The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	0	6717	2511315		Pandoravirus(100.0%)	6	NA	NA
AVL69960.1|819_954_-	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
AVL69961.1|968_2123_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AVL69962.1|2137_3721_-	cytochrome d terminal oxidase subunit 1	NA	NA	NA	NA	NA
AVL69963.1|3870_4209_-	hypothetical protein	NA	NA	NA	NA	NA
AVL69964.1|4374_5265_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AVL69965.1|5439_6717_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	26.1	6.2e-13
>prophage 2
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	37359	38295	2511315		Streptococcus_phage(100.0%)	1	NA	NA
AVL69998.1|37359_38295_-	modification methylase	NA	A0A1S5PRR3	Streptococcus_phage	40.1	1.0e-44
>prophage 3
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	65968	75888	2511315		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
AVL70019.1|65968_68944_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	51.4	4.9e-279
AVL70020.1|69146_70337_+	MFS transporter	NA	NA	NA	NA	NA
AVL70021.1|70426_70996_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	59.2	6.6e-31
AVL70022.1|71124_72099_+	Fe(3+) ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVL70023.1|72179_73889_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AVL70024.1|73876_74929_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.0	1.1e-28
AVL70025.1|75333_75888_+	DUF924 domain-containing protein	NA	E3T4R4	Cafeteria_roenbergensis_virus	29.9	1.3e-10
>prophage 4
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	82711	83542	2511315		Enterobacteria_phage(100.0%)	1	NA	NA
AVL70032.1|82711_83542_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.2	1.3e-27
>prophage 5
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	86557	89367	2511315		Enterobacteria_phage(66.67%)	3	NA	NA
AVL70036.1|86557_87604_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.3	4.8e-80
AVL70037.1|87578_88115_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.9	5.4e-43
AVL70038.1|88197_89367_+	nucleotide sugar dehydrogenase	NA	M1IAF7	Acanthocystis_turfacea_Chlorella_virus	48.7	2.2e-105
>prophage 6
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	93023	93863	2511315		Bacillus_phage(100.0%)	1	NA	NA
AVL70042.1|93023_93863_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	50.6	1.9e-66
>prophage 7
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	97145	99883	2511315		Catovirus(50.0%)	2	NA	NA
AVL70046.1|97145_99083_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.0	1.7e-38
AVL70047.1|99094_99883_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.3	4.1e-15
>prophage 8
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	103365	112748	2511315		Acinetobacter_phage(42.86%)	10	NA	NA
AVL70051.1|103365_104220_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	2.2e-14
AVL70052.1|104232_105531_+	phenylacetate--CoA ligase family protein	NA	NA	NA	NA	NA
AVL70053.1|105622_106147_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.4	7.7e-18
AVL70054.1|106300_107215_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.9	9.6e-24
AVL70055.1|107342_108251_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
AVL70056.1|108274_108721_-	HIT family protein	NA	NA	NA	NA	NA
AVL70057.1|108738_109539_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	50.6	1.7e-64
AVL70058.1|109557_110595_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	40.1	6.5e-69
AVL70059.1|110627_111203_-	type 1 glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	60.8	1.1e-65
AVL70060.1|111224_112748_-	anthranilate synthase component I	NA	A0A0B5J984	Pandoravirus	29.1	5.1e-38
>prophage 9
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	115884	117378	2511315		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVL70064.1|115884_117378_-	ATP-dependent helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.6	2.9e-46
>prophage 10
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	122339	126310	2511315		Bacillus_phage(50.0%)	3	NA	NA
AVL70068.1|122339_124418_+	ATP-dependent DNA helicase Rep	NA	A7KV33	Bacillus_phage	34.9	1.3e-97
AVL70069.1|124513_125710_+	ubiquinone biosynthesis protein UbiH	NA	NA	NA	NA	NA
AVL70070.1|125695_126310_-	hypothetical protein	NA	A0A2H4PQV0	Staphylococcus_phage	38.3	1.1e-26
>prophage 11
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	138936	141717	2511315		Staphylococcus_phage(100.0%)	1	NA	NA
AVL70084.1|138936_141717_-	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	3.8e-23
>prophage 12
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	154386	156096	2511315		Tupanvirus(100.0%)	1	NA	NA
AVL70096.1|154386_156096_-	sulfate adenylyltransferase	NA	A0A2K9L0F0	Tupanvirus	28.0	1.7e-26
>prophage 13
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	162339	163350	2511315	transposase	Burkholderia_phage(100.0%)	1	NA	NA
AVL70100.1|162339_163350_+|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	28.4	2.4e-20
>prophage 14
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	171668	172007	2511315		Burkholderia_phage(100.0%)	1	NA	NA
AVL70110.1|171668_172007_+	XRE family transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	50.5	3.9e-15
>prophage 15
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	178862	180950	2511315	tRNA	Catovirus(100.0%)	1	NA	NA
AVL70120.1|178862_180950_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	23.8	1.2e-21
>prophage 16
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	190819	191383	2511315		Pseudomonas_phage(100.0%)	1	NA	NA
AVL70125.1|190819_191383_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.8	1.4e-73
>prophage 17
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	200961	204127	2511315		Vibrio_phage(50.0%)	3	NA	NA
AVL70133.1|200961_201945_-	Nudix family hydrolase	NA	A0A2I7SA81	Vibrio_phage	40.4	3.3e-06
AVL72066.1|201979_202825_-	AAA family ATPase	NA	NA	NA	NA	NA
AVL70134.1|203146_204127_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	24.0	2.8e-05
>prophage 18
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	218039	218993	2511315		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
AVL70148.1|218039_218993_+	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	38.4	1.9e-30
>prophage 19
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	226152	226725	2511315		Salicola_phage(100.0%)	1	NA	NA
AVL70153.1|226152_226725_-	hypothetical protein	NA	A0A248SJG7	Salicola_phage	34.1	3.5e-08
>prophage 20
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	251782	252145	2511315		Lake_Baikal_phage(100.0%)	1	NA	NA
AVL70177.1|251782_252145_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.9	1.6e-27
>prophage 21
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	255438	263679	2511315	integrase	Staphylococcus_phage(33.33%)	9	259372:259391	266565:266584
AVL70181.1|255438_256683_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.2	5.2e-97
AVL70182.1|256750_257245_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
AVL70183.1|257228_258416_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	30.6	4.3e-40
AVL70184.1|258425_259100_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	35.3	4.1e-24
259372:259391	attL	GTTGGTATAAAAGTTGGTAT	NA	NA	NA	NA
AVL70185.1|259423_260644_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	39.0	5.3e-78
AVL70186.1|260831_262268_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70187.1|262473_262740_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70188.1|262736_263057_+	hypothetical protein	NA	A0A1B0VRK7	Pseudomonas_phage	47.6	1.3e-07
AVL70189.1|263049_263679_+	hypothetical protein	NA	A0A1B0VMK9	Pseudomonas_phage	49.5	1.7e-19
266565:266584	attR	GTTGGTATAAAAGTTGGTAT	NA	NA	NA	NA
>prophage 22
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	274940	277872	2511315		Klosneuvirus(50.0%)	2	NA	NA
AVL70201.1|274940_276212_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.0	1.1e-33
AVL70202.1|276384_277872_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	27.3	4.3e-13
>prophage 23
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	288237	289050	2511315		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVL70210.1|288237_289050_-	hemin ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	1.1e-10
>prophage 24
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	304153	305488	2511315	protease	Erwinia_phage(100.0%)	1	NA	NA
AVL72074.1|304153_305488_-|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	28.6	1.6e-40
>prophage 25
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	308801	313335	2511315	tRNA	Pithovirus(50.0%)	5	NA	NA
AVL70227.1|308801_309515_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	33.3	5.0e-12
AVL70228.1|309524_310373_+	iron ABC transporter	NA	NA	NA	NA	NA
AVL70229.1|310412_311483_+	hypothetical protein	NA	NA	NA	NA	NA
AVL72076.1|311724_312381_+	DUF484 domain-containing protein	NA	NA	NA	NA	NA
AVL70230.1|312390_313335_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.1	1.4e-06
>prophage 26
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	316914	319191	2511315		Bacillus_phage(100.0%)	1	NA	NA
AVL70234.1|316914_319191_+	histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	3.1e-07
>prophage 27
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	327074	327332	2511315		Rhizobium_phage(100.0%)	1	NA	NA
AVL70242.1|327074_327332_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	45.3	2.4e-09
>prophage 28
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	330443	331967	2511315		Moraxella_phage(100.0%)	1	NA	NA
AVL70246.1|330443_331967_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	27.9	2.2e-20
>prophage 29
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	343967	358239	2511315	transposase	Bacillus_phage(16.67%)	13	NA	NA
AVL70259.1|343967_346034_+	lytic transglycosylase	NA	A0A0S2SXL7	Bacillus_phage	39.0	1.3e-15
AVL70260.1|346055_347303_+	hypothetical protein	NA	A0A292GDU1	Xanthomonas_phage	39.3	5.6e-51
AVL70261.1|347322_347793_-	EamA-like transporter family protein	NA	NA	NA	NA	NA
AVL70262.1|347845_349180_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVL70263.1|349176_350064_-	hypothetical protein	NA	NA	NA	NA	NA
AVL70264.1|350223_351024_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	30.3	2.2e-24
AVL70265.1|351259_351652_+	GtrA family protein	NA	NA	NA	NA	NA
AVL70266.1|351632_352742_+	glycosyltransferase	NA	A0A075B8F6	Enterobacteria_phage	48.2	1.1e-77
AVL70267.1|352758_354222_+	hypothetical protein	NA	NA	NA	NA	NA
AVL72079.1|354228_354942_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	26.4	7.0e-06
AVL70268.1|354945_356199_+	sensor histidine kinase	NA	NA	NA	NA	NA
AVL70269.1|356286_356973_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
AVL70270.1|357228_358239_-|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	28.4	8.4e-21
>prophage 30
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	371952	372624	2511315		Planktothrix_phage(100.0%)	1	NA	NA
AVL70283.1|371952_372624_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	38.2	1.7e-30
>prophage 31
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	375954	382578	2511315		Gordonia_phage(25.0%)	5	NA	NA
AVL70288.1|375954_376923_-	tyrosine recombinase XerC	NA	A0A166YH27	Gordonia_phage	29.2	4.7e-13
AVL70289.1|376924_378562_-	trifunctional thioredoxin/methionine sulfoxide reductase A/B protein	NA	NA	NA	NA	NA
AVL70290.1|378606_379503_-	acyltransferase	NA	A0A1W6JP29	Morganella_phage	29.7	6.5e-25
AVL70291.1|379786_380950_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	61.8	3.0e-131
AVL70292.1|381147_382578_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	28.8	3.9e-40
>prophage 32
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	388752	389592	2511315		Planktothrix_phage(100.0%)	1	NA	NA
AVL70300.1|388752_389592_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	1.9e-26
>prophage 33
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	394878	396660	2511315		Cronobacter_phage(100.0%)	1	NA	NA
AVL70304.1|394878_396660_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A060AN10	Cronobacter_phage	58.9	8.8e-207
>prophage 34
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	404254	405532	2511315		Pseudomonas_phage(100.0%)	1	NA	NA
AVL70308.1|404254_405532_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	33.4	1.5e-35
>prophage 35
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	409662	410436	2511315		Bacillus_virus(100.0%)	1	NA	NA
AVL70312.1|409662_410436_-	cobalamin/Fe3+-siderophore ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.0	4.2e-20
>prophage 36
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	417448	423275	2511315	transposase	Burkholderia_phage(33.33%)	4	NA	NA
AVL70318.1|417448_418459_+|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	28.4	8.4e-21
AVL70319.1|418640_420851_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AVL72082.1|421097_422315_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	1.1e-48
AVL70320.1|422423_423275_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.8	1.0e-19
>prophage 37
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	427833	431619	2511315		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
AVL70323.1|427833_428208_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	53.8	8.1e-30
AVL70324.1|428456_428828_-	sulfur reduction protein DsrE	NA	NA	NA	NA	NA
AVL70325.1|429307_430237_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	26.2	3.0e-17
AVL72084.1|430362_431619_+	4-aminobutyrate aminotransferase	NA	A0A2P1JXE5	Rhodococcus_phage	26.7	5.0e-07
>prophage 38
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	440834	441365	2511315		Salmonella_phage(100.0%)	1	NA	NA
AVL70333.1|440834_441365_+	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	51.5	1.0e-41
>prophage 39
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	446259	449447	2511315	tRNA	Vibrio_phage(33.33%)	4	NA	NA
AVL70339.1|446259_447132_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	1.8e-40
AVL70340.1|447124_448075_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	66.0	1.7e-92
AVL70341.1|448089_448449_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AVL70342.1|448526_449447_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	27.7	1.2e-13
>prophage 40
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	452759	456536	2511315		Dickeya_phage(100.0%)	1	NA	NA
AVL70345.1|452759_456536_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	49.2	7.7e-11
>prophage 41
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	459929	460568	2511315		Bacillus_virus(100.0%)	1	NA	NA
AVL70349.1|459929_460568_+	OmpA family protein	NA	G3M9Z1	Bacillus_virus	39.4	4.1e-05
>prophage 42
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	463682	466224	2511315		Mycobacterium_phage(50.0%)	2	NA	NA
AVL70354.1|463682_464372_+	methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	41.0	6.9e-35
AVL70355.1|464388_466224_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.2	1.9e-47
>prophage 43
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	488966	489950	2511315		Xanthomonas_phage(100.0%)	1	NA	NA
AVL70374.1|488966_489950_+	M23 family peptidase	NA	A0A292GJG6	Xanthomonas_phage	51.7	1.7e-26
>prophage 44
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	496135	501155	2511315		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
AVL70378.1|496135_497602_+	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	66.4	1.3e-168
AVL70379.1|498232_499774_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.3	1.2e-103
AVL70380.1|499913_501155_+	restriction endonuclease subunit S	NA	B3GAM1	uncultured_virus	31.5	1.8e-09
>prophage 45
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	513398	514047	2511315		Mannheimia_phage(50.0%)	2	NA	NA
AVL70386.1|513398_513569_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	59.6	1.2e-09
AVL70387.1|513633_514047_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PH90	Moraxella_phage	54.1	6.6e-33
>prophage 46
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	518705	524872	2511315		uncultured_Mediterranean_phage(50.0%)	6	NA	NA
AVL70391.1|518705_521978_-	hypothetical protein	NA	A0A1B1IUN1	uncultured_Mediterranean_phage	26.2	6.3e-09
AVL70392.1|521981_523202_-	exonuclease sbcCD subunit D	NA	NA	NA	NA	NA
AVL72089.1|523333_523828_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70393.1|523859_524138_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70394.1|524160_524400_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70395.1|524401_524872_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	48.2	6.4e-32
>prophage 47
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	529527	530238	2511315		Bradyrhizobium_phage(100.0%)	1	NA	NA
AVL70400.1|529527_530238_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.4	1.7e-36
>prophage 48
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	538802	540763	2511315		Planktothrix_phage(100.0%)	2	NA	NA
AVL70410.1|538802_539795_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	4.7e-24
AVL70411.1|539791_540763_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-22
>prophage 49
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	548511	555816	2511315	tRNA	uncultured_Mediterranean_phage(75.0%)	6	NA	NA
AVL70417.1|548511_549591_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.7	5.6e-47
AVL70418.1|549590_551093_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
AVL70419.1|551254_552196_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	36.8	4.0e-41
AVL70420.1|552224_554159_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AVL70421.1|554240_554579_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	41.1	2.2e-10
AVL70422.1|554676_555816_-|tRNA	tRNA-guanine(34) transglycosylase	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.4	4.3e-90
>prophage 50
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	559593	560994	2511315		Phage_TP(100.0%)	1	NA	NA
AVL70428.1|559593_560994_-	U32 family peptidase	NA	Q6DW11	Phage_TP	57.4	9.3e-111
>prophage 51
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	575842	581564	2511315		Orpheovirus(33.33%)	4	NA	NA
AVL70441.1|575842_576814_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.9	2.6e-59
AVL70442.1|576874_579364_+	cell division protein FtsK	NA	Q853W3	Mycobacterium_phage	48.9	8.5e-83
AVL70443.1|579451_580180_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AVL70444.1|580196_581564_+	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	39.7	2.6e-81
>prophage 52
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	592812	594243	2511315		Erysipelothrix_phage(100.0%)	1	NA	NA
AVL70453.1|592812_594243_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	7.1e-42
>prophage 53
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	600334	601552	2511315	transposase	uncultured_virus(100.0%)	1	NA	NA
AVL72094.1|600334_601552_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.0	2.3e-49
>prophage 54
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	610886	612104	2511315	transposase	uncultured_virus(100.0%)	1	NA	NA
AVL72096.1|610886_612104_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.0	2.3e-49
>prophage 55
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	617068	619138	2511315		Bacillus_phage(100.0%)	1	NA	NA
AVL70473.1|617068_619138_+	helicase	NA	A0A127AW80	Bacillus_phage	27.7	6.4e-68
>prophage 56
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	634125	648965	2511315	tRNA	Vibrio_phage(20.0%)	10	NA	NA
AVL70488.1|634125_634824_-	NAD-dependent protein deacylase	NA	Q6WIA8	Vibrio_phage	40.0	6.4e-28
AVL70489.1|634842_640578_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	38.9	5.0e-195
AVL70490.1|641281_642205_+	glycosyltransferase family 2 protein	NA	A0A2P1ELT8	Moumouvirus	30.0	1.2e-05
AVL70491.1|642256_642817_-	hypothetical protein	NA	NA	NA	NA	NA
AVL70492.1|643005_644679_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	28.5	1.7e-39
AVL70493.1|644922_645132_+	osmotically-inducible lipoprotein B	NA	NA	NA	NA	NA
AVL70494.1|645199_645484_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
AVL70495.1|645487_646303_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
AVL70496.1|646411_647185_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
AVL70497.1|647213_648965_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	52.1	5.5e-169
>prophage 57
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	664884	696990	2511315	tRNA,transposase	Prochlorococcus_phage(14.29%)	26	NA	NA
AVL70512.1|664884_666162_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	33.4	4.4e-35
AVL70513.1|666249_666744_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AVL70514.1|666736_668245_-	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	34.2	7.6e-26
AVL70515.1|668257_668941_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AVL70516.1|668937_669630_-	hypothetical protein	NA	NA	NA	NA	NA
AVL70517.1|669764_670814_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.2	3.9e-69
AVL70518.1|670835_671771_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AVL70519.1|671778_673680_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.9	4.4e-79
AVL70520.1|673743_675072_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	29.0	9.0e-15
AVL70521.1|675035_675563_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
AVL70522.1|675634_676564_-	AEC family transporter	NA	NA	NA	NA	NA
AVL70523.1|676645_677539_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	2.1e-31
AVL70524.1|677676_679305_+	acyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	26.2	5.1e-28
AVL70525.1|679428_682116_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70526.1|682108_685561_+	hypothetical protein	NA	G3MA40	Bacillus_virus	34.7	5.8e-05
AVL70527.1|685866_686151_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	52.1	1.1e-18
AVL70528.1|686140_686392_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AVL70529.1|687380_688181_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
AVL70530.1|688336_690352_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.0	1.4e-43
AVL72100.1|690401_690728_+	nucleoid-associated protein, YbaB/EbfC family	NA	NA	NA	NA	NA
AVL72101.1|690766_691381_+	recombination protein RecR	NA	NA	NA	NA	NA
AVL70531.1|691579_692542_-	transaldolase	NA	E3SNX1	Prochlorococcus_phage	31.8	5.0e-15
AVL70532.1|692769_693180_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.7	5.4e-43
AVL70533.1|693201_694425_+	cytosine methyltransferase	NA	A0A1B0VCD8	Salmonella_phage	61.3	8.3e-140
AVL72102.1|694729_695647_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70534.1|695829_696990_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	30.8	1.1e-40
>prophage 58
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	701020	702520	2511315		Enterobacteria_phage(100.0%)	1	NA	NA
AVL70537.1|701020_702520_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	63.0	1.9e-141
>prophage 59
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	708745	711660	2511315		Micromonas_pusilla_virus(50.0%)	2	NA	NA
AVL70544.1|708745_710722_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	M4QMW8	Micromonas_pusilla_virus	42.3	3.7e-113
AVL70545.1|710811_711660_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	30.6	7.3e-26
>prophage 60
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	715392	718064	2511315		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
AVL70549.1|715392_716364_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	40.5	2.6e-59
AVL70550.1|716350_717298_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AVL70551.1|717305_718064_+	iron ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.9	3.9e-15
>prophage 61
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	721454	725472	2511315		Cyanophage(50.0%)	4	NA	NA
AVL70553.1|721454_722501_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	40.4	6.6e-53
AVL70554.1|722767_723730_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AVL72104.1|723741_724632_+	phosphate ABC transporter permease PtsA	NA	NA	NA	NA	NA
AVL72105.1|724683_725472_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	30.2	2.0e-17
>prophage 62
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	730421	749997	2511315	protease,tRNA	Klebsiella_phage(14.29%)	17	NA	NA
AVL70562.1|730421_731918_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	3.2e-77
AVL72106.1|731974_732481_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVL70563.1|732667_733654_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AVL70564.1|733718_734726_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.4	1.7e-50
AVL70565.1|734750_737468_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	2.1e-18
AVL70566.1|737652_738363_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
AVL72107.1|738503_739955_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AVL70567.1|740098_741163_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.0	3.5e-78
AVL70568.1|741262_742381_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AVL70569.1|742398_743781_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.7	7.0e-111
AVL70570.1|743951_744422_+	cytochrome C	NA	NA	NA	NA	NA
AVL70571.1|744477_745803_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
AVL72108.1|746040_746160_+	entericidin EcnA/B family protein	NA	NA	NA	NA	NA
AVL70572.1|746318_747209_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	35.2	2.8e-52
AVL70573.1|747230_747737_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AVL70574.1|747738_748953_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AVL70575.1|748962_749997_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	34.3	9.1e-39
>prophage 63
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	756581	765774	2511315		uncultured_Caudovirales_phage(20.0%)	6	NA	NA
AVL72110.1|756581_757496_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	39.3	2.5e-56
AVL70580.1|757587_759693_+	acinetobactin biosynthesis protein	NA	NA	NA	NA	NA
AVL70581.1|759754_761332_+	peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	24.3	6.2e-39
AVL70582.1|761414_763013_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.3	7.3e-19
AVL70583.1|763025_764630_-	ABC transporter ATP-binding protein	NA	F2Y165	Organic_Lake_phycodnavirus	29.1	8.6e-12
AVL70584.1|764640_765774_-	histidine decarboxylase	NA	M1HLC2	Paramecium_bursaria_Chlorella_virus	34.1	7.1e-53
>prophage 64
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	774617	775628	2511315	transposase	Burkholderia_phage(100.0%)	1	NA	NA
AVL70593.1|774617_775628_+|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	28.7	2.9e-21
>prophage 65
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	794375	801372	2511315		Chrysochromulina_ericina_virus(33.33%)	6	NA	NA
AVL70610.1|794375_796301_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	1.6e-145
AVL70611.1|796387_797506_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	29.6	6.2e-25
AVL72111.1|797582_798572_+	NAD(P)H quinone oxidoreductase	NA	NA	NA	NA	NA
AVL70612.1|798629_799439_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
AVL70613.1|799529_799970_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AVL70614.1|800370_801372_+	hypothetical protein	NA	A0A0M3LQN1	Mannheimia_phage	36.0	7.0e-52
>prophage 66
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	815523	827772	2511315		Streptococcus_phage(40.0%)	13	NA	NA
AVL70630.1|815523_815928_+	single-stranded DNA-binding protein	NA	A0A077SK05	Escherichia_phage	37.5	4.1e-19
AVL70631.1|815875_817819_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70632.1|817898_818981_+	hypothetical protein	NA	A0A193GYG9	Enterobacter_phage	33.0	3.2e-34
AVL70633.1|818983_819223_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70634.1|819215_820757_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70635.1|820985_821981_+	conjugal transfer protein TraC	NA	K4JTS1	Caulobacter_virus	33.8	4.7e-32
AVL70636.1|822032_822536_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70637.1|822548_823559_+	traS protein	NA	NA	NA	NA	NA
AVL70638.1|823645_825679_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.5	8.6e-49
AVL70639.1|825689_825998_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70640.1|826570_827233_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70641.1|827297_827516_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AVL70642.1|827505_827772_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	A0A1S5S8E8	Streptococcus_phage	48.2	2.0e-14
>prophage 67
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	830839	831850	2511315	transposase	Burkholderia_phage(100.0%)	1	NA	NA
AVL70646.1|830839_831850_-|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	28.4	2.4e-20
>prophage 68
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	838394	839612	2511315	transposase	uncultured_virus(100.0%)	1	NA	NA
AVL72114.1|838394_839612_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.0	1.8e-49
>prophage 69
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	852275	876798	2511315	tRNA	Bacillus_phage(25.0%)	17	NA	NA
AVL70663.1|852275_852722_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	62.6	4.8e-45
AVL70664.1|852762_853263_-	DedA family protein	NA	NA	NA	NA	NA
AVL70665.1|853266_854469_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.9	5.6e-40
AVL70666.1|854489_855044_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
AVL72115.1|855036_857907_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	27.3	2.1e-77
AVL70667.1|857896_858940_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
AVL70668.1|859013_859727_+	phosphoribosylglycinamide formyltransferase	NA	R9S626	Prochlorococcus_phage	38.5	9.7e-24
AVL70669.1|859728_861093_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AVL70670.1|861154_863443_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.3	6.4e-109
AVL70671.1|863466_863775_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70672.1|863907_864180_-	oxidative damage protection protein	NA	NA	NA	NA	NA
AVL70673.1|864181_865555_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
AVL70674.1|865694_869516_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	30.2	5.0e-50
AVL70675.1|869540_873083_+	DNA polymerase III subunit alpha	NA	A0A0K1Y906	Streptomyces_phage	37.1	6.4e-193
AVL70676.1|873146_873932_+	YdcF family protein	NA	NA	NA	NA	NA
AVL70677.1|873955_874870_-	heptosyltransferase	NA	NA	NA	NA	NA
AVL70678.1|875025_876798_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	32.6	5.7e-57
>prophage 70
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	880438	882271	2511315		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVL70683.1|880438_882271_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	48.4	2.1e-155
>prophage 71
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	894369	902418	2511315		Vibrio_phage(100.0%)	5	NA	NA
AVL70689.1|894369_895371_-	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YYX4	Vibrio_phage	35.7	8.0e-40
AVL70690.1|895382_896384_-	type I-F CRISPR-associated protein Csy2	NA	NA	NA	NA	NA
AVL70691.1|896386_897703_-	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
AVL70692.1|898024_901471_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	31.5	2.5e-56
AVL70693.1|901467_902418_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YZM7	Vibrio_phage	38.2	4.4e-48
>prophage 72
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	908066	970500	2511315	integrase,transposase	uncultured_virus(20.0%)	54	943430:943444	973259:973273
AVL70702.1|908066_909605_-|transposase	transposase	transposase	NA	NA	NA	NA
AVL70703.1|911600_912128_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70704.1|912099_912372_+	hypothetical protein	NA	NA	NA	NA	NA
AVL72116.1|912659_913877_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.0	3.0e-49
AVL70705.1|915395_915767_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70706.1|915892_916819_-	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
AVL70707.1|916898_917519_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVL70708.1|917540_918836_-	MFS transporter	NA	NA	NA	NA	NA
AVL70709.1|919040_919658_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70710.1|920897_921176_+	Killer protein	NA	A0A2L1IV28	Escherichia_phage	53.3	9.3e-23
AVL70711.1|921186_921465_+	addiction module antidote protein, HigA family	NA	A0A2L1IV52	Escherichia_phage	35.3	1.0e-08
AVL70712.1|921567_921798_+	TraY domain-containing protein	NA	NA	NA	NA	NA
AVL70713.1|921846_922299_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70714.1|922358_924128_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70715.1|924158_924677_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70716.1|924932_925943_-|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	28.4	8.4e-21
AVL70717.1|926228_926441_-	hypothetical protein	NA	NA	NA	NA	NA
AVL70718.1|926539_928090_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AVL70719.1|929774_930338_-	hypothetical protein	NA	NA	NA	NA	NA
AVL70720.1|930410_930860_-	hypothetical protein	NA	NA	NA	NA	NA
AVL70721.1|931219_931660_+	hypothetical protein	NA	NA	NA	NA	NA
AVL72117.1|932030_933248_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.0	1.8e-49
AVL70722.1|935554_936820_-	aspartate kinase	NA	NA	NA	NA	NA
AVL70723.1|937076_937976_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
AVL70724.1|937985_939128_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVL70725.1|939236_940010_-	DUF533 domain-containing protein	NA	NA	NA	NA	NA
AVL70726.1|940030_940585_-	elongation factor P	NA	NA	NA	NA	NA
AVL70727.1|940693_941791_-	elongation factor P maturation arginine rhamnosyltransferase EarP	NA	NA	NA	NA	NA
AVL70728.1|941879_944579_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
943430:943444	attL	CAGTCAGCTTAATTA	NA	NA	NA	NA
AVL70729.1|944654_945866_-	2-aminoadipate aminotransferase	NA	NA	NA	NA	NA
AVL70730.1|946101_948693_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
AVL70731.1|948879_949827_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70732.1|949931_951287_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	82.4	1.2e-54
AVL70733.1|951376_952537_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
AVL70734.1|952563_953445_-	methylisocitrate lyase	NA	NA	NA	NA	NA
AVL70735.1|953557_954547_-	malate dehydrogenase	NA	NA	NA	NA	NA
AVL70736.1|954719_955565_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVL70737.1|955641_956058_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
AVL70738.1|956057_956441_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
AVL70739.1|956444_958223_+	succinate dehydrogenase flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	24.6	1.8e-05
AVL70740.1|958238_958955_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
AVL72118.1|958993_959251_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
AVL70741.1|959289_960600_+	citrate synthase	NA	NA	NA	NA	NA
AVL70742.1|960724_962023_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
AVL70743.1|962048_962921_-	EamA family transporter	NA	NA	NA	NA	NA
AVL72119.1|962995_963871_-	EamA family transporter	NA	NA	NA	NA	NA
AVL70744.1|964194_965280_-|integrase	site-specific integrase	integrase	A0A077KGX2	Edwardsiella_phage	39.4	8.9e-69
AVL70745.1|966487_966946_+	hypothetical protein	NA	NA	NA	NA	NA
AVL72120.1|967522_967699_+	hypothetical protein	NA	A0A2I7RGT5	Vibrio_phage	51.7	5.7e-10
AVL70746.1|967790_968450_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70747.1|968430_968676_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70748.1|968721_969426_+	hypothetical protein	NA	NA	NA	NA	NA
AVL72121.1|969434_969896_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70749.1|970059_970500_+	hypothetical protein	NA	A0A249Y2R5	Serratia_phage	47.6	1.1e-25
973259:973273	attR	CAGTCAGCTTAATTA	NA	NA	NA	NA
>prophage 73
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	975329	976799	2511315		Burkholderia_phage(50.0%)	2	NA	NA
AVL70755.1|975329_975665_-	XRE family transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	42.7	2.1e-13
AVL70756.1|976253_976799_-	DUF4065 domain-containing protein	NA	I6R0L8	Salmonella_phage	41.9	7.7e-29
>prophage 74
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	983288	983954	2511315		Bacillus_virus(100.0%)	1	NA	NA
AVL72122.1|983288_983954_-	nitrate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	1.4e-24
>prophage 75
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	991067	996623	2511315		Moraxella_phage(20.0%)	5	NA	NA
AVL70769.1|991067_991460_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	45.8	5.3e-24
AVL70770.1|991473_991674_-	addiction module toxin, HicA family	NA	D6R431	Bacillus_phage	50.0	4.1e-12
AVL70771.1|992071_993532_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.7	1.4e-96
AVL72123.1|993559_995152_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	25.8	2.0e-08
AVL70772.1|995312_996623_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	57.5	1.9e-126
>prophage 76
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	999894	1005950	2511315		Bacillus_virus(50.0%)	4	NA	NA
AVL70776.1|999894_1000218_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	47.9	1.2e-18
AVL70777.1|1000571_1002542_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	36.2	3.8e-94
AVL70778.1|1002560_1004882_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.8	1.4e-79
AVL70779.1|1004915_1005950_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	A0A0E3HEF7	Synechococcus_phage	46.7	1.4e-10
>prophage 77
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1009697	1010951	2511315	transposase	Mycobacterium_phage(100.0%)	1	NA	NA
AVL70782.1|1009697_1010951_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	47.5	2.0e-96
>prophage 78
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1017726	1026194	2511315	tRNA	Tupanvirus(25.0%)	7	NA	NA
AVL70789.1|1017726_1018749_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L070	Tupanvirus	35.9	9.3e-28
AVL70790.1|1018812_1021215_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AVL70791.1|1021232_1021541_+	integration host factor subunit alpha	NA	A7KV42	Bacillus_phage	40.0	1.7e-12
AVL70792.1|1021724_1022111_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AVL70793.1|1022268_1022529_+	recombinase RecA	NA	NA	NA	NA	NA
AVL70794.1|1022613_1025454_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.5	1.1e-150
AVL70795.1|1025786_1026194_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	40.9	1.7e-20
>prophage 79
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1036576	1138804	2511315	capsid,integrase,portal,transposase,terminase,head,holin,tRNA,protease,tail	Pseudomonas_phage(15.56%)	101	1046036:1046052	1125053:1125069
AVL70806.1|1036576_1037956_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
AVL70807.1|1037973_1038846_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
AVL70808.1|1038857_1040021_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
AVL70809.1|1040087_1041383_+	adenylosuccinate synthase	NA	A0A291AUF9	Pandoravirus	32.8	1.2e-59
AVL70810.1|1041427_1041979_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
AVL70811.1|1042126_1042339_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVL70812.1|1042380_1044270_+	DNA primase	NA	C7F4F5	Cyanophage	28.5	1.6e-41
AVL70813.1|1044335_1046669_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.4	3.0e-37
1046036:1046052	attL	GGGTAATATCGGTTTGA	NA	NA	NA	NA
AVL72127.1|1046761_1047742_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	36.0	3.4e-27
AVL70814.1|1047744_1048506_+	ABC transporter permease	NA	NA	NA	NA	NA
AVL70815.1|1048938_1049229_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70816.1|1049267_1050812_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	38.0	3.1e-83
AVL70817.1|1050814_1051919_-	peptide chain release factor 2	NA	NA	NA	NA	NA
AVL70818.1|1052199_1053930_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.9	3.9e-58
AVL70819.1|1053911_1054970_-	hypothetical protein	NA	NA	NA	NA	NA
AVL70820.1|1055009_1056290_+	lipoprotein-releasing system transmembrane subunit LolC	NA	NA	NA	NA	NA
AVL70821.1|1056282_1056981_+	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	36.8	9.2e-35
AVL72128.1|1057005_1057812_+	DNAase	NA	NA	NA	NA	NA
AVL70822.1|1057825_1058575_-	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AVL72129.1|1058679_1059342_-	carbonate dehydratase	NA	NA	NA	NA	NA
AVL70823.1|1059496_1061986_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
AVL70824.1|1062065_1062908_+	PHP domain-containing protein	NA	NA	NA	NA	NA
AVL70825.1|1062921_1063476_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
AVL70826.1|1063576_1064542_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70827.1|1064644_1066582_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70828.1|1066667_1068974_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.1	2.3e-13
AVL70829.1|1069036_1069243_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AVL70830.1|1069335_1069965_-	guanylate kinase	NA	A0A218KC48	Bacillus_phage	26.2	2.8e-06
AVL70831.1|1070045_1070705_+	uracil-DNA glycosylase	NA	A0A060D324	Bovine_gammaherpesvirus	52.1	1.6e-52
AVL72130.1|1070940_1071174_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70832.1|1072642_1073422_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70833.1|1073421_1074180_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70834.1|1074160_1075144_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
AVL70835.1|1075187_1076708_+	secretion protein	NA	NA	NA	NA	NA
AVL70836.1|1078230_1079496_+|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	36.8	1.5e-64
AVL70837.1|1079543_1081109_+	DNA repair protein	NA	NA	NA	NA	NA
AVL72131.1|1081263_1082481_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.5	2.5e-48
AVL70838.1|1082637_1083351_-	hypothetical protein	NA	L7P7W8	Pseudomonas_phage	32.9	3.3e-24
AVL70839.1|1083371_1083707_-	hypothetical protein	NA	NA	NA	NA	NA
AVL70840.1|1084222_1084444_-	hypothetical protein	NA	NA	NA	NA	NA
AVL70841.1|1084440_1086108_-	hypothetical protein	NA	A0A0R6PIK7	Moraxella_phage	35.6	7.5e-83
AVL70842.1|1086113_1086650_-	hypothetical protein	NA	M4QSB7	Salicola_phage	35.5	8.7e-17
AVL70843.1|1086668_1087424_-	AAA family ATPase	NA	A0A088F776	Idiomarinaceae_phage	53.1	3.3e-54
AVL70844.1|1087931_1088942_-|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	28.4	2.4e-20
AVL70845.1|1089092_1089680_-	hypothetical protein	NA	NA	NA	NA	NA
AVL70846.1|1089697_1090387_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	30.0	2.2e-17
AVL70847.1|1090491_1090734_+	transcriptional regulator	NA	D0UIL8	Aggregatibacter_phage	62.1	7.6e-13
AVL70848.1|1090815_1091196_+	hypothetical protein	NA	C8CLH2	Xylella_phage	41.7	7.7e-20
AVL70849.1|1091192_1093673_+	hypothetical protein	NA	A0A0K1LKD4	Vibrio_phage	23.6	7.3e-42
AVL70850.1|1093656_1094010_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70851.1|1094006_1094459_+	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
AVL70852.1|1094462_1095077_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70853.1|1095064_1095403_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70854.1|1095477_1095684_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70855.1|1095724_1095907_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70856.1|1095903_1096233_+	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	51.4	1.5e-24
AVL70857.1|1096256_1096589_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70858.1|1096774_1097218_+|terminase	terminase	terminase	A0A2H4J8R0	uncultured_Caudovirales_phage	43.6	2.9e-18
AVL70859.1|1097217_1098885_+|terminase	terminase	terminase	S4TSQ6	Salmonella_phage	59.8	3.7e-191
AVL70860.1|1098881_1100108_+|portal	phage portal protein	portal	A0A0R6PKP0	Moraxella_phage	59.6	2.3e-134
AVL70861.1|1100097_1100739_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0R6PKF0	Moraxella_phage	58.7	1.6e-62
AVL70862.1|1100748_1101960_+|capsid	phage major capsid protein	capsid	A0A2H4JD98	uncultured_Caudovirales_phage	69.4	2.6e-146
AVL70863.1|1102176_1102491_+	hypothetical protein	NA	K7PKT4	Enterobacteria_phage	44.4	1.1e-14
AVL70864.1|1102493_1102823_+|head,tail	head-tail adaptor protein	head,tail	A0A1J0GUY4	Halomonas_phage	55.5	1.9e-27
AVL70865.1|1102815_1103298_+	hypothetical protein	NA	A0A1V0E895	Vibrio_phage	47.1	3.2e-26
AVL70866.1|1103297_1103651_+	hypothetical protein	NA	A0A1J0GUW9	Halomonas_phage	52.1	3.2e-28
AVL70867.1|1103689_1104172_+	hypothetical protein	NA	A0A1U9GN34	Vibrio_phage	47.9	6.3e-35
AVL70868.1|1104175_1104490_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70869.1|1104808_1107037_+	hypothetical protein	NA	A0A0H5AWE4	Pseudomonas_phage	46.8	3.7e-53
AVL70870.1|1107033_1107501_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	53.2	7.7e-46
AVL70871.1|1107485_1107980_+	hypothetical protein	NA	A0A2H4J983	uncultured_Caudovirales_phage	38.0	3.2e-26
AVL70872.1|1107976_1108369_+	hypothetical protein	NA	A0A125RNN5	Pseudomonas_phage	40.7	4.0e-19
AVL70873.1|1108358_1111004_+	hypothetical protein	NA	A0A0H5ART3	Pseudomonas_phage	39.9	1.7e-177
AVL70874.1|1111066_1112512_+	hypothetical protein	NA	J7HXC9	Pseudomonas_phage	69.2	4.1e-13
AVL70875.1|1112575_1112830_+|holin	holin	holin	A0A0U1UNM6	Pseudomonas_phage	56.3	9.7e-11
AVL70876.1|1112810_1113344_+	lysozyme	NA	A0A0P0IDR4	Escherichia_phage	33.1	3.5e-10
AVL70877.1|1113325_1113808_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70878.1|1113835_1114354_-	hypothetical protein	NA	NA	NA	NA	NA
AVL70879.1|1114906_1115752_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70880.1|1115760_1116645_+	type II secretion system F family protein	NA	NA	NA	NA	NA
AVL70881.1|1116638_1116998_+	DUF192 domain-containing protein	NA	NA	NA	NA	NA
AVL70882.1|1117035_1118829_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVL70883.1|1119169_1119454_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70884.1|1120894_1121350_-	hypothetical protein	NA	NA	NA	NA	NA
AVL70885.1|1121759_1122197_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70886.1|1122198_1122618_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70887.1|1122620_1123142_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70888.1|1123397_1124330_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVL70889.1|1124486_1125239_+	short-chain dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.8	1.6e-13
1125053:1125069	attR	TCAAACCGATATTACCC	NA	NA	NA	NA
AVL70890.1|1125254_1126103_+	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	31.6	2.3e-08
AVL70891.1|1126108_1127110_+	transketolase	NA	NA	NA	NA	NA
AVL70892.1|1127131_1128118_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AVL70893.1|1128114_1128615_+	TRAP transporter small permease	NA	NA	NA	NA	NA
AVL70894.1|1128644_1129904_+	hypothetical protein	NA	NA	NA	NA	NA
AVL70895.1|1129920_1130808_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	39.4	1.0e-46
AVL70896.1|1132361_1133033_-	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	24.4	4.6e-07
AVL70897.1|1133029_1133779_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	21.3	7.1e-09
AVL70898.1|1133781_1134732_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVL70899.1|1134728_1135631_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVL70900.1|1135644_1136946_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVL70901.1|1137253_1138804_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 80
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1146256	1149824	2511315		Acidithiobacillus_phage(50.0%)	4	NA	NA
AVL70912.1|1146256_1146727_-	DNA-binding protein	NA	K4ICM4	Acidithiobacillus_phage	51.6	3.4e-33
AVL70913.1|1146850_1147666_-	ABC transporter permease	NA	NA	NA	NA	NA
AVL70914.1|1147694_1148771_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVL70915.1|1148795_1149824_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	6.5e-29
>prophage 81
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1156816	1161204	2511315	transposase	Escherichia_phage(66.67%)	3	NA	NA
AVL70921.1|1156816_1157827_-|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	28.1	7.1e-20
AVL70922.1|1159406_1160444_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	48.2	4.3e-81
AVL70923.1|1160427_1161204_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	54.8	3.2e-73
>prophage 82
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1164206	1164827	2511315		Cassava_brown_streak_virus(100.0%)	1	NA	NA
AVL70927.1|1164206_1164827_+	non-canonical purine NTP pyrophosphatase, RdgB/HAM1 family	NA	E9KZD6	Cassava_brown_streak_virus	40.2	1.1e-07
>prophage 83
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1179088	1182922	2511315		Colwellia_phage(33.33%)	3	NA	NA
AVL70941.1|1179088_1181380_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	67.3	3.3e-307
AVL70942.1|1181468_1182602_+	ribonucleotide-diphosphate reductase subunit beta	NA	A9Q1X8	Enterobacteria_phage	75.6	3.8e-163
AVL70943.1|1182598_1182922_+	ferredoxin	NA	G9IAA2	Pseudomonas_phage	50.0	2.0e-13
>prophage 84
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1186289	1191019	2511315		Pandoravirus(50.0%)	4	NA	NA
AVL70947.1|1186289_1187363_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.5	8.8e-77
AVL70948.1|1187462_1187855_+	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AVL70949.1|1187939_1190045_+	DNA helicase RecG	NA	NA	NA	NA	NA
AVL70950.1|1190083_1191019_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.7	1.4e-14
>prophage 85
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1201226	1201931	2511315		Xanthomonas_phage(100.0%)	1	NA	NA
AVL70960.1|1201226_1201931_+	M23 family peptidase	NA	A0A292GJG6	Xanthomonas_phage	46.2	7.4e-24
>prophage 86
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1208476	1209580	2511315	transposase	Phage_Gifsy-1(100.0%)	1	NA	NA
AVL70970.1|1208476_1209580_-|transposase	transposase	transposase	Q9G0F2	Phage_Gifsy-1	31.3	2.4e-21
>prophage 87
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1214029	1214668	2511315		Pseudomonas_phage(100.0%)	1	NA	NA
AVL70976.1|1214029_1214668_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	38.8	3.8e-27
>prophage 88
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1219022	1226239	2511315		Staphylococcus_phage(33.33%)	8	NA	NA
AVL70981.1|1219022_1219475_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.2	4.9e-29
AVL70982.1|1219517_1220441_-	paraslipin	NA	NA	NA	NA	NA
AVL70983.1|1220443_1220878_-	hypothetical protein	NA	NA	NA	NA	NA
AVL70984.1|1220897_1221227_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AVL72135.1|1221361_1223737_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.7	1.4e-164
AVL70985.1|1223912_1224743_+	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AVL70986.1|1224717_1225554_-	RNA methyltransferase	NA	NA	NA	NA	NA
AVL70987.1|1225588_1226239_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	40.6	6.3e-30
>prophage 89
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1236755	1237499	2511315		Flavobacterium_phage(100.0%)	1	NA	NA
AVL70995.1|1236755_1237499_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	35.6	2.2e-18
>prophage 90
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1248683	1254839	2511315		Mollivirus(50.0%)	5	NA	NA
AVL71004.1|1248683_1250111_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	38.7	3.0e-80
AVL71005.1|1250156_1250645_-	CvpA family protein	NA	NA	NA	NA	NA
AVL71006.1|1250668_1251670_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
AVL71007.1|1251688_1252987_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AVL71008.1|1253078_1254839_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.9	1.1e-39
>prophage 91
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1262077	1275849	2511315		Tupanvirus(28.57%)	13	NA	NA
AVL71013.1|1262077_1262944_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.2	4.1e-32
AVL71014.1|1262946_1265004_+	M3 family peptidase	NA	A0A1V0SID3	Klosneuvirus	24.5	1.9e-40
AVL71015.1|1265016_1265628_+	SCO family protein	NA	NA	NA	NA	NA
AVL71016.1|1265713_1266556_+	hypothetical protein	NA	NA	NA	NA	NA
AVL72139.1|1266617_1267319_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.5	3.0e-17
AVL71017.1|1267327_1268089_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	A0A1M7XV31	Cedratvirus	26.1	4.1e-12
AVL71018.1|1268088_1269318_-	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
AVL71019.1|1269317_1270241_-	high-affinity branched-chain amino acid ABC transporter permease LivH	NA	NA	NA	NA	NA
AVL71020.1|1270489_1271092_+	hypothetical protein	NA	A0A2K9L181	Tupanvirus	35.3	3.5e-14
AVL72140.1|1271171_1271741_-	hypothetical protein	NA	A0A2P1CKM9	Pantoea_phage	30.9	2.1e-13
AVL71021.1|1271802_1272642_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
AVL71022.1|1272699_1273773_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
AVL71023.1|1273911_1275849_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	32.2	2.5e-21
>prophage 92
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1296729	1297260	2511315		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVL71041.1|1296729_1297260_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	52.3	3.0e-46
>prophage 93
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1300886	1306393	2511315		Pandoravirus(33.33%)	5	NA	NA
AVL71044.1|1300886_1302782_-	hypothetical protein	NA	A0A0B5J984	Pandoravirus	31.0	5.2e-40
AVL71045.1|1302771_1303581_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AVL72141.1|1303592_1304543_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AVL71046.1|1304652_1305366_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.4	8.5e-44
AVL71047.1|1305511_1306393_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L5E9	Tupanvirus	31.6	8.1e-20
>prophage 94
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1311096	1311477	2511315		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVL71051.1|1311096_1311477_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	50.9	7.7e-20
>prophage 95
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1316578	1319225	2511315		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
AVL71057.1|1316578_1317343_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.0	1.7e-13
AVL71058.1|1317335_1319225_-	metal-dependent hydrolase	NA	A0A285PWH2	Cedratvirus	28.6	8.3e-14
>prophage 96
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1323756	1325826	2511315		Ralstonia_phage(100.0%)	1	NA	NA
AVL71064.1|1323756_1325826_-	DNA ligase	NA	A0A0K2QQN8	Ralstonia_phage	42.3	1.8e-139
>prophage 97
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1335496	1337699	2511315		Bacillus_phage(50.0%)	2	NA	NA
AVL71070.1|1335496_1336243_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.8	3.7e-34
AVL71071.1|1336214_1337699_+	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.3	4.5e-07
>prophage 98
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1348265	1360032	2511315	protease,tRNA	Agrobacterium_phage(33.33%)	10	NA	NA
AVL71081.1|1348265_1350020_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.8	7.0e-07
AVL71082.1|1350056_1350326_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AVL71083.1|1350352_1350760_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71084.1|1350770_1351730_-	glutathione synthase	NA	NA	NA	NA	NA
AVL71085.1|1351875_1352400_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	37.1	2.5e-16
AVL71086.1|1352440_1354399_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.2	6.0e-124
AVL71087.1|1354663_1355365_+	hypothetical protein	NA	NA	NA	NA	NA
AVL71088.1|1355429_1357934_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	50.4	2.1e-214
AVL71089.1|1358050_1359349_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.4	4.4e-131
AVL71090.1|1359381_1360032_-	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.2	1.6e-52
>prophage 99
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1372641	1377218	2511315		Lake_Baikal_phage(33.33%)	4	NA	NA
AVL71098.1|1372641_1372857_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	56.2	1.8e-13
AVL71099.1|1373059_1375633_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.0	4.5e-119
AVL71100.1|1375835_1376447_+	hypothetical protein	NA	NA	NA	NA	NA
AVL71101.1|1376450_1377218_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	31.5	1.9e-25
>prophage 100
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1380419	1384825	2511315		Streptococcus_phage(25.0%)	4	NA	NA
AVL71105.1|1380419_1381709_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	63.0	7.9e-149
AVL71106.1|1381769_1382627_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.4	2.8e-49
AVL71107.1|1382623_1384267_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.4	9.4e-155
AVL71108.1|1384429_1384825_-	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	45.4	1.8e-24
>prophage 101
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1388092	1392499	2511315		Brucella_phage(33.33%)	5	NA	NA
AVL71112.1|1388092_1388302_+	hypothetical protein	NA	A0A141GEX6	Brucella_phage	55.2	6.1e-11
AVL71113.1|1388298_1388595_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	39.1	4.9e-14
AVL71114.1|1389405_1390341_-	cation transporter	NA	NA	NA	NA	NA
AVL71115.1|1390681_1391518_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVL71116.1|1391533_1392499_+	2-hydroxyacid dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	29.7	1.4e-20
>prophage 102
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1398212	1400936	2511315		Bodo_saltans_virus(100.0%)	1	NA	NA
AVL71122.1|1398212_1400936_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.4	3.6e-26
>prophage 103
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1405106	1412963	2511315		uncultured_Mediterranean_phage(25.0%)	8	NA	NA
AVL71126.1|1405106_1405820_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	30.7	1.9e-19
AVL71127.1|1406048_1406570_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71128.1|1406566_1407754_-	hypothetical protein	NA	A0A0P0IKU8	Acinetobacter_phage	33.7	4.8e-52
AVL71129.1|1407935_1408436_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71130.1|1408446_1409745_-	hypothetical protein	NA	A0A2I7RNF1	Vibrio_phage	31.1	2.8e-08
AVL71131.1|1409852_1410290_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71132.1|1410286_1411570_-	AAA family ATPase	NA	NA	NA	NA	NA
AVL71133.1|1411949_1412963_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.8	2.0e-86
>prophage 104
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1418811	1433649	2511315	tRNA,transposase	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
AVL71140.1|1418811_1419822_-|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	28.7	2.9e-21
AVL71141.1|1419960_1420266_-	DUF4298 domain-containing protein	NA	NA	NA	NA	NA
AVL71142.1|1420332_1421007_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	53.5	1.8e-56
AVL71143.1|1421086_1422466_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.2	5.5e-31
AVL71144.1|1422613_1423399_-	3'-5' exonuclease	NA	NA	NA	NA	NA
AVL71145.1|1423424_1424147_-	peptidase	NA	G9FHH0	Rhodococcus_phage	35.6	4.4e-08
AVL71146.1|1424275_1425103_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	7.5e-36
AVL71147.1|1425141_1425894_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	45.9	8.3e-58
AVL71148.1|1426058_1426748_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AVL71149.1|1426791_1427820_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	49.9	2.3e-90
AVL71150.1|1427908_1429198_+	guanine permease	NA	A0A0R6PHV4	Moraxella_phage	37.5	1.1e-70
AVL71151.1|1429338_1429722_+	thioredoxin	NA	G5CQP2	Megavirus	37.0	2.8e-09
AVL71152.1|1429838_1430438_-	thymidylate synthase	NA	A0A1X9I5T8	Streptococcus_phage	42.5	9.0e-23
AVL71153.1|1430465_1432067_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.1	3.3e-56
AVL71154.1|1432068_1433130_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AVL71155.1|1433175_1433649_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	A0A0B5J096	Pandoravirus	37.4	1.3e-08
>prophage 105
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1441147	1446501	2511315	transposase	Escherichia_phage(66.67%)	6	NA	NA
AVL71160.1|1441147_1441924_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	54.8	2.1e-72
AVL71161.1|1441907_1442945_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	48.2	9.7e-81
AVL71162.1|1443000_1443198_+	hypothetical protein	NA	NA	NA	NA	NA
AVL71163.1|1443562_1443742_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71164.1|1443930_1444665_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71165.1|1445223_1446501_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	33.4	5.8e-35
>prophage 106
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1453695	1465467	2511315		Salmonella_phage(40.0%)	8	NA	NA
AVL71167.1|1453695_1454391_-	GTP cyclohydrolase I	NA	A0A1C3NFQ1	Phage_NCTB	55.3	1.6e-63
AVL71168.1|1454550_1455150_-	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
AVL71169.1|1455424_1459486_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.4	8.6e-133
AVL71170.1|1459862_1460762_+	peptidase S11	NA	NA	NA	NA	NA
AVL71171.1|1460847_1461942_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AVL71172.1|1462210_1462663_+	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	56.1	5.9e-35
AVL71173.1|1462637_1463984_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	50.0	8.3e-109
AVL72150.1|1464069_1465467_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	51.1	2.4e-119
>prophage 107
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1475902	1485692	2511315	tRNA	uncultured_virus(25.0%)	7	NA	NA
AVL71186.1|1475902_1478638_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	29.2	8.5e-68
AVL72151.1|1478726_1479404_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KU27	Synechococcus_phage	38.1	3.3e-21
AVL71187.1|1479425_1479776_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71188.1|1480054_1482718_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.0	8.6e-174
AVL71189.1|1482720_1483296_+	hypothetical protein	NA	NA	NA	NA	NA
AVL71190.1|1483295_1484330_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AVL71191.1|1484375_1485692_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	41.2	1.8e-84
>prophage 108
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1500582	1507467	2511315	transposase	Lactococcus_phage(20.0%)	8	NA	NA
AVL71208.1|1500582_1501500_-	cysteine synthase CysM	NA	C3U2M1	Lactococcus_phage	39.9	4.3e-48
AVL71209.1|1502107_1503118_-|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	28.4	8.4e-21
AVL71210.1|1503414_1504407_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	32.8	5.3e-28
AVL71211.1|1504403_1505333_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	29.6	8.0e-18
AVL71212.1|1505334_1506585_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
AVL71213.1|1506588_1506948_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
AVL71214.1|1506919_1507111_+	hypothetical protein	NA	NA	NA	NA	NA
AVL71215.1|1507107_1507467_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	41.1	9.6e-12
>prophage 109
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1512373	1518468	2511315		Faustovirus(33.33%)	4	NA	NA
AVL72153.1|1512373_1513468_-	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	26.2	3.8e-19
AVL71219.1|1513549_1514659_-	chorismate mutase	NA	NA	NA	NA	NA
AVL71220.1|1514665_1515796_-	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	44.3	4.3e-82
AVL71221.1|1515801_1518468_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.5	8.8e-102
>prophage 110
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1522854	1527121	2511315	protease,tail	unidentified_phage(50.0%)	3	NA	NA
AVL71226.1|1522854_1524132_-	group II intron reverse transcriptase/maturase	NA	H7BVN7	unidentified_phage	26.3	9.6e-22
AVL71227.1|1524414_1524627_+	hypothetical protein	NA	NA	NA	NA	NA
AVL72155.1|1524919_1527121_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	34.7	2.2e-82
>prophage 111
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1531076	1537252	2511315		Agrobacterium_phage(33.33%)	5	NA	NA
AVL71233.1|1531076_1532762_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	30.4	7.3e-62
AVL71234.1|1532909_1534331_+	argininosuccinate lyase	NA	NA	NA	NA	NA
AVL71235.1|1534468_1535086_-	recombination regulator RecX	NA	NA	NA	NA	NA
AVL71236.1|1535095_1536172_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.0	9.9e-113
AVL71237.1|1536349_1537252_+	recombination-associated protein RdgC	NA	A0A218M310	Acidovorax_phage	32.5	2.6e-45
>prophage 112
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1542703	1545704	2511315		uncultured_virus(100.0%)	2	NA	NA
AVL71242.1|1542703_1543360_+	repressor LexA	NA	A0A218MND2	uncultured_virus	34.7	4.3e-10
AVL71243.1|1543403_1545704_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	31.5	2.6e-86
>prophage 113
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1554640	1555762	2511315		Mycoplasma_phage(100.0%)	1	NA	NA
AVL71251.1|1554640_1555762_-	polyamine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	36.8	3.5e-28
>prophage 114
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1568560	1570273	2511315		Vibrio_phage(100.0%)	1	NA	NA
AVL71265.1|1568560_1570273_+	PhoH family protein	NA	A0A2I7SAD7	Vibrio_phage	38.0	5.3e-76
>prophage 115
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1575374	1580932	2511315		Catovirus(50.0%)	6	NA	NA
AVL71272.1|1575374_1577411_-	hypothetical protein	NA	A0A1V0SAV1	Catovirus	23.9	5.3e-06
AVL71273.1|1577566_1577947_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71274.1|1578177_1578435_+	hypothetical protein	NA	NA	NA	NA	NA
AVL71275.1|1578542_1579157_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71276.1|1579150_1580089_-	MCE family protein	NA	NA	NA	NA	NA
AVL71277.1|1580107_1580932_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.2	1.7e-11
>prophage 116
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1591394	1592189	2511315		Indivirus(100.0%)	1	NA	NA
AVL71284.1|1591394_1592189_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	26.2	5.8e-09
>prophage 117
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1599793	1601728	2511315		Tupanvirus(100.0%)	1	NA	NA
AVL71292.1|1599793_1601728_+	ABC transporter	NA	A0A2K9L0W2	Tupanvirus	32.8	8.7e-67
>prophage 118
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1612216	1613101	2511315		Tupanvirus(100.0%)	1	NA	NA
AVL71300.1|1612216_1613101_-	deacetylase	NA	A0A2K9L2T7	Tupanvirus	34.1	4.4e-42
>prophage 119
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1618309	1620400	2511315		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
AVL71305.1|1618309_1619377_-	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	34.7	8.3e-11
AVL71306.1|1619395_1619839_-	holo-ACP synthase	NA	NA	NA	NA	NA
AVL71307.1|1619848_1620400_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	35.2	3.7e-23
>prophage 120
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1629889	1632967	2511315	tRNA	Tupanvirus(50.0%)	3	NA	NA
AVL71318.1|1629889_1631353_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	31.0	8.4e-38
AVL71319.1|1631441_1632353_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
AVL71320.1|1632349_1632967_+	peptidylprolyl isomerase	NA	A0A076FI46	Aureococcus_anophage	31.9	6.9e-10
>prophage 121
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1639190	1641800	2511315		Catovirus(100.0%)	1	NA	NA
AVL71327.1|1639190_1641800_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.8	2.9e-25
>prophage 122
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1646024	1653194	2511315	transposase	Burkholderia_phage(33.33%)	8	NA	NA
AVL71332.1|1646024_1647035_+|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	28.1	7.1e-20
AVL71333.1|1647542_1647752_-	bacterioferritin	NA	NA	NA	NA	NA
AVL71334.1|1648059_1648857_+	hypothetical protein	NA	NA	NA	NA	NA
AVL71335.1|1648872_1649301_-	transporter	NA	NA	NA	NA	NA
AVL71336.1|1649309_1650083_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	8.9e-23
AVL71337.1|1650095_1650770_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AVL71338.1|1650805_1651603_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVL71339.1|1652741_1653194_-	single-stranded DNA-binding protein	NA	A0A193GYD7	Enterobacter_phage	39.2	1.7e-18
>prophage 123
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1669440	1671981	2511315		Escherichia_phage(100.0%)	1	NA	NA
AVL71354.1|1669440_1671981_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	7.1e-69
>prophage 124
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1683614	1684832	2511315	transposase	uncultured_virus(100.0%)	1	NA	NA
AVL72163.1|1683614_1684832_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.5	2.5e-48
>prophage 125
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1692446	1693658	2511315		Agrobacterium_phage(100.0%)	1	NA	NA
AVL71369.1|1692446_1693658_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.7	2.1e-47
>prophage 126
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1700704	1707476	2511315	protease	Agrobacterium_phage(33.33%)	7	NA	NA
AVL71377.1|1700704_1703014_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	40.7	1.7e-162
AVL71378.1|1703075_1703384_-|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
AVL71379.1|1703546_1704008_+	DUF192 domain-containing protein	NA	A0A222YVT9	Synechococcus_phage	39.2	2.2e-13
AVL71380.1|1704044_1704422_+	hypothetical protein	NA	NA	NA	NA	NA
AVL71381.1|1704416_1705370_-	EamA family transporter	NA	NA	NA	NA	NA
AVL71382.1|1705493_1706075_-	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
AVL71383.1|1706078_1707476_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	35.2	1.8e-29
>prophage 127
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1714192	1716320	2511315		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
AVL71391.1|1714192_1715158_+	ornithine carbamoyltransferase	NA	M1IFC1	Paramecium_bursaria_Chlorella_virus	27.7	4.7e-21
AVL71392.1|1715213_1716320_-	sensor histidine kinase	NA	Q6XLV6	Feldmannia_irregularis_virus	25.0	1.8e-08
>prophage 128
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1723632	1789871	2511315	transposase	Burkholderia_phage(21.43%)	61	NA	NA
AVL71400.1|1723632_1724643_-|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	28.4	2.4e-20
AVL71401.1|1724680_1725295_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71402.1|1725296_1725836_-	TRAP transporter small permease	NA	NA	NA	NA	NA
AVL72166.1|1725935_1726898_-	TRAP transporter substrate-binding protein DctP	NA	NA	NA	NA	NA
AVL71403.1|1729123_1729594_+	formate dehydrogenase	NA	NA	NA	NA	NA
AVL71404.1|1729590_1731159_+	formate dehydrogenase	NA	NA	NA	NA	NA
AVL71405.1|1731152_1734017_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
AVL71406.1|1734227_1735238_-|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	28.4	8.4e-21
AVL71407.1|1735323_1735506_+	hypothetical protein	NA	NA	NA	NA	NA
AVL71408.1|1736135_1737422_-	amidase	NA	NA	NA	NA	NA
AVL71409.1|1737431_1738595_-	hypothetical protein	NA	NA	NA	NA	NA
AVL72167.1|1738706_1739324_-	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AVL71410.1|1739357_1740215_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVL71411.1|1740240_1741227_-	oxidoreductase	NA	NA	NA	NA	NA
AVL71412.1|1741257_1742478_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AVL71413.1|1743120_1743411_-	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	53.3	5.5e-18
AVL71414.1|1743649_1744891_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71415.1|1744986_1745724_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AVL71416.1|1745745_1748235_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	29.9	3.6e-57
AVL71417.1|1748318_1749080_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71418.1|1749207_1749807_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71419.1|1749882_1750431_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71420.1|1750446_1750947_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71421.1|1751012_1751765_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71422.1|1753211_1753730_+	hypothetical protein	NA	NA	NA	NA	NA
AVL71423.1|1753824_1754424_+	hypothetical protein	NA	NA	NA	NA	NA
AVL71424.1|1754715_1755507_-	DDE domain-containing protein	NA	NA	NA	NA	NA
AVL71425.1|1756078_1757575_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AVL71426.1|1757567_1757858_+	hypothetical protein	NA	NA	NA	NA	NA
AVL71427.1|1758923_1759700_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	55.2	1.1e-73
AVL71428.1|1760954_1761419_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
AVL71429.1|1761437_1761824_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
AVL71430.1|1761834_1762491_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
AVL71431.1|1762475_1763513_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71432.1|1763513_1766171_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71433.1|1766199_1768641_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.5	7.1e-50
AVL71434.1|1768775_1769126_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AVL71435.1|1769367_1770465_-	hypothetical protein	NA	NA	NA	NA	NA
AVL72168.1|1770742_1771057_+	hypothetical protein	NA	NA	NA	NA	NA
AVL71436.1|1771053_1771392_+	transcriptional regulator	NA	NA	NA	NA	NA
AVL71437.1|1771592_1771835_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
AVL71438.1|1772379_1773207_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	26.3	6.2e-14
AVL71439.1|1773203_1773518_-|transposase	transposase	transposase	NA	NA	NA	NA
AVL71440.1|1773987_1774257_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71441.1|1774576_1776427_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.6	4.3e-07
AVL71442.1|1776581_1777427_+	DUF455 domain-containing protein	NA	NA	NA	NA	NA
AVL71443.1|1777440_1778730_+	D-amino acid dehydrogenase small subunit	NA	NA	NA	NA	NA
AVL71444.1|1778742_1779213_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
AVL71445.1|1779237_1779756_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AVL71446.1|1779882_1780752_-	nicotinate-nucleotide diphosphorylase (carboxylating)	NA	NA	NA	NA	NA
AVL71447.1|1780845_1781712_-	M23 family peptidase	NA	Q8SBN9	Clostridium_phage	51.4	8.5e-22
AVL71448.1|1781745_1782087_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AVL71449.1|1782105_1783965_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.0	3.0e-101
AVL71450.1|1784013_1784517_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
AVL71451.1|1784534_1784858_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	56.1	1.6e-26
AVL71452.1|1784965_1785349_-	Fe-S cluster assembly scaffold IscU	NA	A0A2H4N7M4	Lake_Baikal_phage	84.7	6.3e-54
AVL71453.1|1785388_1786603_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
AVL71454.1|1786617_1787142_-	DNA-binding protein	NA	NA	NA	NA	NA
AVL71455.1|1787422_1787914_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
AVL71456.1|1788212_1788626_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.4	1.3e-44
AVL72169.1|1788647_1789871_+	cytosine methyltransferase	NA	A0A1B0VCD8	Salmonella_phage	61.5	6.4e-140
>prophage 129
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1795775	1797773	2511315		Acinetobacter_phage(100.0%)	1	NA	NA
AVL71461.1|1795775_1797773_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.4	9.4e-08
>prophage 130
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1801734	1806821	2511315	tRNA	Tupanvirus(50.0%)	4	NA	NA
AVL71467.1|1801734_1804353_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.7	2.1e-79
AVL71468.1|1804465_1804849_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71469.1|1804943_1805474_-	DUF2818 domain-containing protein	NA	NA	NA	NA	NA
AVL72170.1|1805711_1806821_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.6	2.3e-35
>prophage 131
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1811161	1811842	2511315		Synechococcus_phage(100.0%)	1	NA	NA
AVL71472.1|1811161_1811842_+	Fe2+-dependent dioxygenase	NA	Q5GQB0	Synechococcus_phage	30.6	3.4e-18
>prophage 132
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1815748	1817488	2511315		Aureococcus_anophage(100.0%)	1	NA	NA
AVL71476.1|1815748_1817488_+	ABC transporter ATP-binding protein/permease	NA	A0A076FI99	Aureococcus_anophage	25.5	4.4e-09
>prophage 133
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1845917	1847717	2511315		Acinetobacter_phage(100.0%)	1	NA	NA
AVL71506.1|1845917_1847717_-	Xaa-Pro aminopeptidase	NA	A0A0P0I8D7	Acinetobacter_phage	49.9	2.6e-166
>prophage 134
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1852233	1852821	2511315		Clostridium_phage(100.0%)	1	NA	NA
AVL71510.1|1852233_1852821_+	peptidoglycan endopeptidase	NA	A0A0A8WF62	Clostridium_phage	45.3	4.4e-22
>prophage 135
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1855911	1872350	2511315		Mycoplasma_phage(12.5%)	18	NA	NA
AVL71514.1|1855911_1857414_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.9	1.0e-51
AVL71515.1|1857429_1857918_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AVL71516.1|1857930_1858476_+	hypothetical protein	NA	NA	NA	NA	NA
AVL71517.1|1858657_1859347_+	BAX inhibitor (BI)-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	36.5	5.2e-22
AVL71518.1|1859411_1859978_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71519.1|1860243_1860849_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AVL71520.1|1860841_1861735_-	GTPase Era	NA	NA	NA	NA	NA
AVL71521.1|1861721_1862495_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	28.0	9.9e-14
AVL71522.1|1862503_1863319_-	signal peptidase I	NA	NA	NA	NA	NA
AVL71523.1|1863341_1865132_-	elongation factor 4	NA	A0A2K5B2A5	Erysipelothrix_phage	24.7	3.5e-22
AVL71524.1|1865214_1866759_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	33.2	2.3e-17
AVL71525.1|1866798_1867827_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71526.1|1867823_1868600_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71527.1|1868626_1869232_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	27.5	1.4e-07
AVL71528.1|1869228_1869669_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71529.1|1869678_1870908_-	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AVL71530.1|1871040_1871280_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	46.2	3.9e-09
AVL71531.1|1871606_1872350_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.1	3.2e-17
>prophage 136
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1879288	1880245	2511315		Bodo_saltans_virus(100.0%)	1	NA	NA
AVL71541.1|1879288_1880245_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	31.9	3.8e-07
>prophage 137
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1890841	1935721	2511315	coat,tRNA,transposase	Burkholderia_phage(27.27%)	38	NA	NA
AVL71547.1|1890841_1892188_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.8	2.7e-91
AVL71548.1|1892408_1893092_+	cytochrome B	NA	NA	NA	NA	NA
AVL71549.1|1893208_1894273_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
AVL71550.1|1894362_1895184_-	hydrolase	NA	M1I5T1	Acanthocystis_turfacea_Chlorella_virus	26.1	1.0e-08
AVL71551.1|1895220_1895880_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71552.1|1895902_1896319_-	DUF4878 domain-containing protein	NA	NA	NA	NA	NA
AVL71553.1|1896399_1898646_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
AVL71554.1|1898647_1904578_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71555.1|1904944_1905949_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVL71556.1|1906036_1906801_+	ABC transporter permease	NA	NA	NA	NA	NA
AVL71557.1|1906813_1907578_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.2	5.3e-36
AVL71558.1|1907613_1908921_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AVL71559.1|1909085_1909220_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AVL71560.1|1909408_1909669_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
AVL71561.1|1909668_1909890_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71562.1|1910267_1910498_+	hypothetical protein	NA	NA	NA	NA	NA
AVL71563.1|1910494_1910755_+|transposase	transposase	transposase	NA	NA	NA	NA
AVL71564.1|1910989_1912000_-|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	28.4	8.4e-21
AVL71565.1|1912370_1913006_-	virulence factor	NA	A0A1B0VCD8	Salmonella_phage	58.9	3.2e-58
AVL71566.1|1913047_1914103_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71567.1|1914099_1914441_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71568.1|1916034_1917045_-|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	28.4	8.4e-21
AVL71569.1|1917729_1918269_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71570.1|1918265_1919447_-	abortive infection protein	NA	NA	NA	NA	NA
AVL71571.1|1920744_1921059_-	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
AVL71572.1|1921315_1921798_-	DUF4411 domain-containing protein	NA	NA	NA	NA	NA
AVL71573.1|1921801_1922935_-	peptidase	NA	NA	NA	NA	NA
AVL71574.1|1923447_1925451_-	beta-3-deoxy-D-manno-oct-2-ulosonic acid transferase	NA	NA	NA	NA	NA
AVL71575.1|1925535_1926480_-|coat	spore coat protein	coat	A0A1V0SAE6	Catovirus	28.7	1.4e-22
AVL71576.1|1926567_1926858_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71577.1|1927167_1927995_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71578.1|1928002_1928581_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71579.1|1928571_1929360_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71580.1|1929701_1930478_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	57.7	1.7e-77
AVL71581.1|1930461_1931418_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	47.1	1.6e-74
AVL71582.1|1931499_1933020_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AVL72174.1|1933080_1934298_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.0	1.8e-49
AVL71583.1|1934710_1935721_-|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	28.4	2.4e-20
>prophage 138
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1940862	1943922	2511315		uncultured_virus(33.33%)	3	NA	NA
AVL71588.1|1940862_1942083_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	A0A218MKK1	uncultured_virus	24.3	7.0e-14
AVL71589.1|1942092_1943214_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	30.3	2.1e-25
AVL71590.1|1943265_1943922_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.5	3.5e-12
>prophage 139
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1951710	1952967	2511315		Phage_21(100.0%)	1	NA	NA
AVL71597.1|1951710_1952967_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	59.3	4.4e-11
>prophage 140
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1961606	1964807	2511315	transposase	Indivirus(50.0%)	3	NA	NA
AVL72176.1|1961606_1962275_-	phosphatidylserine decarboxylase family protein	NA	A0A1V0SDU9	Indivirus	30.6	1.6e-12
AVL71605.1|1962576_1963173_+	nitroreductase	NA	NA	NA	NA	NA
AVL71606.1|1963796_1964807_-|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	28.1	7.1e-20
>prophage 141
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1971358	1973086	2511315		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVL71613.1|1971358_1973086_-	acetolactate synthase, large subunit, biosynthetic type	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	28.6	2.7e-59
>prophage 142
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1985321	1986746	2511315		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVL71624.1|1985321_1986746_-	ATP-dependent helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.1	1.7e-56
>prophage 143
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	1994866	2000546	2511315		Prochlorococcus_phage(33.33%)	5	NA	NA
AVL71629.1|1994866_1996459_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	42.8	5.3e-62
AVL71630.1|1996488_1997034_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
AVL71631.1|1997054_1997630_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AVL71632.1|1997648_1998728_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.2	2.1e-06
AVL71633.1|1998719_2000546_-	DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	42.3	1.9e-76
>prophage 144
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2004900	2012270	2511315		uncultured_virus(40.0%)	9	NA	NA
AVL71639.1|2004900_2005188_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	7.9e-17
AVL71640.1|2005296_2006943_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	59.5	6.5e-172
AVL71641.1|2007120_2007966_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AVL71642.1|2007994_2008516_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	43.0	2.3e-22
AVL71643.1|2008515_2009052_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
AVL71644.1|2009063_2010044_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
AVL71645.1|2010043_2010487_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
AVL71646.1|2010498_2011038_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2I2L4Y7	Orpheovirus	42.0	4.5e-13
AVL72180.1|2011082_2012270_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	M4QPK3	Synechococcus_phage	40.8	2.7e-34
>prophage 145
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2016297	2017138	2511315		uncultured_Mediterranean_phage(100.0%)	2	NA	NA
AVL71651.1|2016297_2016852_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.2	5.1e-28
AVL71652.1|2016874_2017138_+	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.3e-21
>prophage 146
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2023153	2024086	2511315		Hokovirus(100.0%)	1	NA	NA
AVL72181.1|2023153_2024086_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	33.3	2.8e-39
>prophage 147
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2030362	2031772	2511315		Bacillus_phage(100.0%)	1	NA	NA
AVL71663.1|2030362_2031772_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.2	2.7e-49
>prophage 148
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2037843	2043782	2511315		Tupanvirus(25.0%)	6	NA	NA
AVL71668.1|2037843_2038869_-	LPS biosynthesis protein WbpP	NA	A0A2K9L4U8	Tupanvirus	46.4	2.5e-73
AVL71669.1|2038906_2040181_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	M1H3J6	Paramecium_bursaria_Chlorella_virus	29.2	7.6e-27
AVL71670.1|2040215_2041334_-	glycosyl transferase	NA	NA	NA	NA	NA
AVL71671.1|2041995_2042418_+	OsmC family protein	NA	NA	NA	NA	NA
AVL71672.1|2042421_2043258_+	thymidylate synthase	NA	E5DV96	Deep-sea_thermophilic_phage	66.0	3.5e-105
AVL71673.1|2043284_2043782_+	dihydrofolate reductase	NA	F8SJN4	Pseudomonas_phage	49.6	5.5e-26
>prophage 149
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2050491	2066078	2511315		uncultured_Mediterranean_phage(33.33%)	16	NA	NA
AVL71679.1|2050491_2051169_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	33.3	4.3e-13
AVL71680.1|2051225_2051708_-	D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	33.7	2.7e-17
AVL71681.1|2051710_2053258_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	A0A0R6PKQ6	Moraxella_phage	25.3	1.2e-29
AVL71682.1|2053269_2053887_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71683.1|2054005_2055040_-	hypothetical protein	NA	NA	NA	NA	NA
AVL72182.1|2055106_2055889_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
AVL71684.1|2056061_2056754_+	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.5e-34
AVL71685.1|2056811_2058104_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.5	1.8e-28
AVL71686.1|2058148_2059669_+	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
AVL71687.1|2059727_2060267_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.5	2.4e-30
AVL71688.1|2060368_2061358_+	D-arabinose 5-phosphate isomerase	NA	NA	NA	NA	NA
AVL71689.1|2061385_2061985_+	phenylphosphate carboxylase subunit delta	NA	A0A140XBD6	Dickeya_phage	42.2	3.8e-21
AVL71690.1|2062005_2062608_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AVL71691.1|2062616_2063222_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
AVL71692.1|2063230_2064025_+	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.4	7.3e-20
AVL71693.1|2064158_2066078_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.4	1.1e-114
>prophage 150
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2076925	2078092	2511315		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVL71704.1|2076925_2078092_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.1	5.6e-93
>prophage 151
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2088340	2092285	2511315		Corynebacterium_phage(25.0%)	5	NA	NA
AVL71716.1|2088340_2089222_+	RNase adapter RapZ	NA	A0A1P8D5W0	Corynebacterium_phage	31.9	3.5e-07
AVL71717.1|2089226_2089949_+	septal ring lytic transglycosylase RlpA family lipoprotein	NA	F5B3X9	Synechococcus_phage	61.9	4.9e-23
AVL71718.1|2090027_2090975_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	37.6	5.6e-35
AVL71719.1|2091037_2091604_+	YraN family protein	NA	NA	NA	NA	NA
AVL71720.1|2091697_2092285_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.9	1.1e-17
>prophage 152
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2102265	2103543	2511315		Pseudomonas_phage(100.0%)	1	NA	NA
AVL71728.1|2102265_2103543_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	33.4	5.8e-35
>prophage 153
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2110479	2116778	2511315		Leptospira_phage(100.0%)	2	NA	NA
AVL71734.1|2110479_2113614_-	multidrug transporter subunit MdtC	NA	S5VTK5	Leptospira_phage	21.4	1.2e-57
AVL71735.1|2113616_2116778_-	multidrug transporter subunit MdtC	NA	S5VTK5	Leptospira_phage	22.8	4.7e-62
>prophage 154
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2120302	2121370	2511315		Bacillus_virus(100.0%)	1	NA	NA
AVL71741.1|2120302_2121370_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.5	2.3e-29
>prophage 155
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2127469	2128729	2511315		Stx2-converting_phage(100.0%)	1	NA	NA
AVL71749.1|2127469_2128729_-	peptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	1.4e-57
>prophage 156
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2135481	2136363	2511315		Rhodococcus_phage(100.0%)	1	NA	NA
AVL71757.1|2135481_2136363_-	hypothetical protein	NA	A0A1I9SA48	Rhodococcus_phage	39.0	1.0e-35
>prophage 157
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2140271	2142068	2511315	tRNA	Catovirus(100.0%)	1	NA	NA
AVL71761.1|2140271_2142068_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	21.6	7.7e-09
>prophage 158
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2155053	2155458	2511315	protease	Pseudomonas_phage(100.0%)	1	NA	NA
AVL71769.1|2155053_2155458_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	37.4	3.2e-16
>prophage 159
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2160755	2162747	2511315		Pithovirus(50.0%)	2	NA	NA
AVL71776.1|2160755_2161961_+	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	30.9	2.2e-07
AVL71777.1|2161967_2162747_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.8	2.0e-22
>prophage 160
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2171580	2172375	2511315		Staphylococcus_phage(100.0%)	1	NA	NA
AVL71790.1|2171580_2172375_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.0	3.2e-15
>prophage 161
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2175561	2183222	2511315		Planktothrix_phage(25.0%)	7	NA	NA
AVL71794.1|2175561_2176494_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.4	1.1e-19
AVL71795.1|2176628_2178032_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	1.5e-52
AVL71796.1|2178181_2179075_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	38.9	1.8e-38
AVL71797.1|2179326_2180070_-	SCO family protein	NA	NA	NA	NA	NA
AVL71798.1|2180108_2180924_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AVL71799.1|2180960_2181800_+	hypothetical protein	NA	NA	NA	NA	NA
AVL71800.1|2181845_2183222_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	34.7	8.4e-32
>prophage 162
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2199960	2200713	2511315		Bacillus_virus(100.0%)	1	NA	NA
AVL71817.1|2199960_2200713_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.9	5.8e-27
>prophage 163
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2208100	2209204	2511315	transposase	Phage_Gifsy-1(100.0%)	1	NA	NA
AVL71822.1|2208100_2209204_-|transposase	transposase	transposase	Q9G0F2	Phage_Gifsy-1	33.5	5.2e-24
>prophage 164
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2223881	2225402	2511315		Aeromonas_phage(100.0%)	1	NA	NA
AVL71833.1|2223881_2225402_+	sodium/proline symporter PutP	NA	A0A240F3J2	Aeromonas_phage	23.3	4.4e-05
>prophage 165
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2232333	2236887	2511315		Bacillus_phage(50.0%)	4	NA	NA
AVL71839.1|2232333_2233125_-	ABC transporter	NA	W8CYL7	Bacillus_phage	25.9	2.7e-06
AVL71840.1|2233117_2234122_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AVL71841.1|2234131_2234596_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71842.1|2234922_2236887_+	DNA adenine methylase	NA	E0YIY3	Lactococcus_phage	45.3	3.6e-60
>prophage 166
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2242485	2243784	2511315		Hokovirus(100.0%)	1	NA	NA
AVL71847.1|2242485_2243784_+	sulfate adenylyltransferase	NA	A0A1V0SGC3	Hokovirus	26.7	2.3e-31
>prophage 167
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2248106	2253391	2511315		uncultured_virus(50.0%)	5	NA	NA
AVL71850.1|2248106_2249231_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	49.3	3.7e-102
AVL71851.1|2249335_2250673_+	MFS transporter	NA	NA	NA	NA	NA
AVL72188.1|2250646_2250790_-	hypothetical protein	NA	NA	NA	NA	NA
AVL71852.1|2251145_2251403_+	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
AVL71853.1|2251810_2253391_+	acyl-CoA synthetase	NA	A0A2K9KZV5	Tupanvirus	20.8	1.3e-15
>prophage 168
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2270658	2279105	2511315		Tupanvirus(50.0%)	7	NA	NA
AVL71876.1|2270658_2272884_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.2	1.8e-137
AVL72189.1|2273078_2273552_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AVL71877.1|2273554_2275081_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AVL71878.1|2275077_2275632_+	cysteine hydrolase	NA	A0A2K9L6K4	Tupanvirus	32.7	9.6e-11
AVL71879.1|2275701_2276151_-	universal stress protein	NA	NA	NA	NA	NA
AVL72190.1|2276250_2277726_-	catalase	NA	A0A2K9L572	Tupanvirus	43.3	3.0e-83
AVL71880.1|2277917_2279105_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.5	1.9e-24
>prophage 169
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2282926	2285482	2511315		Acanthamoeba_polyphaga_lentillevirus(100.0%)	1	NA	NA
AVL71883.1|2282926_2285482_+	DNA topoisomerase III	NA	J3E777	Acanthamoeba_polyphaga_lentillevirus	25.4	2.3e-22
>prophage 170
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2289661	2290474	2511315		Bacillus_virus(100.0%)	1	NA	NA
AVL71889.1|2289661_2290474_-	mannosyltransferase	NA	G3M9Y6	Bacillus_virus	35.9	1.1e-28
>prophage 171
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2294083	2297465	2511315		Vibrio_phage(50.0%)	2	NA	NA
AVL71894.1|2294083_2295274_-	elongation factor Tu	NA	M4M9V7	Vibrio_phage	64.7	9.9e-05
AVL71895.1|2295365_2297465_-	elongation factor G	NA	A0A1S5SF82	Streptococcus_phage	26.1	3.5e-61
>prophage 172
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2309213	2310446	2511315		Catovirus(100.0%)	1	NA	NA
AVL71907.1|2309213_2310446_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.1	3.7e-103
>prophage 173
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2329809	2338202	2511315		Vibrio_phage(50.0%)	2	NA	NA
AVL71926.1|2329809_2334087_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	24.7	2.6e-71
AVL71927.1|2334086_2338202_-	DNA-directed RNA polymerase subunit beta	NA	E3T4Z4	Cafeteria_roenbergensis_virus	22.3	3.7e-22
>prophage 174
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2342097	2345887	2511315		Vibrio_phage(33.33%)	3	NA	NA
AVL71934.1|2342097_2343288_-	elongation factor Tu	NA	M4M9V7	Vibrio_phage	64.7	9.9e-05
AVL72192.1|2344014_2344989_-	chromosome partitioning protein ParB	NA	I3NLC2	Bifidobacterium_phage	33.6	1.2e-13
AVL71935.1|2345107_2345887_-	chromosome partitioning protein	NA	Q8JL10	Natrialba_phage	28.1	3.3e-17
>prophage 175
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2354404	2355622	2511315	transposase	uncultured_virus(100.0%)	1	NA	NA
AVL72193.1|2354404_2355622_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.9	2.5e-48
>prophage 176
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2363035	2364547	2511315		Staphylococcus_phage(100.0%)	1	NA	NA
AVL71950.1|2363035_2364547_+	AMP-dependent synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	28.1	3.1e-35
>prophage 177
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2367793	2368872	2511315	transposase	Leptospira_phage(100.0%)	1	NA	NA
AVL71954.1|2367793_2368872_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.1	5.6e-47
>prophage 178
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2373778	2374789	2511315	transposase	Burkholderia_phage(100.0%)	1	NA	NA
AVL71960.1|2373778_2374789_+|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	28.4	8.4e-21
>prophage 179
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2383685	2387306	2511315		Rhizobium_phage(50.0%)	2	NA	NA
AVL71969.1|2383685_2384840_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	32.6	2.2e-41
AVL71970.1|2384855_2387306_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	35.5	1.2e-116
>prophage 180
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2391290	2393150	2511315		Virus_Rctr197k(100.0%)	1	NA	NA
AVL71974.1|2391290_2393150_+	ATP-dependent helicase	NA	A0A1P8DIG0	Virus_Rctr197k	37.8	2.4e-05
>prophage 181
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2396172	2399574	2511315		Brazilian_cedratvirus(100.0%)	2	NA	NA
AVL71978.1|2396172_2398887_+	hypothetical protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	2.5e-19
AVL71979.1|2398887_2399574_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.8	3.8e-09
>prophage 182
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2413382	2422790	2511315	transposase	Ostreococcus_lucimarinus_virus(20.0%)	8	NA	NA
AVL71987.1|2413382_2415137_-	acetolactate synthase, large subunit, biosynthetic type	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.6	8.2e-56
AVL71988.1|2415321_2416143_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
AVL71989.1|2416142_2416679_+	SET domain-containing protein	NA	B5LWM5	Feldmannia_species_virus	32.3	7.6e-05
AVL71990.1|2416791_2417802_+|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	28.7	2.9e-21
AVL71991.1|2418009_2419269_-	glycine/betaine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	8.3e-26
AVL71992.1|2419265_2420123_-	ABC transporter permease	NA	NA	NA	NA	NA
AVL71993.1|2420298_2421306_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVL71994.1|2421773_2422790_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	4.9e-29
>prophage 183
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2432264	2433872	2511315		Pike_perch_iridovirus(100.0%)	1	NA	NA
AVL72002.1|2432264_2433872_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	68.1	3.3e-19
>prophage 184
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2451836	2457774	2511315		Tupanvirus(33.33%)	6	NA	NA
AVL72017.1|2451836_2453462_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	35.8	3.2e-14
AVL72018.1|2453525_2454149_-	hypothetical protein	NA	NA	NA	NA	NA
AVL72019.1|2454305_2454920_+	LemA family protein	NA	A0A0C5K8T5	Enterococcus_phage	26.0	2.2e-08
AVL72020.1|2454937_2455882_+	hypothetical protein	NA	NA	NA	NA	NA
AVL72195.1|2455871_2456372_+	hypothetical protein	NA	NA	NA	NA	NA
AVL72021.1|2456376_2457774_-	DUF3482 domain-containing protein	NA	A0A0R6PKQ1	Moraxella_phage	38.8	2.0e-60
>prophage 185
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2461042	2469307	2511315		Moumouvirus(20.0%)	10	NA	NA
AVL72024.1|2461042_2462128_+	hypothetical protein	NA	M1PNU1	Moumouvirus	35.4	1.4e-37
AVL72025.1|2462151_2462658_+	hypothetical protein	NA	NA	NA	NA	NA
AVL72026.1|2463065_2464121_+	DNA cytosine methyltransferase	NA	Q6DMX0	Streptococcus_phage	48.3	5.6e-76
AVL72196.1|2464126_2465233_+	HpaII family restriction endonuclease	NA	NA	NA	NA	NA
AVL72197.1|2465250_2465691_+	very short patch repair endonuclease	NA	I6NSG0	Burkholderia_phage	44.1	1.9e-22
AVL72027.1|2465758_2466085_-	DUF1232 domain-containing protein	NA	A0A2I7S9Z5	Vibrio_phage	32.3	1.9e-06
AVL72028.1|2466287_2467079_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVL72029.1|2467099_2467792_+	histidine ABC transporter permease	NA	NA	NA	NA	NA
AVL72030.1|2467797_2468547_+	histidine ABC transporter permease HisM	NA	NA	NA	NA	NA
AVL72031.1|2468539_2469307_+	histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP	NA	G9BWD6	Planktothrix_phage	35.0	6.4e-21
>prophage 186
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2480936	2486956	2511315	plate,transposase	Burkholderia_phage(50.0%)	3	NA	NA
AVL72042.1|2480936_2481947_+|transposase	IS5/IS1182 family transposase	transposase	E5E3P6	Burkholderia_phage	28.4	8.4e-21
AVL72043.1|2483128_2484172_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVL72044.1|2484316_2486956_+	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	44.0	4.4e-53
>prophage 187
CP027417	Oligella urethralis strain FDAARGOS_329 chromosome, complete genome	2511315	2508638	2510321	2511315		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVL72062.1|2508638_2510321_-	thiol reductant ABC exporter subunit CydC	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.1	4.3e-14
