173_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVL32716.1|4121176_4121590_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 12
CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	4689659	4732093	5277316	head,integrase,tail,capsid,portal,terminase,lysis	Enterobacteria_phage(57.69%)	60	4687937:4687952	4711088:4711103
4687937:4687952	attL	CTGACTGCTGAAGAGC	NA	NA	NA	NA
AVL33238.1|4689659_4690730_-|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
AVL33239.1|4690707_4690926_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AVL33240.1|4690965_4691133_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
AVL34001.1|4691065_4691251_+	hypothetical protein	NA	NA	NA	NA	NA
AVL33241.1|4691305_4691557_+	hypothetical protein	NA	NA	NA	NA	NA
AVL33242.1|4691447_4691978_+	hypothetical protein	NA	NA	NA	NA	NA
AVL33243.1|4692188_4692410_-	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
AVL33244.1|4692508_4692790_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
AVL33245.1|4692800_4692992_-	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	4.7e-26
AVL33246.1|4692964_4693147_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
AVL33247.1|4693143_4693824_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
AVL33248.1|4693820_4694606_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AVL33249.1|4694611_4694908_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
AVL33250.1|4694983_4695190_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AVL33251.1|4695787_4696540_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AVL33252.1|4696582_4696813_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AVL33253.1|4696882_4697422_+	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
AVL33254.1|4697418_4698438_+	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	63.4	9.7e-110
AVL33255.1|4698434_4699136_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
AVL33256.1|4699132_4699435_+	protein ren	NA	M1FPD5	Enterobacteria_phage	97.8	6.1e-44
AVL33257.1|4699680_4700475_+	recombinase	NA	A0A2K9V406	Faecalibacterium_phage	28.9	7.5e-09
AVL33258.1|4700586_4700826_+	hypothetical protein	NA	NA	NA	NA	NA
AVL33259.1|4701144_4701654_+	hypothetical protein	NA	NA	NA	NA	NA
AVL33260.1|4701750_4701852_+	hypothetical protein	NA	NA	NA	NA	NA
AVL33261.1|4701848_4702304_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
AVL33262.1|4702303_4702474_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
AVL33263.1|4702466_4702757_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
AVL33264.1|4703111_4703252_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
AVL33265.1|4703337_4703721_+	antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
AVL33266.1|4703909_4704992_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
AVL33267.1|4705580_4705796_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AVL33268.1|4705795_4706293_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	3.2e-90
AVL33269.1|4706289_4706727_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	94.5	3.0e-68
AVL33270.1|4706931_4707453_+	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
AVL33271.1|4707592_4707757_-	hypothetical protein	NA	NA	NA	NA	NA
AVL33272.1|4707802_4708213_-	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
AVL33273.1|4708269_4708503_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
AVL34002.1|4708608_4708752_+	DNA-packaging protein	NA	NA	NA	NA	NA
AVL33274.1|4708891_4709437_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
AVL33275.1|4711332_4711539_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
4711088:4711103	attR	CTGACTGCTGAAGAGC	NA	NA	NA	NA
AVL33276.1|4711535_4713137_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.2e-311
AVL33277.1|4713117_4714437_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.4e-230
AVL33278.1|4714446_4714779_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
AVL33279.1|4714834_4715860_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
AVL33280.1|4715901_4716297_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
AVL33281.1|4716308_4716662_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
AVL33282.1|4716673_4717252_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
AVL33283.1|4717248_4717644_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
AVL34003.1|4717651_4718392_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	6.8e-129
AVL33284.1|4718407_4718830_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.0	1.4e-59
AVL33285.1|4718811_4719246_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AVL33286.1|4719238_4721800_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.8	0.0e+00
AVL33287.1|4721796_4722126_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
AVL33288.1|4722125_4722824_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	4.7e-132
AVL33289.1|4722829_4723573_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.1e-146
AVL33290.1|4723470_4724142_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	8.1e-105
AVL33291.1|4724202_4727700_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.6	0.0e+00
AVL33292.1|4727770_4728370_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
AVL34004.1|4728434_4731509_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
AVL33293.1|4731508_4732093_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	9.2e-105
>prophage 13
CP027394	Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome	5277316	4997011	5060389	5277316	integrase,tail,capsid,portal,holin,terminase,lysis,bacteriocin	Escherichia_phage(93.42%)	78	4994536:4994551	5030533:5030548
4994536:4994551	attL	CTGAACTTTTTGCTCA	NA	NA	NA	NA
AVL33525.1|4997011_4998322_-|integrase	site-specific integrase	integrase	A0A0P0ZGA8	Escherichia_phage	100.0	9.2e-254
AVL33526.1|4998374_4998659_-	DNA-binding protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
AVL33527.1|4998704_4998956_-	DUF4222 domain-containing protein	NA	G9L6F5	Escherichia_phage	100.0	8.4e-39
AVL33528.1|4998943_4999177_-	hypothetical protein	NA	G9L6F6	Escherichia_phage	100.0	1.4e-35
AVL33529.1|4999320_4999674_-	hypothetical protein	NA	A0A0P0ZH73	Escherichia_phage	100.0	3.5e-59
AVL33530.1|4999709_4999922_-	hypothetical protein	NA	A0A0P0ZG72	Escherichia_phage	100.0	2.7e-30
AVL33531.1|4999881_5000508_-	adenine methylase	NA	A0A0P0ZG10	Escherichia_phage	100.0	8.0e-123
AVL33532.1|5000504_5000936_-	regulator	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
AVL33533.1|5000991_5001630_-	phage antirepressor Ant	NA	A0A0P0ZG08	Escherichia_phage	100.0	4.2e-119
AVL33534.1|5001985_5002882_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	100.0	5.4e-173
AVL33535.1|5002884_5003076_-	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
AVL33536.1|5003077_5003485_-	hypothetical protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
AVL33537.1|5003481_5004207_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	100.0	3.3e-128
AVL33538.1|5004357_5004753_-	hypothetical protein	NA	A0A0P0ZG44	Escherichia_phage	100.0	1.1e-69
AVL33539.1|5004829_5005651_-	DUF2303 domain-containing protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
AVL33540.1|5005714_5006062_-	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
AVL33541.1|5006136_5006724_-	DUF669 domain-containing protein	NA	A0A0N7KZV4	Escherichia_phage	100.0	1.2e-107
AVL33542.1|5006723_5007413_-	exonuclease	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
AVL33543.1|5007409_5008360_-	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
AVL33544.1|5008376_5008658_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
AVL33545.1|5008678_5008960_-	AbrB family transcriptional regulator	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
AVL33546.1|5008971_5009184_-	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
AVL33547.1|5009254_5009929_-	hypothetical protein	NA	A0A0P0ZGP9	Escherichia_phage	100.0	1.3e-123
AVL33548.1|5010084_5010279_+	hypothetical protein	NA	A0A0N7KZV5	Escherichia_phage	100.0	1.3e-31
AVL34014.1|5010184_5010832_-	hypothetical protein	NA	A0A0P0ZG86	Escherichia_phage	100.0	4.3e-119
AVL33549.1|5011586_5012540_-	restriction endonuclease	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
AVL33550.1|5012536_5014006_-	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
AVL33551.1|5014100_5014814_-	LexA family transcriptional repressor	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
AVL33552.1|5014909_5015113_+	Cro/Cl family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
AVL33553.1|5015283_5015478_+	hypothetical protein	NA	NA	NA	NA	NA
AVL33554.1|5015644_5016022_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
AVL33555.1|5016015_5017536_+	ATP-dependent helicase	NA	A0A0N7KZV6	Escherichia_phage	100.0	1.4e-306
AVL33556.1|5017525_5018497_+	DNA primase	NA	A0A0P0ZFY3	Escherichia_phage	100.0	6.5e-196
AVL33557.1|5018496_5018946_+	DUF1367 domain-containing protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
AVL33558.1|5018953_5019517_+	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
AVL33559.1|5019513_5019708_+	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
AVL33560.1|5019700_5020135_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
AVL33561.1|5020123_5020369_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
AVL33562.1|5020383_5020536_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
AVL33563.1|5020918_5021878_+	Shiga toxin Stx2 subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
AVL33564.1|5021889_5022159_+	Shiga toxin Stx2 subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
AVL33565.1|5022644_5024582_+	DUF1737 domain-containing protein	NA	A0A0P0ZGE0	Escherichia_phage	100.0	0.0e+00
AVL33566.1|5024718_5024898_+	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AVL33567.1|5024938_5025184_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
AVL33568.1|5025261_5025477_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
AVL33569.1|5025481_5026015_+	lysozyme	NA	A0A0P0ZGA2	Escherichia_phage	100.0	5.1e-102
AVL33570.1|5026288_5026858_+	hypothetical protein	NA	A0A0N7KZV8	Escherichia_phage	100.0	1.8e-105
AVL33571.1|5027018_5027447_+|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	100.0	1.9e-70
AVL33572.1|5027649_5028201_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
AVL33573.1|5028493_5029300_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
AVL33574.1|5029280_5030987_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
5030533:5030548	attR	CTGAACTTTTTGCTCA	NA	NA	NA	NA
AVL33575.1|5030986_5033131_+|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	100.0	0.0e+00
AVL33576.1|5033288_5034296_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
AVL33577.1|5034319_5035534_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
AVL33578.1|5035589_5035979_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
AVL33579.1|5036028_5036490_+	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	100.0	6.0e-75
AVL33580.1|5036473_5037037_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
AVL33581.1|5037036_5037687_+	hypothetical protein	NA	A0A0P0ZGL1	Escherichia_phage	100.0	4.6e-121
AVL33582.1|5037683_5039876_+|tail	phage tail protein	tail	A0A0H4IU95	Shigella_phage	98.0	1.9e-86
AVL33583.1|5039962_5040475_+	hypothetical protein	NA	A0A0P0ZFL3	Escherichia_phage	100.0	1.2e-92
AVL34015.1|5040708_5042334_+	hypothetical protein	NA	A0A0P0ZG21	Escherichia_phage	100.0	0.0e+00
AVL33584.1|5042330_5043599_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
AVL33585.1|5043613_5043892_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
AVL33586.1|5043897_5044515_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	99.5	3.3e-121
AVL33587.1|5044605_5045340_+	outer membrane protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
AVL33588.1|5045270_5045516_-	hypothetical protein	NA	Q7Y2U2	Escherichia_phage	98.8	6.2e-39
AVL33589.1|5045572_5045713_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
AVL33590.1|5045769_5046171_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
AVL33591.1|5046264_5046921_+	hypothetical protein	NA	A0A0P0ZGB7	Escherichia_phage	100.0	2.4e-109
AVL33592.1|5046923_5047370_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
AVL33593.1|5047379_5047631_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
AVL33594.1|5047641_5048907_+	hypothetical protein	NA	A0A0P0ZFI5	Escherichia_phage	100.0	2.4e-206
AVL33595.1|5048976_5057358_+	hypothetical protein	NA	A0A0P0ZFK4	Escherichia_phage	100.0	0.0e+00
AVL33596.1|5057695_5057923_+	hypothetical protein	NA	Q7Y2P9	Escherichia_phage	92.7	2.0e-23
AVL33597.1|5058126_5058357_+	hypothetical protein	NA	NA	NA	NA	NA
AVL33598.1|5058289_5058463_+	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
AVL33599.1|5058545_5059874_-	transporter	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
AVL33600.1|5059894_5060389_-	FMN reductase	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
>prophage 1
CP027395	Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed1	117229	53039	63337	117229	transposase	Salmonella_phage(22.22%)	12	NA	NA
AVL34077.1|53039_53915_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AVL34078.1|54170_55433_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AVL34079.1|55996_56554_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AVL34080.1|56736_57597_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVL34140.1|57865_58045_-	Par-like protein	NA	NA	NA	NA	NA
AVL34081.1|58164_58791_-	cobyrinic acid ac-diamide synthase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
AVL34082.1|58994_60266_-	protein ImpB	NA	F1C5A5	Cronobacter_phage	60.4	2.2e-143
AVL34083.1|60265_60703_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
AVL34142.1|60699_60948_-	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
AVL34143.1|61059_61329_+	hypothetical protein	NA	NA	NA	NA	NA
AVL34084.1|61297_62269_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AVL34085.1|62653_63337_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	5.1e-30
>prophage 1
CP027392	Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed2, complete sequence	75562	0	67624	75562	integrase,protease,transposase	Stx2-converting_phage(21.43%)	62	46333:46347	65463:65477
AVL28814.1|1387_1888_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	28.2	2.4e-08
AVL28815.1|2323_3352_+	hypothetical protein	NA	NA	NA	NA	NA
AVL28816.1|3355_3895_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AVL28817.1|4709_5690_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	3.4e-184
AVL28818.1|7623_8421_-	transcriptional activator AggR	NA	NA	NA	NA	NA
AVL28819.1|9886_10258_-	hypothetical protein	NA	NA	NA	NA	NA
AVL28820.1|10551_10707_+	reverse transcriptase	NA	NA	NA	NA	NA
AVL28821.1|13950_14175_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	6.4e-06
AVL28822.1|14221_14554_+	hypothetical protein	NA	NA	NA	NA	NA
AVL28823.1|14895_15876_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
AVL28824.1|16468_16669_+	hypothetical protein	NA	NA	NA	NA	NA
AVL28825.1|18190_18838_+|protease	serine protease	protease	Q9LA58	Enterobacterial_phage	43.1	6.1e-33
AVL28826.1|18809_19985_+|protease	serine protease	protease	Q9LA58	Enterobacterial_phage	46.8	4.2e-72
AVL28827.1|19956_20193_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	63.8	2.0e-18
AVL28828.1|20249_20342_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
AVL28875.1|20335_20584_-|transposase	IS3 family transposase	transposase	A0A0N7BVE9	Escherichia_phage	82.4	1.2e-24
AVL28829.1|20963_22094_+	permease	NA	NA	NA	NA	NA
AVL28830.1|22090_23329_+	hypothetical protein	NA	NA	NA	NA	NA
AVL28831.1|23408_24047_+	hypothetical protein	NA	NA	NA	NA	NA
AVL28832.1|24039_24669_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.4	1.2e-20
AVL28833.1|24685_25897_+	acyltransferase	NA	NA	NA	NA	NA
AVL28834.1|26871_28005_+|transposase	IS110 family transposase ISEc45	transposase	NA	NA	NA	NA
AVL28835.1|28114_29683_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.9	5.6e-141
AVL28836.1|29713_30064_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	3.6e-40
AVL28837.1|30060_30498_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	3.4e-19
AVL28838.1|31088_34142_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	43.8	3.1e-220
AVL28839.1|34333_35182_-	hypothetical protein	NA	Q9LA58	Enterobacterial_phage	38.7	5.2e-40
AVL28840.1|36725_37556_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	37.5	2.2e-43
AVL28876.1|37873_38476_-	lytic transglycosylase	NA	NA	NA	NA	NA
AVL28841.1|38806_39190_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
AVL28842.1|45123_45261_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
AVL28843.1|45280_46027_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
AVL28844.1|46081_46642_+	conjugal transfer protein	NA	NA	NA	NA	NA
46333:46347	attL	GCCGGGATTATTTGA	NA	NA	NA	NA
AVL28845.1|47300_47597_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	64.4	3.4e-31
AVL28846.1|47909_49481_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.2e-169
AVL28847.1|49500_49848_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AVL28848.1|49847_50525_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AVL28877.1|51092_51215_+	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	92.5	9.0e-15
AVL28849.1|51252_52233_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
AVL28850.1|52513_52768_+	replication protein	NA	NA	NA	NA	NA
AVL28851.1|52811_52922_-	replication protein RepA	NA	NA	NA	NA	NA
AVL28878.1|53005_53080_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
AVL28852.1|54468_54600_-	replication protein RepA4	NA	NA	NA	NA	NA
AVL28853.1|54808_55093_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AVL28854.1|55092_55368_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AVL28855.1|55820_55982_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AVL28879.1|56104_56230_+	transcriptional regulator	NA	NA	NA	NA	NA
AVL28856.1|56350_57091_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
AVL28857.1|57369_58347_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	8.8e-100
AVL28858.1|58656_59145_-	hypothetical protein	NA	NA	NA	NA	NA
AVL28880.1|59670_60072_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AVL28859.1|60095_60326_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AVL28860.1|60920_61139_+	plasmid maintenance protein CcdA	NA	NA	NA	NA	NA
AVL28861.1|61140_61446_+	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AVL28862.1|61446_62253_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	93.9	2.7e-54
AVL28863.1|62431_63076_+	ParA family protein	NA	NA	NA	NA	NA
AVL28864.1|63162_63471_+	molecular chaperone GroEL	NA	NA	NA	NA	NA
AVL28865.1|63884_64865_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	2.2e-79
AVL28866.1|64857_65274_+	recombinase	NA	NA	NA	NA	NA
AVL28881.1|65275_65347_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
AVL28867.1|66548_66926_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	47.2	6.1e-25
65463:65477	attR	TCAAATAATCCCGGC	NA	NA	NA	NA
AVL28882.1|67057_67624_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	45.6	4.8e-34
>prophage 2
CP027392	Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed2, complete sequence	75562	73621	74346	75562		Stx2-converting_phage(100.0%)	2	NA	NA
AVL28883.1|73621_74002_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	2.7e-65
AVL28874.1|73998_74346_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
