The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	0	5949	4607960		Ralstonia_phage(100.0%)	1	NA	NA
AVM02361.1|3840_5949_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	3.3e-27
>prophage 2
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	10857	12960	4607960		Salmonella_phage(100.0%)	1	NA	NA
AVM02368.1|10857_12960_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.0	3.4e-133
>prophage 3
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	20092	30266	4607960	protease,transposase	Mycoplasma_phage(20.0%)	9	NA	NA
AVM02378.1|20092_21106_-	polyamine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
AVM02379.1|21123_22269_-	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVM02380.1|22513_23920_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVM02381.1|23998_24415_-	antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
AVM02382.1|24460_24637_-	mRNA interferase HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
AVM02383.1|24858_25089_+	DUF2554 domain-containing protein	NA	NA	NA	NA	NA
AVM02384.1|25180_27142_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.3	2.7e-23
AVM02385.1|27803_29018_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
AVM02386.1|29057_30266_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.0	1.7e-206
>prophage 4
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	42073	43022	4607960		Moraxella_phage(50.0%)	2	NA	NA
AVM02398.1|42073_42247_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
AVM02399.1|42491_43022_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 5
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	47738	51641	4607960		Klosneuvirus(100.0%)	1	NA	NA
AVM02403.1|47738_51641_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.4	8.4e-53
>prophage 6
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	60169	61332	4607960	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
AVM02409.1|60169_61332_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 7
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	69583	70573	4607960		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVM02415.1|69583_70573_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 8
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	75533	100299	4607960	holin,tRNA,integrase,tail	Escherichia_phage(40.0%)	34	83289:83304	105900:105915
AVM02420.1|75533_76667_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
AVM02421.1|76807_77242_+	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
AVM02422.1|78202_78436_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AVM02423.1|78751_79342_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AVM02424.1|79569_79863_-	hypothetical protein	NA	NA	NA	NA	NA
AVM02425.1|79875_80154_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	2.9e-24
AVM06563.1|80150_82175_-|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.3	3.2e-181
AVM02426.1|82474_83239_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.5	3.9e-87
83289:83304	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
AVM02427.1|83343_83775_-	chromosome partitioning protein ParB	NA	A0A0R6PD10	Moraxella_phage	58.7	3.3e-19
AVM02428.1|83692_83974_-	hypothetical protein	NA	NA	NA	NA	NA
AVM02429.1|83912_85370_-	potassium transporter TrkG	NA	NA	NA	NA	NA
AVM02430.1|85566_85752_-	Spanin from lambdoid prophage Rac, outer membrane subunit	NA	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
AVM02431.1|85968_86502_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.0	4.8e-100
AVM02432.1|86607_86880_+	hypothetical protein	NA	NA	NA	NA	NA
AVM02433.1|86845_87190_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
AVM02434.1|87194_87407_-|holin	holin	holin	A5LH82	Enterobacteria_phage	96.9	3.0e-29
AVM02435.1|87405_87540_+	hypothetical protein	NA	NA	NA	NA	NA
AVM02436.1|87550_87706_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AVM02437.1|87702_88191_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
AVM02438.1|88225_88504_-	hypothetical protein	NA	NA	NA	NA	NA
AVM02439.1|88632_88854_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	97.3	1.7e-35
AVM06564.1|88853_89024_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AVM02440.1|89098_89374_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
AVM02441.1|89475_92076_+	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.6	7.9e-249
AVM02442.1|92068_92878_+	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.1	9.8e-105
AVM02443.1|92934_93129_+	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
AVM02444.1|93121_93331_+	double-strand break reduction protein	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
AVM02445.1|93409_93625_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AVM02446.1|93626_94862_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
AVM02447.1|94913_95849_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AVM02448.1|95977_97351_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AVM02449.1|97380_97554_-	hypothetical protein	NA	NA	NA	NA	NA
AVM02450.1|97828_98812_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AVM06565.1|99066_100299_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.0	3.1e-17
105900:105915	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
>prophage 9
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	106625	107141	4607960		Streptococcus_phage(100.0%)	1	NA	NA
AVM02456.1|106625_107141_+	methylated-DNA--protein-cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 10
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	123760	124843	4607960		Indivirus(100.0%)	1	NA	NA
AVM02473.1|123760_124843_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.4	4.0e-13
>prophage 11
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	138848	140114	4607960		Klosneuvirus(100.0%)	1	NA	NA
AVM02488.1|138848_140114_-	4-aminobutyrate aminotransferase PuuE	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.0e-24
>prophage 12
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	153028	158685	4607960		Bacillus_virus(50.0%)	5	NA	NA
AVM02501.1|153028_153835_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
AVM02502.1|153902_154256_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
AVM02503.1|154623_155412_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AVM02504.1|155555_156683_+	CMD domain-containing protein	NA	NA	NA	NA	NA
AVM02505.1|156750_158685_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.6	6.9e-32
>prophage 13
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	166499	167090	4607960		Staphylococcus_phage(100.0%)	1	NA	NA
AVM02516.1|166499_167090_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 14
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	172014	177306	4607960	protease	Tupanvirus(33.33%)	5	NA	NA
AVM02522.1|172014_174612_-	DNA topoisomerase 1	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
AVM02523.1|174734_174947_-	hypothetical protein	NA	NA	NA	NA	NA
AVM02524.1|174991_175243_+	hypothetical protein	NA	NA	NA	NA	NA
AVM02525.1|175278_176328_-|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
AVM02526.1|176547_177306_+	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
>prophage 15
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	185053	188011	4607960		Acinetobacter_phage(100.0%)	2	NA	NA
AVM02532.1|185053_186649_+	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AVM06570.1|186652_188011_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
>prophage 16
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	199669	201684	4607960		Bacillus_virus(50.0%)	2	NA	NA
AVM02547.1|199669_200674_-	oligopeptide transport ATP-binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
AVM02548.1|200670_201684_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 17
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	210094	212781	4607960		Citrobacter_phage(50.0%)	3	NA	NA
AVM02554.1|210094_210712_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.7e-53
AVM02555.1|211315_211729_+	DNA-binding protein H-NS	NA	NA	NA	NA	NA
AVM02556.1|211872_212781_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
>prophage 18
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	216390	220761	4607960		Synechococcus_phage(50.0%)	4	NA	NA
AVM02559.1|216390_217233_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
AVM02560.1|217838_218516_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
AVM02561.1|218515_219226_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
AVM02562.1|219222_220761_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 19
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	232016	238818	4607960		Spodoptera_litura_granulovirus(33.33%)	9	NA	NA
AVM02570.1|232016_232247_-	cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
AVM02571.1|232516_233617_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AVM02572.1|234021_234129_+	small toxic polypeptide LdrB	NA	NA	NA	NA	NA
AVM02573.1|234529_234664_+	toxin Ldr, type I toxin-antitoxin system family protein	NA	NA	NA	NA	NA
AVM02574.1|234810_235665_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
AVM02575.1|235700_236510_-	protein sirB1	NA	NA	NA	NA	NA
AVM02576.1|236513_236906_-	hypothetical protein	NA	NA	NA	NA	NA
AVM02577.1|236902_237736_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVM02578.1|237735_238818_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 20
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	241954	244706	4607960		Tupanvirus(50.0%)	2	NA	NA
AVM02582.1|241954_242902_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
AVM02583.1|243026_244706_+	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
>prophage 21
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	271375	273063	4607960		Salmonella_phage(50.0%)	2	NA	NA
AVM02606.1|271375_272644_-	protein UmuC	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
AVM02607.1|272643_273063_-	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 22
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	289759	293488	4607960		Enterobacteria_phage(66.67%)	4	NA	NA
AVM02629.1|289759_290491_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
AVM02630.1|290711_291116_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AVM02631.1|291811_292135_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
AVM02632.1|292237_293488_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 23
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	296624	297995	4607960		Bodo_saltans_virus(100.0%)	1	NA	NA
AVM02636.1|296624_297995_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
>prophage 24
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	303015	304993	4607960		Mycoplasma_phage(100.0%)	2	NA	NA
AVM02641.1|303015_304152_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
AVM02642.1|304135_304993_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
>prophage 25
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	308248	312766	4607960		Vibrio_phage(50.0%)	3	NA	NA
AVM02646.1|308248_309088_-	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.7e-23
AVM02647.1|310820_312065_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AVM02648.1|312064_312766_-	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
>prophage 26
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	320055	320313	4607960		Erwinia_phage(100.0%)	1	NA	NA
AVM02653.1|320055_320313_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 27
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	332644	334287	4607960		Streptococcus_virus(50.0%)	2	NA	NA
AVM02666.1|332644_333649_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
AVM02667.1|333645_334287_-	thymidylate kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 28
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	337559	337796	4607960		Ralstonia_phage(100.0%)	1	NA	NA
AVM02671.1|337559_337796_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 29
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	351098	352040	4607960		Brevibacillus_phage(100.0%)	1	NA	NA
AVM02684.1|351098_352040_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 30
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	367920	368166	4607960		Salmonella_phage(100.0%)	1	NA	NA
AVM02704.1|367920_368166_+	DNA-damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 31
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	372828	373749	4607960		Morganella_phage(100.0%)	1	NA	NA
AVM02711.1|372828_373749_+	lipid A biosynthesis lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 32
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	383057	383591	4607960		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
AVM02719.1|383057_383591_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 33
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	387726	388560	4607960		Pelagibacter_phage(100.0%)	1	NA	NA
AVM02728.1|387726_388560_+	curli production assembly/transport component CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 34
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	392257	394819	4607960	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
AVM02732.1|392257_393419_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AVM02733.1|393460_394819_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	1.9e-20
>prophage 35
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	401638	402703	4607960		Cronobacter_phage(100.0%)	1	NA	NA
AVM02738.1|401638_402703_-	phosphate starvation protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
>prophage 36
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	417341	419616	4607960		Enterobacteria_phage(100.0%)	3	NA	NA
AVM02752.1|417341_417836_+	FMN reductase	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
AVM02753.1|417856_419185_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	1.3e-234
AVM02754.1|419442_419616_-	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 37
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	423914	436228	4607960		Klosneuvirus(20.0%)	13	NA	NA
AVM02760.1|423914_424835_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
AVM02761.1|424834_425140_+	chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
AVM02762.1|425291_425891_-	molecular chaperone TorD	NA	NA	NA	NA	NA
AVM02763.1|425887_428434_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	2.0e-71
AVM02764.1|428433_429606_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
AVM02765.1|429735_430428_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
AVM02766.1|430400_431429_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
AVM02767.1|431511_434256_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	2.7e-37
AVM02768.1|434327_435401_+	electron transporter YccM	NA	NA	NA	NA	NA
AVM02769.1|435448_435622_-	protein GnsA	NA	NA	NA	NA	NA
AVM02770.1|435611_435842_-	cold-shock protein	NA	NA	NA	NA	NA
AVM06585.1|435816_436005_-	cold-shock protein	NA	NA	NA	NA	NA
AVM02771.1|436015_436228_-	cold-shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 38
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	455470	456130	4607960		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVM02788.1|455470_456130_+	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	6.8e-48
>prophage 39
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	460363	462418	4607960		Bacillus_phage(100.0%)	1	NA	NA
AVM02796.1|460363_462418_-	helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 40
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	475017	476925	4607960		Tupanvirus(100.0%)	1	NA	NA
AVM02808.1|475017_476925_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
>prophage 41
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	493620	504588	4607960	tRNA	Bacillus_virus(20.0%)	9	NA	NA
AVM02824.1|493620_494388_+	aliphatic sulfonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
AVM02825.1|494430_497043_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
AVM02826.1|497308_498511_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AVM02827.1|498679_500080_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
AVM02828.1|500680_501769_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	54.3	5.3e-98
AVM02829.1|501784_501967_-	hypothetical protein	NA	NA	NA	NA	NA
AVM02830.1|501953_503144_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AVM02831.1|503365_504013_-	hypothetical protein	NA	NA	NA	NA	NA
AVM06590.1|504039_504588_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 42
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	519293	523835	4607960		Bacillus_phage(100.0%)	3	NA	NA
AVM02843.1|519293_521042_-	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
AVM02844.1|521078_523343_-	ComEC family protein	NA	NA	NA	NA	NA
AVM02845.1|523550_523835_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 43
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	528921	530010	4607960		Streptococcus_phage(100.0%)	1	NA	NA
AVM02850.1|528921_530010_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 44
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	534107	537322	4607960		Tetraselmis_virus(100.0%)	2	NA	NA
AVM02854.1|534107_536390_+	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AVM02855.1|536581_537322_+	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 45
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	543630	623269	4607960	capsid,tail,protease,tRNA,integrase,plate,portal	Salmonella_phage(44.68%)	83	539904:539919	626356:626371
539904:539919	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
AVM02862.1|543630_544248_-	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AVM02863.1|544258_546703_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
AVM02864.1|546941_548234_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AVM02865.1|548324_549668_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AVM02866.1|549678_550290_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AVM02867.1|550444_554473_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AVM02868.1|554607_555102_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AVM02869.1|555646_556612_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
AVM02870.1|556734_558501_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
AVM02871.1|558501_560223_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
AVM02872.1|560264_560969_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVM02873.1|561253_561472_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AVM06591.1|561894_562146_+	hypothetical protein	NA	NA	NA	NA	NA
AVM02874.1|562154_564431_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	2.5e-166
AVM02875.1|564461_564782_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AVM02876.1|565104_565329_+	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AVM02877.1|565401_567348_-	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
AVM02878.1|567344_568460_-	MacA family efflux pump subunit	NA	NA	NA	NA	NA
AVM02879.1|568574_569567_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AVM02880.1|569563_571222_-	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
AVM02881.1|571646_572342_+	aquaporin	NA	NA	NA	NA	NA
AVM02882.1|572836_573736_+	transporter	NA	NA	NA	NA	NA
AVM02883.1|573879_575532_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AVM02884.1|575543_576512_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVM02885.1|576644_578363_+	pyruvate dehydrogenase [ubiquinone]	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
AVM02886.1|578399_579401_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AVM02887.1|579411_580842_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVM06592.1|580940_581954_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVM02888.1|581950_582781_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
AVM02889.1|582777_583101_-	hypothetical protein	NA	NA	NA	NA	NA
AVM02890.1|583226_583742_+	lipoprotein	NA	NA	NA	NA	NA
AVM02891.1|583959_584688_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
AVM02892.1|584705_585437_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVM02893.1|585443_586160_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AVM02894.1|586159_586828_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AVM02895.1|587118_587850_+	arginine/ornithine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVM02896.1|588048_589176_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
AVM02897.1|589216_589705_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AVM02898.1|589764_590610_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AVM02899.1|590606_591560_-	putrescine ABC transporter permease	NA	NA	NA	NA	NA
AVM02900.1|591569_592703_-	putrescine transport ATP-binding protein PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
AVM02901.1|592797_593910_-	putrescine-binding periplasmic protein	NA	NA	NA	NA	NA
AVM02902.1|593893_594055_-	putrescine/spermidine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVM02903.1|594260_594737_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AVM02904.1|594824_595727_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
AVM02905.1|595787_596510_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AVM02906.1|596493_596781_-	hypothetical protein	NA	NA	NA	NA	NA
AVM02907.1|596940_597198_+	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
AVM02908.1|597227_597605_-	hypothetical protein	NA	NA	NA	NA	NA
AVM02909.1|597874_599560_+	transporter	NA	NA	NA	NA	NA
AVM02910.1|599795_600014_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AVM06593.1|600775_601315_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	62.5	1.5e-56
AVM02911.1|601314_601917_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	2.3e-98
AVM02912.1|601888_602326_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	75.0	1.7e-55
AVM02913.1|602327_603950_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	78.5	6.2e-151
AVM02914.1|603946_604552_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	2.3e-111
AVM02915.1|604544_605453_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
AVM02916.1|605439_605799_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	8.0e-51
AVM02917.1|605795_606374_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	3.6e-93
AVM02918.1|606477_607284_+	hypothetical protein	NA	NA	NA	NA	NA
AVM02919.1|607225_607672_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.7	7.6e-59
AVM02920.1|607664_608096_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	3.8e-71
AVM06594.1|608058_608304_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.5	1.4e-30
AVM02921.1|608191_608620_-	hypothetical protein	NA	E5G6N2	Salmonella_phage	88.7	8.1e-58
AVM02922.1|608756_609509_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	94.7	3.1e-113
AVM02923.1|609651_611418_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
AVM02924.1|611417_612443_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
AVM02925.1|612460_613423_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
AVM02926.1|613585_614509_-	hypothetical protein	NA	NA	NA	NA	NA
AVM02927.1|614981_615317_+	hypothetical protein	NA	NA	NA	NA	NA
AVM02928.1|615509_615815_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AVM02929.1|615753_615942_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
AVM02930.1|616094_618509_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.3	0.0e+00
AVM02931.1|618505_619363_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	92.6	5.4e-154
AVM02932.1|619359_619587_-	hypothetical protein	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
AVM02933.1|619586_619820_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
AVM02934.1|619887_620229_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
AVM02935.1|620192_620393_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
AVM02936.1|620400_620910_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AVM02937.1|620942_621164_-	regulator	NA	NA	NA	NA	NA
AVM02938.1|621289_621859_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	3.8e-39
AVM02939.1|621874_622066_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
AVM02940.1|622252_623269_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	56.7	3.2e-105
626356:626371	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 46
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	629919	631122	4607960		Stx2-converting_phage(100.0%)	1	NA	NA
AVM06595.1|629919_631122_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
>prophage 47
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	642457	644329	4607960		Planktothrix_phage(100.0%)	1	NA	NA
AVM02957.1|642457_644329_-	glutathione import ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 48
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	647544	655813	4607960		Synechococcus_phage(33.33%)	6	NA	NA
AVM02961.1|647544_648207_-	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.2	8.2e-25
AVM02962.1|648337_649237_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
AVM02963.1|649242_651675_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
AVM02964.1|651820_652636_+	sugar phosphatase YbiV	NA	NA	NA	NA	NA
AVM02965.1|652787_654053_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
AVM02966.1|654220_655813_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 49
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	660810	666035	4607960		Escherichia_phage(33.33%)	7	NA	NA
AVM02972.1|660810_661326_-	outer membrane protein X	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
AVM02973.1|661678_662566_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AVM02974.1|662864_663368_+	DNA starvation/stationary phase protection protein	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
AVM02975.1|663653_663845_+	hypothetical protein	NA	NA	NA	NA	NA
AVM02976.1|663771_664518_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVM02977.1|664656_665316_+	glutamine ABC transporter permease	NA	NA	NA	NA	NA
AVM02978.1|665312_666035_+	glutamine transport ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
>prophage 50
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	669575	684531	4607960		Erwinia_phage(14.29%)	13	NA	NA
AVM02981.1|669575_669980_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	2.6e-05
AVM02982.1|670244_672527_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
AVM02983.1|672568_673246_+	PKHD-type hydroxylase	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
AVM02984.1|673319_673586_+	DksA/TraR family C4-type zinc finger protein	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
AVM02985.1|673850_674111_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVM02986.1|674339_675425_-	dehydrogenase	NA	NA	NA	NA	NA
AVM02987.1|675565_676528_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AVM02988.1|676555_678706_-	ATP-dependent helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
AVM02989.1|678825_679308_+	swarming motility protein YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
AVM02990.1|679539_680904_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
AVM06596.1|681132_681804_+	transcriptional regulator	NA	NA	NA	NA	NA
AVM02991.1|681803_682802_+	secretion protein HlyD	NA	NA	NA	NA	NA
AVM02992.1|682794_684531_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 51
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	695127	696036	4607960		Streptococcus_phage(100.0%)	1	NA	NA
AVM03006.1|695127_696036_+	hypothetical protein	NA	A1IMD5	Streptococcus_phage	31.5	8.3e-28
>prophage 52
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	702517	716449	4607960	terminase,integrase,tail	Escherichia_phage(41.67%)	16	704433:704447	716523:716537
AVM03012.1|702517_703807_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
AVM03013.1|703865_704342_+	kinase inhibitor	NA	NA	NA	NA	NA
AVM03014.1|704256_704436_+	hypothetical protein	NA	NA	NA	NA	NA
704433:704447	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
AVM03015.1|705125_706271_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	29.9	1.6e-20
AVM03016.1|706308_707646_-	hypothetical protein	NA	A0A2D2W3A0	Escherichia_phage	56.4	5.5e-145
AVM03017.1|708038_709064_+	acyltransferase	NA	G9L6E5	Escherichia_phage	28.9	2.4e-15
AVM03018.1|709105_709501_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	36.6	1.6e-12
AVM03019.1|710769_712392_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	0.0e+00
AVM03020.1|712394_712946_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	69.8	7.2e-67
AVM03021.1|712899_713514_+	hypothetical protein	NA	NA	NA	NA	NA
AVM03022.1|713646_713832_-	hypothetical protein	NA	NA	NA	NA	NA
AVM03023.1|714341_714626_+	DUF4752 domain-containing protein	NA	G9L657	Escherichia_phage	94.7	3.2e-47
AVM03024.1|714618_714903_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
AVM03025.1|714975_715143_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	2.9e-27
AVM03026.1|715182_715401_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AVM03027.1|715378_716449_+|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
716523:716537	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 53
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	726159	732733	4607960		Planktothrix_phage(33.33%)	8	NA	NA
AVM03035.1|726159_727218_-	molybdenum import ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
AVM03036.1|727220_727910_-	molybdenum ABC transporter permease	NA	NA	NA	NA	NA
AVM03037.1|727909_728683_-	molybdate-binding periplasmic protein	NA	NA	NA	NA	NA
AVM03038.1|728704_728914_-	hypothetical protein	NA	NA	NA	NA	NA
AVM03039.1|728849_728999_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
AVM03040.1|729127_729916_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AVM03041.1|729983_731456_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
AVM03042.1|731716_732733_+	UDP-glucose 4-epimerase	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
>prophage 54
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	737086	740606	4607960		Klebsiella_phage(33.33%)	4	NA	NA
AVM03047.1|737086_738139_-	phospho-2-dehydro-3-deoxyheptonate aldolase Phe-sensitive	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
AVM03048.1|738454_738835_+	hypothetical protein	NA	NA	NA	NA	NA
AVM03049.1|738948_739890_+	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	3.7e-23
AVM03050.1|739886_740606_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
>prophage 55
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	776172	776964	4607960		Kaumoebavirus(100.0%)	1	NA	NA
AVM03082.1|776172_776964_-	endonuclease VII	NA	A0A1V0CNR6	Kaumoebavirus	31.5	2.2e-08
>prophage 56
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	780342	783284	4607960		Acinetobacter_phage(50.0%)	2	NA	NA
AVM03087.1|780342_781824_+	dipeptide permease D	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
AVM03088.1|781862_783284_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	2.3e-61
>prophage 57
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	788897	799235	4607960		uncultured_Caudovirales_phage(25.0%)	9	NA	NA
AVM03095.1|788897_790562_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	3.8e-26
AVM03096.1|790558_790708_-	rhsC element core protein RshC	NA	NA	NA	NA	NA
AVM03097.1|790950_791157_-	DUF2517 domain-containing protein	NA	NA	NA	NA	NA
AVM03098.1|791469_791559_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AVM03099.1|791558_793232_+	potassium-transporting ATPase A chain	NA	NA	NA	NA	NA
AVM03100.1|793254_795303_+	K(+)-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.1	6.4e-28
AVM03101.1|795311_795884_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AVM03102.1|795876_798561_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
AVM03103.1|798557_799235_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.1	3.4e-26
>prophage 58
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	807488	808253	4607960		Mycobacterium_phage(100.0%)	1	NA	NA
AVM03110.1|807488_808253_+	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 59
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	812533	816347	4607960	tRNA	Escherichia_phage(50.0%)	2	NA	NA
AVM03116.1|812533_814198_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
AVM03117.1|814400_816347_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
>prophage 60
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	821113	822778	4607960		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVM03123.1|821113_822778_+	asparagine synthetase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	7.9e-85
>prophage 61
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	826764	827844	4607960		Pseudomonas_phage(100.0%)	1	NA	NA
AVM03126.1|826764_827844_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 62
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	835789	840768	4607960	transposase	Planktothrix_phage(33.33%)	4	NA	NA
AVM03134.1|835789_836176_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	2.1e-09
AVM03135.1|836172_837542_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
AVM03136.1|838078_839014_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
AVM03137.1|839097_840768_+	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.7	8.0e-77
>prophage 63
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	844909	847492	4607960	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
AVM03140.1|844909_847492_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	2.3e-184
>prophage 64
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	854502	856942	4607960		Synechococcus_phage(50.0%)	2	NA	NA
AVM03149.1|854502_855591_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
AVM03150.1|855730_856942_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 65
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	861756	862404	4607960		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVM03159.1|861756_862140_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
AVM03160.1|862194_862404_-	cold-shock protein CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 66
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	878358	884833	4607960		Morganella_phage(25.0%)	6	NA	NA
AVM03177.1|878358_878787_+	universal stress protein G	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
AVM03178.1|878907_880473_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
AVM03179.1|880717_881281_-	peroxiredoxin	NA	NA	NA	NA	NA
AVM03180.1|881652_882414_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
AVM03181.1|883169_884231_+	DUF3440 domain-containing protein	NA	L0P6Z6	Lactobacillus_phage	31.9	2.7e-46
AVM03182.1|884203_884833_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	3.8e-56
>prophage 67
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	899369	905412	4607960		Klosneuvirus(50.0%)	3	NA	NA
AVM03196.1|899369_900185_+	ferric enterobactin transport ATP-binding protein FepC	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
AVM03197.1|900181_901315_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
AVM03198.1|901530_905412_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
>prophage 68
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	910392	965348	4607960	tail,protease,lysis,integrase,transposase	Enterobacteria_phage(42.86%)	60	940823:940869	965362:965408
AVM03202.1|910392_911505_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AVM03203.1|911581_911734_-	protein HokE	NA	NA	NA	NA	NA
AVM06603.1|911831_911960_-	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	3.3e-15
AVM03204.1|913842_913992_-	hypothetical protein	NA	NA	NA	NA	NA
AVM03205.1|914003_915122_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AVM03206.1|915187_915436_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
AVM03207.1|915500_915869_+	hypothetical protein	NA	NA	NA	NA	NA
AVM03208.1|915962_916616_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
AVM03209.1|916723_917971_+	miniconductance mechanosensitive channel YbdG	NA	NA	NA	NA	NA
AVM03210.1|918038_919415_-	phenylalanine-specific permease	NA	NA	NA	NA	NA
AVM03211.1|919516_922660_-	cation efflux system protein CusA	NA	S5VTK5	Leptospira_phage	22.1	1.7e-59
AVM03212.1|922671_923895_-	cation efflux system protein CusB	NA	NA	NA	NA	NA
AVM03213.1|923910_924243_-	copper-binding protein	NA	NA	NA	NA	NA
AVM03214.1|924400_925774_-	copper transporter	NA	NA	NA	NA	NA
AVM03215.1|925728_925884_-	copper transporter	NA	NA	NA	NA	NA
AVM03216.1|925930_926614_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	2.3e-30
AVM03217.1|926603_928052_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
AVM03218.1|928788_930387_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	2.5e-27
AVM03219.1|930349_930796_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	37.2	7.2e-17
AVM03220.1|930828_931089_+	hypothetical protein	NA	NA	NA	NA	NA
AVM06604.1|931214_931376_+	rhs core protein	NA	NA	NA	NA	NA
AVM03221.1|931666_931864_+	hypothetical protein	NA	NA	NA	NA	NA
AVM06605.1|931809_932142_+	hypothetical protein	NA	NA	NA	NA	NA
AVM03222.1|932340_933477_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AVM03223.1|935971_938944_+	phage receptor	NA	NA	NA	NA	NA
AVM03224.1|938944_939835_+	hypothetical protein	NA	NA	NA	NA	NA
AVM03225.1|939748_939961_-	hypothetical protein	NA	NA	NA	NA	NA
AVM03226.1|940017_940779_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVM03227.1|940772_940889_+	hypothetical protein	NA	NA	NA	NA	NA
940823:940869	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
AVM03228.1|941292_942246_+|protease	protease 7	protease	NA	NA	NA	NA
AVM03229.1|942494_943244_-	transcriptional regulator	NA	NA	NA	NA	NA
AVM03230.1|943919_944213_-	hypothetical protein	NA	NA	NA	NA	NA
AVM03231.1|944223_944928_-	chaperone of endosialidase	NA	A0A1X7QGH6	Escherichia_phage	61.1	4.1e-59
AVM03232.1|944937_945219_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
AVM03233.1|945215_947561_-|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	45.4	9.5e-92
AVM03234.1|947619_950451_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	87.5	0.0e+00
AVM03235.1|951110_951212_-	hypothetical protein	NA	NA	NA	NA	NA
AVM03236.1|951359_951554_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
AVM03237.1|951914_952208_+	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AVM03238.1|952239_952701_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	99.3	2.4e-76
AVM03239.1|952697_953195_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
AVM03240.1|953194_953410_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AVM06606.1|955264_955402_-	aldehyde dehydrogenase	NA	A0A2L1IV26	Escherichia_phage	100.0	3.5e-07
AVM03241.1|956047_956431_-	antitermination protein	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
AVM03242.1|956516_956657_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	2.5e-08
AVM03243.1|956653_957016_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	97.4	7.3e-60
AVM03244.1|957012_957303_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
AVM03245.1|957295_957466_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
AVM03246.1|957465_957921_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
AVM03247.1|957917_958019_-	hypothetical protein	NA	NA	NA	NA	NA
AVM03248.1|958135_958933_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVM03249.1|958942_959494_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AVM03250.1|959958_961485_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
AVM03251.1|961739_962072_-	multidrug SMR transporter	NA	NA	NA	NA	NA
AVM03252.1|962139_962442_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
AVM03253.1|963061_963343_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
AVM03254.1|963441_963660_+	conjugal transfer protein TraR	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
AVM03255.1|963707_963986_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	98.9	1.7e-48
AVM03256.1|963957_964329_+	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
AVM03257.1|964184_965348_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	1.3e-198
965362:965408	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 69
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	972427	975558	4607960	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
AVM03263.1|972427_973294_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AVM03264.1|973295_973508_+	ribosome-associated protein	NA	NA	NA	NA	NA
AVM03265.1|973615_974137_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AVM03266.1|974172_975558_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 70
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	987077	988223	4607960		Streptococcus_phage(100.0%)	1	NA	NA
AVM03278.1|987077_988223_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 71
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	994413	996195	4607960		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVM03284.1|994413_996195_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
>prophage 72
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1002568	1010376	4607960		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
AVM03292.1|1002568_1006849_-	DUF4329 domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
AVM03293.1|1007278_1009693_-	ABC transporter permease	NA	NA	NA	NA	NA
AVM03294.1|1009689_1010376_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 73
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1013512	1014190	4607960		Bacillus_virus(100.0%)	1	NA	NA
AVM03298.1|1013512_1014190_-	iron export ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 74
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1018729	1021992	4607960		uncultured_virus(50.0%)	2	NA	NA
AVM03304.1|1018729_1021234_+	copper-exporting P-type ATPase A	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
AVM03305.1|1021650_1021992_-	transcriptional regulator	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
>prophage 75
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1030236	1038798	4607960		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
AVM03314.1|1030236_1031196_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.7	2.2e-15
AVM03315.1|1031192_1032155_-	ferrochelatase	NA	NA	NA	NA	NA
AVM03316.1|1032390_1033035_-	adenylate kinase	NA	NA	NA	NA	NA
AVM03317.1|1033215_1035090_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
AVM03318.1|1035199_1035805_-	recombination protein RecR	NA	NA	NA	NA	NA
AVM03319.1|1035804_1036134_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AVM03320.1|1036186_1038118_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
AVM03321.1|1038246_1038798_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 76
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1045805	1048955	4607960		Leptospira_phage(100.0%)	1	NA	NA
AVM03330.1|1045805_1048955_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 77
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1057791	1061338	4607960		Bacillus_phage(100.0%)	2	NA	NA
AVM03341.1|1057791_1059573_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
AVM03342.1|1059565_1061338_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	3.4e-49
>prophage 78
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1064661	1065357	4607960		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVM03346.1|1064661_1065357_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	8.4e-89
>prophage 79
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1068497	1073544	4607960	protease	Bacillus_phage(25.0%)	4	NA	NA
AVM03350.1|1068497_1068770_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
AVM03351.1|1068978_1071333_-|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
AVM03352.1|1071520_1072795_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
AVM03353.1|1072920_1073544_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 80
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1097386	1106366	4607960	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
AVM03381.1|1097386_1097857_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
AVM03382.1|1097945_1099049_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	1.7e-54
AVM03383.1|1099052_1099502_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AVM03384.1|1099652_1100192_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
AVM03385.1|1100490_1101375_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
AVM03386.1|1101551_1101899_-	HNH endonuclease	NA	NA	NA	NA	NA
AVM03387.1|1102026_1102998_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
AVM03388.1|1103008_1104856_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AVM03389.1|1104883_1105216_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
AVM03390.1|1105238_1106366_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 81
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1113318	1123395	4607960		Bacillus_phage(60.0%)	7	NA	NA
AVM03396.1|1113318_1114614_-	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	2.9e-26
AVM03397.1|1114671_1115361_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
AVM03398.1|1115550_1116753_+	exonuclease sbcCD subunit D	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
AVM03399.1|1116749_1119896_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
AVM06610.1|1120021_1121206_+	MFS transporter AraJ	NA	NA	NA	NA	NA
AVM03400.1|1121450_1122359_-	fructokinase	NA	NA	NA	NA	NA
AVM06611.1|1122483_1123395_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 82
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1128461	1129577	4607960		Bacillus_phage(100.0%)	1	NA	NA
AVM03409.1|1128461_1129577_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 83
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1136992	1138150	4607960		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVM03421.1|1136992_1138150_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 84
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1145043	1145811	4607960		Planktothrix_phage(100.0%)	1	NA	NA
AVM03428.1|1145043_1145811_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-25
>prophage 85
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1148997	1150107	4607960		Prochlorococcus_phage(100.0%)	1	NA	NA
AVM03432.1|1148997_1150107_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 86
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1153488	1155449	4607960		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
AVM03437.1|1153488_1154502_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	9.2e-44
AVM03438.1|1154498_1155449_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
>prophage 87
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1160859	1165139	4607960		Enterobacteria_phage(50.0%)	2	NA	NA
AVM03444.1|1160859_1161942_+	lactose operon repressor	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
AVM03445.1|1162064_1165139_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	100.0	0.0e+00
>prophage 88
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1169679	1175370	4607960		Lactobacillus_phage(50.0%)	4	NA	NA
AVM03451.1|1169679_1170579_+	transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
AVM03452.1|1170715_1171999_-	cytosine deaminase	NA	NA	NA	NA	NA
AVM03453.1|1171988_1173248_-	cytosine permease	NA	NA	NA	NA	NA
AVM03454.1|1173483_1175370_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	1.6e-52
>prophage 89
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1184143	1185193	4607960		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
AVM03463.1|1184143_1185193_-	aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.6	2.8e-72
>prophage 90
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1196487	1202407	4607960	holin	Vibrio_phage(50.0%)	5	NA	NA
AVM03475.1|1196487_1198521_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
AVM06612.1|1198517_1198733_-	hypothetical protein	NA	NA	NA	NA	NA
AVM03476.1|1198649_1199237_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
AVM03477.1|1199250_1200723_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVM03478.1|1200736_1202407_+|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	3.6e-61
>prophage 91
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1207982	1209308	4607960		Erysipelothrix_phage(100.0%)	1	NA	NA
AVM03486.1|1207982_1209308_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	1.2e-112
>prophage 92
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1229514	1237078	4607960		Streptococcus_phage(50.0%)	6	NA	NA
AVM03508.1|1229514_1231713_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	1.5e-38
AVM03509.1|1231722_1232679_+	XdhC family protein	NA	NA	NA	NA	NA
AVM03510.1|1232657_1233068_+	hypothetical protein	NA	NA	NA	NA	NA
AVM03511.1|1233384_1234638_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	7.5e-96
AVM03512.1|1234649_1235753_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AVM03513.1|1236040_1237078_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.1	4.3e-113
>prophage 93
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1248588	1252507	4607960		Clostridioides_phage(50.0%)	6	NA	NA
AVM03526.1|1248588_1249338_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
AVM03527.1|1249547_1249808_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
AVM03528.1|1249810_1250089_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
AVM03529.1|1250244_1250985_+	transpeptidase	NA	NA	NA	NA	NA
AVM03530.1|1250955_1251723_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AVM03531.1|1251928_1252507_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 94
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1260898	1268530	4607960		Bradyrhizobium_phage(25.0%)	9	NA	NA
AVM06614.1|1260898_1261630_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.1	1.3e-39
AVM03539.1|1261694_1262162_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AVM03540.1|1262158_1262881_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVM03541.1|1262914_1263670_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AVM03542.1|1263741_1265100_+	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AVM03543.1|1265147_1265771_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVM03544.1|1265774_1266575_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AVM03545.1|1266815_1267730_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVM03546.1|1267726_1268530_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	1.4e-39
>prophage 95
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1275144	1276176	4607960		Planktothrix_phage(100.0%)	1	NA	NA
AVM03548.1|1275144_1276176_+	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 96
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1289179	1293295	4607960		Saccharomonospora_phage(50.0%)	2	NA	NA
AVM03563.1|1289179_1292662_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
AVM03564.1|1292698_1293295_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.3	6.0e-27
>prophage 97
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1302123	1302882	4607960		Flavobacterium_phage(100.0%)	1	NA	NA
AVM03573.1|1302123_1302882_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 98
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1315479	1316904	4607960	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVM03587.1|1315479_1316904_-|protease	periplasmic serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 99
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1320833	1321178	4607960		Lake_Baikal_phage(100.0%)	1	NA	NA
AVM03592.1|1320833_1321178_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 100
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1327212	1328010	4607960		Planktothrix_phage(100.0%)	1	NA	NA
AVM03597.1|1327212_1328010_-	iron(3+)-hydroxamate import ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 101
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1333244	1340050	4607960	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
AVM03601.1|1333244_1335674_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	28.8	1.3e-40
AVM03602.1|1335747_1336278_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AVM03603.1|1336292_1336997_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AVM03604.1|1337174_1337630_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AVM03605.1|1337666_1338593_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AVM03606.1|1338631_1340050_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 102
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1349956	1350859	4607960	transposase	Sodalis_phage(100.0%)	1	NA	NA
AVM03617.1|1349956_1350859_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	49.2	7.4e-61
>prophage 103
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1354121	1360744	4607960		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
AVM03624.1|1354121_1355048_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
AVM03625.1|1355156_1355819_+	carbonic anhydrase	NA	NA	NA	NA	NA
AVM03626.1|1355859_1356396_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
AVM03627.1|1356601_1358992_+	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
AVM03628.1|1359193_1360744_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 104
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1368489	1369914	4607960		Erysipelothrix_phage(100.0%)	1	NA	NA
AVM06616.1|1368489_1369914_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 105
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1378541	1379093	4607960		Sphingobium_phage(100.0%)	1	NA	NA
AVM03641.1|1378541_1379093_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 106
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1383338	1384382	4607960		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVM03647.1|1383338_1384382_-	guanosine monophosphate reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.0	6.3e-104
>prophage 107
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1410471	1412196	4607960		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVM03674.1|1410471_1412196_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.4e-36
>prophage 108
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1424898	1425597	4607960		Planktothrix_phage(100.0%)	1	NA	NA
AVM03686.1|1424898_1425597_+	thiamine import ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 109
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1431960	1437383	4607960		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
AVM03691.1|1431960_1434312_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	3.0e-37
AVM03692.1|1434476_1437383_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 110
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1445127	1446527	4607960		Microcystis_phage(50.0%)	2	NA	NA
AVM03700.1|1445127_1445970_+	diadenosine tetraphosphatase	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
AVM03701.1|1446047_1446527_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 111
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1454420	1460080	4607960		Vibrio_phage(50.0%)	3	NA	NA
AVM03709.1|1454420_1455935_+	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	1.6e-07
AVM03710.1|1455965_1457108_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVM03711.1|1458526_1460080_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	2.0e-34
>prophage 112
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1465674	1466823	4607960		Halovirus(100.0%)	1	NA	NA
AVM03717.1|1465674_1466823_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 113
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1471266	1474083	4607960	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVM03723.1|1471266_1474083_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	1.2e-77
>prophage 114
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1481891	1492310	4607960	transposase	uncultured_Caudovirales_phage(20.0%)	10	NA	NA
AVM03731.1|1481891_1483058_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
AVM06619.1|1483587_1483797_+	regulatory protein MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
AVM03732.1|1483990_1485103_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AVM03733.1|1485249_1486380_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
AVM03734.1|1486468_1488385_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
AVM03735.1|1488761_1489166_+	hypothetical protein	NA	NA	NA	NA	NA
AVM03736.1|1489191_1489905_+	hypothetical protein	NA	NA	NA	NA	NA
AVM03737.1|1490053_1490620_+	succinate-acetate/proton symporter SatP	NA	NA	NA	NA	NA
AVM03738.1|1490654_1491242_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
AVM03739.1|1491356_1492310_-	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
>prophage 115
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1504077	1506191	4607960		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
AVM03750.1|1504077_1505502_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
AVM03751.1|1505501_1506191_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
>prophage 116
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1509474	1514829	4607960		Bacillus_phage(33.33%)	4	NA	NA
AVM06622.1|1509474_1511412_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
AVM06623.1|1511520_1511649_-	methionine aminopeptidase	NA	NA	NA	NA	NA
AVM03756.1|1511622_1513290_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
AVM03757.1|1513596_1514829_-	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
>prophage 117
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1521572	1522895	4607960		Geobacillus_virus(100.0%)	1	NA	NA
AVM03765.1|1521572_1522895_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 118
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1528632	1531508	4607960		Salmonella_phage(50.0%)	3	NA	NA
AVM03771.1|1528632_1528812_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
AVM03772.1|1528920_1529526_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AVM03773.1|1529918_1531508_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
>prophage 119
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1539404	1540684	4607960		Salmonella_phage(50.0%)	2	NA	NA
AVM03784.1|1539404_1539944_+	primosomal protein 1	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
AVM03785.1|1539946_1540684_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 120
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1543909	1549264	4607960		Tupanvirus(50.0%)	3	NA	NA
AVM03787.1|1543909_1544932_-	L-galactonate-5-dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
AVM03788.1|1546198_1547560_+	L-galactonate transporter	NA	NA	NA	NA	NA
AVM03789.1|1547608_1549264_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 121
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1587757	1588312	4607960		Clostridioides_phage(100.0%)	1	NA	NA
AVM03819.1|1587757_1588312_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 122
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1594880	1596341	4607960		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVM03829.1|1594880_1596341_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	6.2e-49
>prophage 123
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1606608	1607205	4607960		Escherichia_phage(100.0%)	1	NA	NA
AVM03840.1|1606608_1607205_-	type 1 fimbriae regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 124
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1612423	1613404	4607960		Stx2-converting_phage(100.0%)	1	NA	NA
AVM06627.1|1612423_1613404_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.6	4.7e-101
>prophage 125
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1632709	1651738	4607960	holin,integrase,transposase	uncultured_Caudovirales_phage(14.29%)	20	1623975:1623989	1655900:1655914
1623975:1623989	attL	TTGGCGATGCGCTCG	NA	NA	NA	NA
AVM03863.1|1632709_1633666_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AVM03864.1|1633666_1634434_+	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AVM03865.1|1634990_1635404_-	hypothetical protein	NA	NA	NA	NA	NA
AVM03866.1|1636181_1637337_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AVM03867.1|1637485_1639489_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AVM03868.1|1639433_1639592_+|holin	choline transporter	holin	NA	NA	NA	NA
AVM03869.1|1639551_1639965_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AVM03870.1|1639899_1641067_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
AVM03871.1|1641242_1641638_+	hypothetical protein	NA	NA	NA	NA	NA
AVM03872.1|1641690_1641816_-	hypothetical protein	NA	NA	NA	NA	NA
AVM06628.1|1641858_1642977_-	oxidoreductase	NA	NA	NA	NA	NA
AVM03873.1|1642988_1644206_-	MFS transporter	NA	NA	NA	NA	NA
AVM03874.1|1644832_1646161_+|transposase	IS4 family transposase IS4	transposase	NA	NA	NA	NA
AVM03875.1|1646188_1646332_-	hypothetical protein	NA	NA	NA	NA	NA
AVM03876.1|1647035_1647230_-	hypothetical protein	NA	NA	NA	NA	NA
AVM03877.1|1647245_1647476_+	hypothetical protein	NA	NA	NA	NA	NA
AVM03878.1|1647364_1647832_+	hypothetical protein	NA	NA	NA	NA	NA
AVM06629.1|1648987_1650178_-|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.1	9.4e-72
AVM03879.1|1650206_1650401_-	hypothetical protein	NA	NA	NA	NA	NA
AVM03880.1|1650718_1651738_+	aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
1655900:1655914	attR	CGAGCGCATCGCCAA	NA	NA	NA	NA
>prophage 126
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1656865	1666141	4607960	tRNA	Klebsiella_phage(33.33%)	6	NA	NA
AVM03886.1|1656865_1658368_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.2	4.6e-84
AVM03887.1|1658528_1659611_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AVM03888.1|1659610_1660711_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AVM03889.1|1660977_1662489_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AVM03890.1|1662842_1663286_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AVM03891.1|1663285_1666141_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
>prophage 127
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1674483	1680580	4607960		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
AVM03902.1|1674483_1675419_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
AVM03903.1|1675431_1675893_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AVM03904.1|1675965_1676352_+	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AVM03905.1|1676557_1679254_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
AVM06631.1|1679394_1679448_-	MgtA leader peptide	NA	NA	NA	NA	NA
AVM03906.1|1679632_1680580_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
>prophage 128
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1684218	1686980	4607960		Vibrio_phage(50.0%)	2	NA	NA
AVM03909.1|1684218_1686357_+	anaerobic ribonucleoside triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
AVM03910.1|1686515_1686980_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
>prophage 129
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1691296	1697784	4607960		Klosneuvirus(33.33%)	6	NA	NA
AVM03915.1|1691296_1692295_+	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
AVM03916.1|1692327_1693323_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
AVM03917.1|1693309_1694335_-	ABC transporter permease	NA	NA	NA	NA	NA
AVM03918.1|1694345_1695848_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
AVM03919.1|1695987_1696944_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVM03920.1|1697253_1697784_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
>prophage 130
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1738586	1739750	4607960		Ralstonia_phage(100.0%)	1	NA	NA
AVM03962.1|1738586_1739750_-	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
>prophage 131
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1743682	1756713	4607960	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
AVM03969.1|1743682_1746124_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
AVM03970.1|1746162_1746588_-	transcriptional regulator	NA	NA	NA	NA	NA
AVM03971.1|1746792_1748091_-	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
AVM03972.1|1748194_1748392_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
AVM03973.1|1748473_1749478_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
AVM03974.1|1749480_1750740_-|protease	protease modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
AVM03975.1|1750825_1752106_-	GTPase HflX	NA	NA	NA	NA	NA
AVM03976.1|1752181_1752490_-	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AVM03977.1|1752575_1753526_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AVM03978.1|1753518_1755366_-	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
AVM03979.1|1755375_1756713_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 132
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1760628	1761174	4607960		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVM03983.1|1760628_1761174_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 133
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1768601	1769579	4607960		Tupanvirus(100.0%)	1	NA	NA
AVM03988.1|1768601_1769579_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 134
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1774499	1775036	4607960		Morganella_phage(100.0%)	1	NA	NA
AVM03994.1|1774499_1775036_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	55.0	3.6e-47
>prophage 135
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1779540	1781524	4607960		Vibrio_phage(50.0%)	2	NA	NA
AVM04002.1|1779540_1781187_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
AVM04003.1|1781230_1781524_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 136
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1795801	1799013	4607960	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
AVM04016.1|1795801_1797259_+	dipeptide and tripeptide permease C	NA	A0A0P0IY73	Acinetobacter_phage	29.4	8.9e-48
AVM04017.1|1797495_1799013_+|tRNA	lysine--tRNA ligase heat inducible	tRNA	A0A1V0SAC0	Catovirus	38.0	2.0e-87
>prophage 137
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1820214	1821717	4607960		Burkholderia_virus(100.0%)	1	NA	NA
AVM04035.1|1820214_1821717_-	proline/betaine transporter	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 138
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1826653	1827442	4607960		Cedratvirus(100.0%)	1	NA	NA
AVM04039.1|1826653_1827442_+	phosphonates import ATP-binding protein PhnC	NA	A0A285PWH2	Cedratvirus	30.1	4.2e-12
>prophage 139
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1833046	1834596	4607960		Bacillus_virus(50.0%)	2	NA	NA
AVM04046.1|1833046_1833805_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
AVM04047.1|1833915_1834596_+	alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
>prophage 140
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1840830	1847199	4607960		Bacillus_virus(50.0%)	5	NA	NA
AVM04056.1|1840830_1842363_+	D-allose import ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.4	4.4e-13
AVM04057.1|1842341_1843322_+	D-allose ABC transporter permease	NA	NA	NA	NA	NA
AVM04058.1|1843332_1844028_+	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
AVM04059.1|1844011_1844941_+	allose kinase	NA	NA	NA	NA	NA
AVM04060.1|1845213_1847199_+	alkyl/aryl-sulfatase	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	1.6e-148
>prophage 141
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1852444	1854592	4607960		Escherichia_phage(100.0%)	1	NA	NA
AVM04065.1|1852444_1854592_+	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	25.2	4.7e-29
>prophage 142
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1864214	1866173	4607960		Staphylococcus_phage(100.0%)	1	NA	NA
AVM04076.1|1864214_1866173_+	acetyl-coenzyme A synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 143
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1871759	1873109	4607960		Moraxella_phage(100.0%)	1	NA	NA
AVM04080.1|1871759_1873109_-	guanine/hypoxanthine permease GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 144
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1876926	1880540	4607960		Enterobacteria_phage(50.0%)	2	NA	NA
AVM04089.1|1876926_1877463_-	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
AVM04090.1|1877717_1880540_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.0	0.0e+00
>prophage 145
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1884727	1887275	4607960		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
AVM04096.1|1884727_1885807_-	alanine racemase biosynthetic	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
AVM04097.1|1885859_1887275_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 146
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1893902	1894511	4607960		Lactococcus_phage(100.0%)	1	NA	NA
AVM04105.1|1893902_1894511_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 147
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1918885	1922569	4607960		Dickeya_phage(100.0%)	1	NA	NA
AVM06640.1|1918885_1922569_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 148
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1938210	1939800	4607960		Prochlorococcus_phage(100.0%)	1	NA	NA
AVM04133.1|1938210_1939800_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.9e-68
>prophage 149
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1945162	1946926	4607960		Bacillus_phage(50.0%)	3	NA	NA
AVM04139.1|1945162_1945435_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
AVM04140.1|1945621_1946212_-	DUF416 domain-containing protein	NA	NA	NA	NA	NA
AVM04141.1|1946254_1946926_-	endonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 150
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1956143	1964472	4607960		Vibrio_phage(50.0%)	2	NA	NA
AVM04152.1|1956143_1960367_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
AVM04153.1|1960443_1964472_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 151
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1968588	1971641	4607960		Tupanvirus(50.0%)	4	NA	NA
AVM04160.1|1968588_1969773_-	translation elongation factor EF-Tu 2	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
AVM04161.1|1970348_1970504_+	hypothetical protein	NA	NA	NA	NA	NA
AVM04162.1|1970513_1970708_-	hypothetical protein	NA	NA	NA	NA	NA
AVM04163.1|1970690_1971641_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 152
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	1998917	2006164	4607960		Serratia_phage(33.33%)	5	NA	NA
AVM04181.1|1998917_2001215_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
AVM04182.1|2001265_2001586_-	fructose-like phosphotransferase enzyme IIB component 2	NA	NA	NA	NA	NA
AVM04183.1|2001600_2002680_-	fructose-like permease IIC component 2	NA	NA	NA	NA	NA
AVM04184.1|2002988_2005490_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
AVM04185.1|2005501_2006164_+	fructose-6-phosphate aldolase 2	NA	A0A0E3F0E2	Synechococcus_phage	34.6	4.2e-29
>prophage 153
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2024086	2028590	4607960		Erwinia_phage(50.0%)	5	NA	NA
AVM04201.1|2024086_2025418_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
AVM04202.1|2025484_2026411_+	prenyltransferase	NA	NA	NA	NA	NA
AVM04203.1|2026503_2026989_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AVM04204.1|2027073_2027319_-	cell division protein ZapB	NA	NA	NA	NA	NA
AVM04205.1|2027744_2028590_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 154
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2040164	2045025	4607960		Feldmannia_irregularis_virus(33.33%)	6	NA	NA
AVM04218.1|2040164_2040863_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AVM04219.1|2040859_2042233_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
AVM04220.1|2042338_2043013_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AVM04221.1|2043161_2044145_-	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AVM04222.1|2044122_2044230_-	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AVM04223.1|2044404_2045025_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 155
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2072491	2075271	4607960		Escherichia_phage(50.0%)	3	NA	NA
AVM04249.1|2072491_2073277_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
AVM04250.1|2073310_2074207_-	ribokinase	NA	NA	NA	NA	NA
AVM04251.1|2074374_2075271_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 156
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2091495	2093966	4607960		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
AVM04263.1|2091495_2092545_+	two-component system sensor histidine kinase NtrB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
AVM06647.1|2092556_2093966_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 157
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2098043	2100830	4607960		uncultured_virus(100.0%)	1	NA	NA
AVM04268.1|2098043_2100830_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 158
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2114615	2115230	4607960		Streptococcus_phage(100.0%)	1	NA	NA
AVM04279.1|2114615_2115230_-	IMPACT family member YigZ	NA	A0A1X9I5T8	Streptococcus_phage	33.0	2.8e-19
>prophage 159
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2124111	2127398	4607960		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AVM04287.1|2124111_2124888_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
AVM04288.1|2124890_2125406_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AVM04289.1|2125409_2125679_-	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
AVM04290.1|2125757_2127398_-	ubiquinone biosynthesis protein UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 160
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2153974	2155804	4607960		Catovirus(100.0%)	1	NA	NA
AVM06649.1|2153974_2155804_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	9.7e-84
>prophage 161
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2162405	2166264	4607960		Bacillus_phage(100.0%)	3	NA	NA
AVM04323.1|2162405_2164568_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
AVM04324.1|2164651_2165368_-	flavin mononucleotide phosphatase YigB	NA	NA	NA	NA	NA
AVM04325.1|2165367_2166264_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	1.1e-24
>prophage 162
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2176581	2178237	4607960		Tetraselmis_virus(100.0%)	1	NA	NA
AVM04337.1|2176581_2178237_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.0e-44
>prophage 163
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2186311	2192455	4607960		Enterobacteria_phage(40.0%)	6	NA	NA
AVM04344.1|2186311_2187442_-	dTDP-4-amino-4,6-dideoxygalactose aminotransferase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
AVM04345.1|2187446_2188121_-	dTDP-fucosamine acetyltransferase	NA	NA	NA	NA	NA
AVM04346.1|2188098_2188980_-	glucose-1-phosphate thymidylyltransferase 2	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
AVM04347.1|2188998_2190066_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	3.0e-101
AVM04348.1|2190065_2191328_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
AVM04349.1|2191324_2192455_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
>prophage 164
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2196497	2201909	4607960		Indivirus(33.33%)	5	NA	NA
AVM04355.1|2196497_2196827_-	thiol reductase thioredoxin	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
AVM04356.1|2196957_2198223_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
AVM04357.1|2198228_2198351_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AVM04358.1|2198356_2199841_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
AVM04359.1|2199887_2201909_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
>prophage 165
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2210381	2212028	4607960		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVM04366.1|2210381_2212028_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	2.5e-67
>prophage 166
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2225412	2231265	4607960		Enterobacteria_phage(33.33%)	5	NA	NA
AVM04374.1|2225412_2226303_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
AVM04375.1|2226327_2227293_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
AVM04376.1|2227297_2228803_-	ribose import ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
AVM06653.1|2228810_2229230_-	D-ribose pyranase	NA	NA	NA	NA	NA
AVM04377.1|2229396_2231265_-	low affinity potassium transport system protein kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 167
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2234433	2235426	4607960		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AVM04380.1|2234433_2235426_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	1.3e-50
>prophage 168
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2247380	2254987	4607960		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
AVM04394.1|2247380_2248751_+	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
AVM04395.1|2248912_2250742_+	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
AVM04396.1|2251055_2252096_+	phosphate-binding protein	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
AVM04397.1|2252181_2253141_+	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AVM04398.1|2253140_2254031_+	phosphate ABC transporter permease PtsA	NA	NA	NA	NA	NA
AVM04399.1|2254213_2254987_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 169
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2265976	2267314	4607960		Moraxella_phage(100.0%)	1	NA	NA
AVM04410.1|2265976_2267314_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 170
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2277512	2284881	4607960		Staphylococcus_phage(33.33%)	8	NA	NA
AVM04419.1|2277512_2277770_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
AVM04420.1|2277733_2278093_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AVM04421.1|2278109_2278250_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AVM04422.1|2278362_2278563_+	hypothetical protein	NA	NA	NA	NA	NA
AVM04423.1|2278856_2280260_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AVM04424.1|2280264_2281365_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
AVM04425.1|2281364_2282438_+	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
AVM04426.1|2282466_2284881_+	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 171
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2289587	2290736	4607960		Oenococcus_phage(100.0%)	1	NA	NA
AVM04432.1|2289587_2290736_+	D-galactonate dehydratase 2	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 172
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2295163	2296117	4607960		Cyanophage(50.0%)	2	NA	NA
AVM04435.1|2295163_2295577_+	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
AVM04436.1|2295688_2296117_+	heat-shock protein IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 173
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2302898	2311920	4607960		Aeromonas_phage(25.0%)	14	NA	NA
AVM04441.1|2302898_2304614_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
AVM04442.1|2304610_2306104_+	hypothetical protein	NA	A0A2K9L1A5	Tupanvirus	25.6	2.3e-30
AVM04443.1|2306150_2306600_-	hypothetical protein	NA	NA	NA	NA	NA
AVM04444.1|2306708_2307056_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
AVM04445.1|2307045_2307408_+	hypothetical protein	NA	NA	NA	NA	NA
AVM04446.1|2307404_2307902_+	radical SAM protein	NA	NA	NA	NA	NA
AVM04447.1|2307909_2309094_-	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
AVM04448.1|2309133_2309316_-	hypothetical protein	NA	NA	NA	NA	NA
AVM04449.1|2309373_2309463_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AVM04450.1|2309459_2309573_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
AVM04451.1|2309595_2309754_-	hypothetical protein	NA	NA	NA	NA	NA
AVM04452.1|2309750_2310041_-	hypothetical protein	NA	NA	NA	NA	NA
AVM04453.1|2310027_2310126_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AVM04454.1|2310231_2311920_+	acetolactate synthase isozyme 1 large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	3.2e-57
>prophage 174
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2319225	2320560	4607960		Moraxella_phage(100.0%)	1	NA	NA
AVM06658.1|2319225_2320560_+	adenine permease PurP	NA	A0A0R6PHV4	Moraxella_phage	37.2	8.6e-66
>prophage 175
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2329819	2334706	4607960	transposase	Shigella_phage(50.0%)	4	NA	NA
AVM04472.1|2329819_2330176_-|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	92.5	2.6e-33
AVM04473.1|2330202_2330349_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AVM04474.1|2330638_2330839_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
AVM04475.1|2331208_2334706_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.8	3.5e-98
>prophage 176
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2338090	2338576	4607960		Enterobacteria_phage(100.0%)	1	NA	NA
AVM04478.1|2338090_2338576_-	single-stranded DNA-binding protein	NA	Q1MVN2	Enterobacteria_phage	63.8	4.4e-52
>prophage 177
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2346104	2347289	4607960		Enterobacteria_phage(100.0%)	1	NA	NA
AVM04483.1|2346104_2347289_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	69.9	2.6e-162
>prophage 178
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2353568	2354960	4607960		environmental_Halophage(100.0%)	1	NA	NA
AVM04487.1|2353568_2354960_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 179
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2360081	2366831	4607960		Bordetella_phage(25.0%)	6	NA	NA
AVM04492.1|2360081_2362190_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
AVM04493.1|2362208_2362484_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AVM04494.1|2362538_2363162_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
AVM04495.1|2363419_2365102_+	DNA ligase B	NA	F8SJM3	Pseudomonas_phage	22.3	1.5e-22
AVM04496.1|2365098_2365716_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
AVM04497.1|2366006_2366831_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	76.6	2.4e-90
>prophage 180
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2370204	2374767	4607960		Xanthomonas_phage(25.0%)	7	NA	NA
AVM06663.1|2370204_2370660_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
AVM04502.1|2370640_2371861_-	bifunctional phosphopantothenoylcysteine decarboxylase CoaC/phosphopantothenate--cysteine ligase CoaB	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
AVM04503.1|2372032_2372701_+	DNA repair protein RadC	NA	NA	NA	NA	NA
AVM04504.1|2372917_2373154_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AVM04505.1|2373174_2373342_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AVM04506.1|2373439_2374249_+	formamidopyrimidine-DNA glycosylase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
AVM04507.1|2374287_2374767_-	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 181
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2382981	2385075	4607960		Archaeal_BJ1_virus(50.0%)	2	NA	NA
AVM04514.1|2382981_2384007_+	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	26.1	7.2e-12
AVM04515.1|2384091_2385075_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
>prophage 182
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2388483	2397990	4607960		Synechococcus_phage(16.67%)	9	NA	NA
AVM04519.1|2388483_2389416_-	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
AVM04520.1|2389629_2390826_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	1.1e-35
AVM04521.1|2390835_2391861_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
AVM04522.1|2392099_2393134_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
AVM04523.1|2393120_2394080_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AVM04524.1|2394083_2395367_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
AVM04525.1|2395376_2396921_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVM04526.1|2397165_2397597_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AVM04527.1|2397738_2397990_+	glutaredoxin	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 183
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2420087	2427855	4607960	tRNA	uncultured_Caudovirales_phage(66.67%)	7	NA	NA
AVM06665.1|2420087_2421032_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.5	9.9e-24
AVM04548.1|2421074_2421917_-	lyase	NA	NA	NA	NA	NA
AVM04549.1|2421937_2423542_-	hypothetical protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.3	3.6e-26
AVM04550.1|2423538_2423688_-	rhsC element core protein RshC	NA	NA	NA	NA	NA
AVM04551.1|2423916_2424525_+	glutathione S-transferase	NA	NA	NA	NA	NA
AVM04552.1|2424622_2426014_+|tRNA	L-selenocysteinyl-tRNA(Sec) synthase	tRNA	NA	NA	NA	NA
AVM04553.1|2426010_2427855_+|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
>prophage 184
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2463224	2464220	4607960		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AVM04585.1|2463224_2464220_-	O-acetyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.8	3.5e-11
>prophage 185
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2468057	2470058	4607960	transposase	Macacine_betaherpesvirus(50.0%)	3	NA	NA
AVM04589.1|2468057_2469427_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
AVM04590.1|2469506_2469659_+	protein HokA	NA	NA	NA	NA	NA
AVM04591.1|2469845_2470058_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 186
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2473712	2476046	4607960		Escherichia_phage(100.0%)	1	NA	NA
AVM04596.1|2473712_2476046_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.8	3.1e-71
>prophage 187
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2486258	2488243	4607960		Planktothrix_phage(50.0%)	2	NA	NA
AVM04606.1|2486258_2487242_+	dipeptide transport ATP-binding protein DppD	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
AVM04607.1|2487238_2488243_+	dipeptide transport ATP-binding protein DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
>prophage 188
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2535171	2535819	4607960		Bacillus_virus(100.0%)	1	NA	NA
AVM06669.1|2535171_2535819_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 189
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2539065	2541200	4607960		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
AVM04651.1|2539065_2539491_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
AVM04652.1|2539503_2540793_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
AVM04653.1|2540846_2541200_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 190
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2544545	2546588	4607960		Indivirus(100.0%)	1	NA	NA
AVM04658.1|2544545_2546588_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 191
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2560191	2562927	4607960		Staphylococcus_phage(100.0%)	1	NA	NA
AVM04669.1|2560191_2562927_+	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
>prophage 192
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2571147	2571954	4607960		Bacillus_virus(100.0%)	1	NA	NA
AVM04674.1|2571147_2571954_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
>prophage 193
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2579847	2583979	4607960		Dickeya_phage(50.0%)	4	NA	NA
AVM04683.1|2579847_2580513_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
AVM04684.1|2580733_2580979_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
AVM04685.1|2581080_2583279_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	38.1	2.5e-118
AVM04686.1|2583352_2583979_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 194
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2586985	2589804	4607960		Staphylococcus_phage(50.0%)	3	NA	NA
AVM04691.1|2586985_2587654_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	3.8e-14
AVM04692.1|2587646_2588705_+	ABC transporter permease	NA	NA	NA	NA	NA
AVM04693.1|2588949_2589804_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 195
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2595537	2597020	4607960		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
AVM04699.1|2595537_2596305_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
AVM04700.1|2596306_2597020_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 196
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2600561	2602372	4607960		Planktothrix_phage(50.0%)	2	NA	NA
AVM04704.1|2600561_2601632_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
AVM04705.1|2601628_2602372_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	2.9e-10
>prophage 197
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2622382	2624830	4607960		Dickeya_phage(100.0%)	1	NA	NA
AVM04722.1|2622382_2624830_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 198
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2633738	2634965	4607960		Ralstonia_phage(100.0%)	1	NA	NA
AVM04731.1|2633738_2634965_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	59.5	4.9e-132
>prophage 199
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2639344	2641738	4607960		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AVM04734.1|2639344_2641738_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 200
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2647707	2648586	4607960	transposase	Sodalis_phage(100.0%)	1	NA	NA
AVM04740.1|2647707_2648586_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 201
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2655149	2658916	4607960		Bacillus_phage(66.67%)	3	NA	NA
AVM04748.1|2655149_2655869_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.4	1.3e-28
AVM04749.1|2655865_2657218_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
AVM04750.1|2657293_2658916_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 202
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2675822	2676659	4607960		Vibrio_phage(100.0%)	1	NA	NA
AVM04765.1|2675822_2676659_+	DNA adenine methylase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 203
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2701683	2711224	4607960		Acinetobacter_phage(25.0%)	10	NA	NA
AVM04792.1|2701683_2702247_+	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
AVM04793.1|2702332_2703553_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AVM04794.1|2703619_2705722_-	hypothetical protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
AVM04795.1|2705760_2706393_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AVM04796.1|2706399_2706615_-	hypothetical protein	NA	NA	NA	NA	NA
AVM04797.1|2706694_2707099_+	OsmC family protein	NA	NA	NA	NA	NA
AVM04798.1|2707153_2708023_-	phosphoribulokinase	NA	NA	NA	NA	NA
AVM04799.1|2708076_2708295_-	hypothetical protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
AVM04800.1|2708288_2709311_-	hydrolase	NA	NA	NA	NA	NA
AVM04801.1|2709310_2711224_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 204
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2716794	2725353	4607960		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
AVM04810.1|2716794_2717181_+	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
AVM04811.1|2717180_2717540_+	sulfurtransferase TusC	NA	NA	NA	NA	NA
AVM04812.1|2717547_2717835_+	sulfurtransferase TusB	NA	NA	NA	NA	NA
AVM04813.1|2717960_2718335_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
AVM04814.1|2718431_2718902_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
AVM04815.1|2718998_2721113_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
AVM04816.1|2721183_2722368_+	translation elongation factor EF-Tu 1	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
AVM04817.1|2722659_2725353_+	lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	35.7	3.3e-40
>prophage 205
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2734183	2736136	4607960		Vibrio_phage(100.0%)	1	NA	NA
AVM04830.1|2734183_2736136_-	type II secretion system protein GspD	NA	R9TEZ5	Vibrio_phage	30.9	9.2e-32
>prophage 206
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2757351	2758823	4607960	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
AVM04868.1|2757351_2758299_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
AVM04869.1|2758313_2758823_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 207
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2769084	2773238	4607960		Bacillus_virus(50.0%)	4	NA	NA
AVM04877.1|2769084_2769843_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
AVM04878.1|2769850_2770954_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVM04879.1|2770963_2772145_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVM04880.1|2772212_2773238_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
>prophage 208
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2779742	2780627	4607960		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVM04888.1|2779742_2780627_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.5	6.4e-25
>prophage 209
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2791192	2792236	4607960		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVM04900.1|2791192_2792236_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 210
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2808914	2811439	4607960	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
AVM04915.1|2808914_2809982_-|protease	serine endoprotease DegS	protease	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
AVM04916.1|2810071_2811439_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 211
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2815405	2815903	4607960		Pseudomonas_phage(100.0%)	1	NA	NA
AVM04922.1|2815405_2815903_+	stringent starvation protein B	NA	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 212
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2819607	2821098	4607960		Burkholderia_virus(100.0%)	1	NA	NA
AVM04926.1|2819607_2821098_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 213
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2830794	2845589	4607960		Staphylococcus_phage(25.0%)	17	NA	NA
AVM06677.1|2830794_2831724_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
AVM04935.1|2831819_2834156_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
AVM04936.1|2834385_2835039_+	glutamine amidotransferase	NA	NA	NA	NA	NA
AVM04937.1|2835035_2835764_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AVM04938.1|2835760_2836393_-	protein YrbL	NA	NA	NA	NA	NA
AVM04939.1|2836606_2836879_-	phosphocarrier protein NPr	NA	NA	NA	NA	NA
AVM04940.1|2836875_2837730_-	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
AVM04941.1|2837775_2838267_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AVM04942.1|2838384_2838672_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
AVM04943.1|2838694_2840128_-	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AVM04944.1|2840175_2840901_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
AVM04945.1|2840907_2841465_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AVM04946.1|2841433_2842009_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AVM04947.1|2842005_2842572_-	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
AVM04948.1|2842592_2843579_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	4.8e-37
AVM04949.1|2843592_2844570_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
AVM04950.1|2844779_2845589_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 214
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2849656	2851135	4607960		Vibrio_phage(50.0%)	2	NA	NA
AVM04956.1|2849656_2849935_-	sugar fermentation stimulation protein B	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
AVM04957.1|2850163_2851135_-	octaprenyl-diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 215
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2857909	2860782	4607960	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
AVM04966.1|2857909_2859844_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
AVM04967.1|2859933_2860782_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 216
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2864864	2871503	4607960		Dickeya_phage(50.0%)	4	NA	NA
AVM04971.1|2864864_2866208_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.1	3.1e-63
AVM06679.1|2866838_2867291_+	ribosome maturation factor	NA	NA	NA	NA	NA
AVM04972.1|2867318_2868806_+	transcription termination protein NusA	NA	NA	NA	NA	NA
AVM04973.1|2868830_2871503_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 217
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2876984	2878874	4607960		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVM04980.1|2876984_2878874_+	DEAD/DEAH box family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 218
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2884576	2892370	4607960		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
AVM04986.1|2884576_2884879_-	GIY-YIG nuclease family protein	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
AVM04987.1|2884929_2885373_+	hypothetical protein	NA	NA	NA	NA	NA
AVM04988.1|2885352_2885871_-	glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
AVM04989.1|2885998_2886634_+	hypothetical protein	NA	NA	NA	NA	NA
AVM04990.1|2886706_2887747_+	permease	NA	NA	NA	NA	NA
AVM04991.1|2887860_2888436_-	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AVM04992.1|2888445_2889036_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
AVM04993.1|2889055_2889451_-	YraN family protein	NA	NA	NA	NA	NA
AVM04994.1|2889408_2891445_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
AVM04995.1|2891509_2892370_+	rRNA (cytidine-2'-O-)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
>prophage 219
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2915379	2916525	4607960		Streptococcus_phage(100.0%)	1	NA	NA
AVM05018.1|2915379_2916525_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 220
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2924626	2926921	4607960		Tetraselmis_virus(100.0%)	1	NA	NA
AVM05027.1|2924626_2926921_+	PFL-like enzyme TdcE	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 221
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2947716	2948682	4607960		Escherichia_phage(100.0%)	1	NA	NA
AVM05051.1|2947716_2948682_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 222
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2961536	2977732	4607960	tRNA	Herpes_simplex_virus(16.67%)	16	NA	NA
AVM05063.1|2961536_2964629_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	6.5e-157
AVM05064.1|2964812_2965796_-	transcriptional regulator	NA	NA	NA	NA	NA
AVM05065.1|2965725_2965908_-	hypothetical protein	NA	NA	NA	NA	NA
AVM05066.1|2966014_2966347_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
AVM06684.1|2966388_2967768_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.0e-33
AVM06685.1|2967703_2967910_-	hypothetical protein	NA	NA	NA	NA	NA
AVM05067.1|2968185_2969706_+	aerotaxis receptor	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
AVM05068.1|2969859_2970483_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AVM05069.1|2970770_2971535_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AVM05070.1|2971788_2972295_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AVM05071.1|2972373_2974215_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
AVM05072.1|2974273_2974396_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AVM05073.1|2974409_2976155_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
AVM05074.1|2976265_2976481_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVM05075.1|2976479_2976710_+	hypothetical protein	NA	NA	NA	NA	NA
AVM05076.1|2976718_2977732_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 223
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2984115	2985354	4607960	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
AVM05084.1|2984115_2985354_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 224
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	2990491	2991925	4607960		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVM05088.1|2990491_2991925_+	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 225
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3001440	3012403	4607960		Staphylococcus_phage(20.0%)	13	NA	NA
AVM05099.1|3001440_3002094_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
AVM05100.1|3002355_3002526_+	DUF4051 domain-containing protein	NA	NA	NA	NA	NA
AVM05101.1|3002583_3003357_-	zinc transporter ZupT	NA	NA	NA	NA	NA
AVM05102.1|3003499_3004288_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
AVM05103.1|3004325_3005486_-	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
AVM05104.1|3005491_3006163_-	DUF1190 domain-containing protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
AVM05105.1|3006050_3006311_-	hypothetical protein	NA	NA	NA	NA	NA
AVM05106.1|3006310_3007792_-	outer membrane protein TolC	NA	NA	NA	NA	NA
AVM05107.1|3007996_3008626_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
AVM05108.1|3008626_3009049_+	dehydrogenase	NA	NA	NA	NA	NA
AVM05109.1|3009073_3009901_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
AVM05110.1|3009900_3010482_+	esterase YqiA	NA	NA	NA	NA	NA
AVM05111.1|3010510_3012403_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 226
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3016230	3016623	4607960		Stx_converting_phage(100.0%)	1	NA	NA
AVM05117.1|3016230_3016623_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 227
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3019933	3029284	4607960		Bacillus_virus(33.33%)	7	NA	NA
AVM05123.1|3019933_3022192_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
AVM05124.1|3022425_3023163_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AVM05125.1|3023237_3024650_+	cell division protein FtsP	NA	NA	NA	NA	NA
AVM05126.1|3024760_3026980_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
AVM05127.1|3027022_3027280_-	hypothetical protein	NA	NA	NA	NA	NA
AVM05128.1|3027330_3028257_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AVM05129.1|3028456_3029284_-	2,5-diketo-D-gluconic acid reductase A	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 228
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3035360	3036245	4607960		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AVM05137.1|3035360_3036245_-	NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 229
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3058458	3059631	4607960		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
AVM05162.1|3058458_3059631_-	aminotransferase class V-fold PLP-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	5.5e-40
>prophage 230
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3106660	3107680	4607960		Tetraselmis_virus(100.0%)	1	NA	NA
AVM05198.1|3106660_3107680_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.4	1.4e-36
>prophage 231
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3111871	3112093	4607960		Klebsiella_phage(100.0%)	1	NA	NA
AVM05204.1|3111871_3112093_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
>prophage 232
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3140471	3141626	4607960		Staphylococcus_phage(100.0%)	1	NA	NA
AVM05235.1|3140471_3141626_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 233
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3169921	3171154	4607960		Catovirus(100.0%)	1	NA	NA
AVM05264.1|3169921_3171154_+	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 234
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3179289	3184668	4607960		Prochlorococcus_phage(50.0%)	3	NA	NA
AVM05274.1|3179289_3182163_+	glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	3.7e-263
AVM05275.1|3182428_3183172_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVM05276.1|3183228_3184668_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	4.4e-31
>prophage 235
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3188586	3203978	4607960	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
AVM05283.1|3188586_3189483_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
AVM05284.1|3189507_3190218_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AVM05285.1|3190223_3191957_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
AVM05286.1|3192047_3193145_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
AVM05287.1|3193155_3194673_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
AVM05288.1|3194715_3195264_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AVM05289.1|3195386_3195512_-	hypothetical protein	NA	NA	NA	NA	NA
AVM05290.1|3195513_3196962_-	uric acid transporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
AVM05291.1|3197008_3197095_-	purine permease YgfU	NA	NA	NA	NA	NA
AVM05292.1|3197397_3199317_+	oxidoreductase (Fe-S)-binding subunit	NA	NA	NA	NA	NA
AVM05293.1|3199316_3199805_+	effector protein	NA	NA	NA	NA	NA
AVM05294.1|3199840_3201208_-	guanine/hypoxanthine permease GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
AVM05295.1|3201243_3202563_-	guanine deaminase	NA	NA	NA	NA	NA
AVM05296.1|3202577_3203978_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 236
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3228436	3231309	4607960	transposase	Clostridium_phage(50.0%)	3	NA	NA
AVM05314.1|3228436_3229192_+	hypothetical protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
AVM05315.1|3229539_3230133_+	hypothetical protein	NA	NA	NA	NA	NA
AVM05316.1|3230146_3231309_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 237
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3236203	3238698	4607960		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AVM05320.1|3236203_3236965_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
AVM06693.1|3237279_3238698_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.0e-24
>prophage 238
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3248329	3255102	4607960		Moraxella_phage(33.33%)	6	NA	NA
AVM05329.1|3248329_3249043_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
AVM05330.1|3249111_3249801_-	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
AVM05331.1|3250485_3251016_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AVM05332.1|3251028_3253275_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	26.2	4.6e-11
AVM05333.1|3253425_3254301_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AVM05334.1|3254307_3255102_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 239
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3260579	3275907	4607960	protease,tRNA	Bacillus_phage(33.33%)	9	NA	NA
AVM05340.1|3260579_3263468_+|protease	protease 3	protease	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
AVM05341.1|3263460_3267003_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.9	1.5e-08
AVM05342.1|3267002_3268829_+	RecBCD enzyme subunit RecD	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
AVM05343.1|3268890_3270222_-	N-acetylglutamate synthase	NA	NA	NA	NA	NA
AVM05344.1|3270453_3271707_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
AVM05345.1|3272065_3273163_+	murein transglycosylase A	NA	NA	NA	NA	NA
AVM05346.1|3273401_3274208_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
AVM05347.1|3274258_3274702_-	sulfur acceptor protein CsdE	NA	NA	NA	NA	NA
AVM05348.1|3274701_3275907_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	3.0e-73
>prophage 240
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3284129	3285629	4607960		Bacillus_virus(100.0%)	1	NA	NA
AVM05357.1|3284129_3285629_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.8	3.9e-14
>prophage 241
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3293123	3293879	4607960		Bacillus_phage(100.0%)	1	NA	NA
AVM05363.1|3293123_3293879_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 242
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3298737	3299586	4607960		Vibrio_phage(100.0%)	1	NA	NA
AVM05367.1|3298737_3299586_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	8.0e-41
>prophage 243
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3307121	3311236	4607960		Hokovirus(50.0%)	2	NA	NA
AVM05375.1|3307121_3309878_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	1.9e-54
AVM05376.1|3309934_3311236_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	3.9e-39
>prophage 244
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3315268	3320188	4607960		Only_Syngen_Nebraska_virus(33.33%)	5	NA	NA
AVM05381.1|3315268_3316906_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
AVM05382.1|3316993_3318292_+	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
AVM05383.1|3318351_3319224_-	TPM domain protein phosphatase	NA	NA	NA	NA	NA
AVM05384.1|3319237_3319378_-	hypothetical protein	NA	NA	NA	NA	NA
AVM05385.1|3319516_3320188_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 245
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3325089	3325875	4607960		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AVM05388.1|3325089_3325875_+	oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 246
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3342136	3344169	4607960		Hokovirus(50.0%)	2	NA	NA
AVM05404.1|3342136_3343564_+	sulfate adenylyltransferase	NA	A0A1V0SGC3	Hokovirus	31.1	1.1e-29
AVM05405.1|3343563_3344169_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 247
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3347281	3360464	4607960		Escherichia_phage(50.0%)	12	NA	NA
AVM05411.1|3347281_3348043_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
AVM05412.1|3348036_3348663_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AVM05413.1|3348802_3349942_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AVM05414.1|3350004_3350997_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AVM05415.1|3351090_3352455_-	permease	NA	NA	NA	NA	NA
AVM05416.1|3352543_3353320_-	hypothetical protein	NA	NA	NA	NA	NA
AVM05417.1|3353324_3353963_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AVM05418.1|3353959_3355222_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	4.9e-135
AVM05419.1|3355218_3356127_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
AVM05420.1|3356322_3357090_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
AVM05421.1|3357140_3357797_-	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	8.6e-51
AVM05422.1|3357902_3360464_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 248
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3378292	3379303	4607960		Enterobacteria_phage(100.0%)	1	NA	NA
AVM06696.1|3378292_3379303_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.6	3.5e-27
>prophage 249
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3386778	3387744	4607960		Tetraselmis_virus(100.0%)	1	NA	NA
AVM05443.1|3386778_3387744_-	arabinose 5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 250
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3393211	3398597	4607960	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
AVM05451.1|3393211_3393709_+	nicotinamide-nucleotide amidohydrolase PncC	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
AVM05452.1|3393788_3394850_+	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
AVM05453.1|3394918_3395419_+	regulatory protein RecX	NA	NA	NA	NA	NA
AVM05454.1|3395546_3398177_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
AVM05455.1|3398411_3398597_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 251
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3411647	3416942	4607960		Bacillus_virus(20.0%)	5	NA	NA
AVM05469.1|3411647_3412850_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
AVM05470.1|3413203_3414163_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	1.0e-132
AVM05471.1|3414172_3416317_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
AVM05472.1|3416289_3416700_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
AVM05473.1|3416696_3416942_-	NrdH-redoxin	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 252
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3420877	3425002	4607960		Clostridium_phage(50.0%)	4	NA	NA
AVM05481.1|3420877_3421327_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
AVM05482.1|3421327_3421990_-	transcriptional regulator	NA	NA	NA	NA	NA
AVM05483.1|3422010_3423411_-	GABA permease	NA	NA	NA	NA	NA
AVM05484.1|3423721_3425002_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	4.2e-33
>prophage 253
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3431931	3436226	4607960		Clostridium_phage(33.33%)	3	NA	NA
AVM05490.1|3431931_3433488_-	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	30.0	3.2e-19
AVM05491.1|3433770_3435000_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	86.6	4.6e-207
AVM05492.1|3435743_3436226_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 254
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3449859	3450930	4607960		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AVM05508.1|3449859_3450930_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 255
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3456835	3459409	4607960		Enterobacteria_phage(100.0%)	1	NA	NA
AVM05516.1|3456835_3459409_+	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 256
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3465186	3466485	4607960		Burkholderia_virus(100.0%)	1	NA	NA
AVM05518.1|3465186_3466485_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 257
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3471778	3478037	4607960		Achromobacter_phage(25.0%)	8	NA	NA
AVM05523.1|3471778_3472198_-	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AVM05524.1|3472211_3472415_+	hypothetical protein	NA	NA	NA	NA	NA
AVM05525.1|3472404_3473442_+	methyltransferase	NA	NA	NA	NA	NA
AVM05526.1|3473489_3474179_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	9.3e-56
AVM05527.1|3474483_3474867_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
AVM05528.1|3474922_3475510_-	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AVM06702.1|3475612_3476494_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVM05529.1|3476702_3478037_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 258
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3483808	3487551	4607960		Tupanvirus(50.0%)	4	NA	NA
AVM05536.1|3483808_3485608_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
AVM05537.1|3485623_3486598_+	S26 family signal peptidase	NA	NA	NA	NA	NA
AVM05538.1|3486648_3486927_-	hypothetical protein	NA	NA	NA	NA	NA
AVM05539.1|3486870_3487551_+	ribonuclease 3	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 259
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3491010	3506754	4607960	tRNA	Bacillus_phage(33.33%)	13	NA	NA
AVM05546.1|3491010_3491271_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
AVM05547.1|3491326_3492175_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AVM05548.1|3492383_3493019_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
AVM05549.1|3493043_3493580_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
AVM05550.1|3493564_3493711_+	aldehyde dehydrogenase	NA	A0A2L1IV26	Escherichia_phage	96.4	9.8e-08
AVM05551.1|3495282_3495432_+	phosphoribosylglycinamide synthetase	NA	NA	NA	NA	NA
AVM05552.1|3495446_3499334_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	5.9e-131
AVM05553.1|3499909_3501337_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
AVM05554.1|3501501_3502215_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AVM05555.1|3502204_3503539_+	transcriptional regulator	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
AVM05556.1|3503599_3503938_+	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AVM05557.1|3503982_3505173_-	flavohemoprotein	NA	NA	NA	NA	NA
AVM05558.1|3505500_3506754_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 260
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3512646	3514158	4607960		Staphylococcus_phage(100.0%)	1	NA	NA
AVM05562.1|3512646_3514158_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.7	1.8e-11
>prophage 261
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3529476	3535813	4607960		Faustovirus(20.0%)	8	NA	NA
AVM05578.1|3529476_3530691_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
AVM05579.1|3530718_3531105_+	iron-sulfur cluster scaffold-like protein	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
AVM05580.1|3531121_3531445_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
AVM05581.1|3531540_3532056_+	co-chaperone protein HscB	NA	NA	NA	NA	NA
AVM05582.1|3532072_3533923_+	molecular chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
AVM05583.1|3533924_3534260_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AVM05584.1|3534271_3534472_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AVM05585.1|3534529_3535813_+	peptidase B	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
>prophage 262
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3546023	3546455	4607960		Powai_lake_megavirus(100.0%)	1	NA	NA
AVM05590.1|3546023_3546455_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 263
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3555285	3561768	4607960		Escherichia_phage(66.67%)	8	NA	NA
AVM05599.1|3555285_3556656_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.4e-42
AVM05600.1|3556817_3558284_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
AVM05601.1|3558352_3559930_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AVM05602.1|3560022_3560562_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
AVM05603.1|3560577_3561096_-	hypothetical protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
AVM05604.1|3561198_3561345_-	succinate dehydrogenase	NA	NA	NA	NA	NA
AVM05605.1|3561406_3561598_-	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AVM05606.1|3561615_3561768_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 264
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3568014	3572016	4607960		Prochlorococcus_phage(33.33%)	5	NA	NA
AVM05610.1|3568014_3568653_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
AVM05611.1|3568652_3569690_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
AVM05612.1|3569708_3569894_-	hypothetical protein	NA	NA	NA	NA	NA
AVM05613.1|3570014_3570641_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AVM05614.1|3570726_3572016_+	uracil/xanthine transporter	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 265
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3593260	3593974	4607960		Synechococcus_phage(100.0%)	1	NA	NA
AVM05635.1|3593260_3593974_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 266
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3611262	3612213	4607960		Cyanophage(100.0%)	1	NA	NA
AVM05648.1|3611262_3612213_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 267
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3630866	3634588	4607960		Deep-sea_thermophilic_phage(50.0%)	5	NA	NA
AVM05668.1|3630866_3631736_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
AVM05669.1|3631949_3632375_+	acetyltransferase YpeA	NA	NA	NA	NA	NA
AVM05670.1|3632361_3632811_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AVM05671.1|3633017_3633593_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AVM05672.1|3633688_3634588_+	deferrochelatase/peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
>prophage 268
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3638241	3639033	4607960		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AVM05676.1|3638241_3639033_+	NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.2e-17
>prophage 269
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3642050	3654720	4607960		Streptococcus_phage(40.0%)	13	NA	NA
AVM05681.1|3642050_3643148_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
AVM05682.1|3643281_3644193_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	7.7e-58
AVM05683.1|3644189_3644429_-	hypothetical protein	NA	NA	NA	NA	NA
AVM05684.1|3644397_3645132_-	WGR domain-containing protein	NA	NA	NA	NA	NA
AVM05685.1|3645164_3645539_-	hypothetical protein	NA	NA	NA	NA	NA
AVM05686.1|3645643_3646495_+	pyridoxine kinase	NA	NA	NA	NA	NA
AVM05687.1|3646537_3647047_-	glucose-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AVM05688.1|3647087_3648815_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
AVM05689.1|3648859_3649117_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AVM05690.1|3649500_3650472_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
AVM05691.1|3650656_3651418_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
AVM05692.1|3651647_3652634_+	cell division protein ZipA	NA	NA	NA	NA	NA
AVM05693.1|3652704_3654720_+	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	5.9e-151
>prophage 270
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3676021	3676756	4607960		Clostridioides_phage(100.0%)	1	NA	NA
AVM05713.1|3676021_3676756_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 271
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3680574	3681495	4607960		Morganella_phage(100.0%)	1	NA	NA
AVM05716.1|3680574_3681495_-	lipid A biosynthesis palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 272
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3685186	3692763	4607960		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
AVM05721.1|3685186_3686881_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
AVM05722.1|3686950_3687895_+	transporter YfdV	NA	NA	NA	NA	NA
AVM05723.1|3687968_3689114_+	acetyl-CoA--oxalate CoA-transferase	NA	NA	NA	NA	NA
AVM05724.1|3689169_3692763_-	sensor protein EvgS	NA	W8CYM9	Bacillus_phage	40.0	1.1e-09
>prophage 273
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3700688	3701621	4607960		Enterobacteria_phage(100.0%)	1	NA	NA
AVM05731.1|3700688_3701621_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.4	2.3e-166
>prophage 274
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3720298	3721384	4607960		Pandoravirus(100.0%)	1	NA	NA
AVM05750.1|3720298_3721384_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 275
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3729920	3731057	4607960		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVM05759.1|3729920_3731057_+	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.9e-23
>prophage 276
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3737533	3739051	4607960		Mollivirus(100.0%)	1	NA	NA
AVM05767.1|3737533_3739051_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 277
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3743262	3745123	4607960	transposase	Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
AVM05773.1|3743262_3744036_+	histidine transport ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
AVM05774.1|3744232_3745123_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	44.2	5.2e-67
>prophage 278
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3755683	3758911	4607960		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
AVM05786.1|3755683_3756334_+	sugar phosphatase YfbT	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.4	3.1e-08
AVM05787.1|3756420_3758253_+	transporter	NA	NA	NA	NA	NA
AVM05788.1|3758311_3758911_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 279
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3777859	3779217	4607960	transposase	Bacillus_phage(100.0%)	1	NA	NA
AVM05805.1|3777859_3779217_-|transposase	IS3-like element ISEcB1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.9	2.5e-76
>prophage 280
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3794829	3799833	4607960		Tupanvirus(50.0%)	4	NA	NA
AVM05821.1|3794829_3796812_-	bifunctional UDP-glucuronic acid oxidase/UDP-4-amino-4-deoxy-L-arabinose formyltransferase	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
AVM05822.1|3796811_3797780_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
AVM05823.1|3797783_3798923_-	UDP-4-amino-4-deoxy-L-arabinose-oxoglutarate aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.5e-29
AVM05824.1|3799230_3799833_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	2.6e-09
>prophage 281
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3803436	3807752	4607960		Oenococcus_phage(50.0%)	4	NA	NA
AVM06711.1|3803436_3804642_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
AVM05829.1|3804698_3805988_+	MFS transporter	NA	NA	NA	NA	NA
AVM05830.1|3806005_3806809_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
AVM05831.1|3806849_3807752_-	hypothetical protein	NA	Q2A0A7	Sodalis_phage	54.4	2.1e-68
>prophage 282
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3813644	3819799	4607960		Pseudomonas_phage(50.0%)	6	NA	NA
AVM05836.1|3813644_3814721_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.0e-08
AVM05837.1|3814762_3814969_-	hypothetical protein	NA	NA	NA	NA	NA
AVM05838.1|3815183_3815834_+	protein InaA	NA	NA	NA	NA	NA
AVM05839.1|3815887_3816142_-	ferredoxin	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
AVM06712.1|3816141_3817272_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
AVM05840.1|3817513_3819799_-	ribonucleoside-diphosphate reductase 1 subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
>prophage 283
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3825243	3827871	4607960		Bacillus_virus(100.0%)	1	NA	NA
AVM05843.1|3825243_3827871_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
>prophage 284
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3842794	3854288	4607960		Bacillus_phage(33.33%)	7	NA	NA
AVM05854.1|3842794_3844621_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
AVM05855.1|3844787_3847637_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	2.4e-41
AVM05856.1|3848618_3849614_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.8	1.0e-103
AVM05857.1|3849725_3850781_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
AVM05858.1|3850854_3851919_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	2.4e-18
AVM05859.1|3851918_3852569_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
AVM05860.1|3852644_3854288_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.2e-13
>prophage 285
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3863165	3863789	4607960		Bacillus_virus(100.0%)	1	NA	NA
AVM05871.1|3863165_3863789_+	cytochrome c biogenesis ATP-binding export protein CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.0e-12
>prophage 286
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3875663	3883311	4607960		Vibrio_phage(50.0%)	8	NA	NA
AVM05884.1|3875663_3876671_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	6.9e-84
AVM05885.1|3876809_3877094_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AVM05886.1|3877218_3878979_-	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	41.8	2.4e-100
AVM05887.1|3879004_3879127_-	aldose epimerase	NA	NA	NA	NA	NA
AVM05888.1|3879127_3879823_+	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
AVM05889.1|3879850_3881041_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
AVM05890.1|3881373_3881718_+	hypothetical protein	NA	NA	NA	NA	NA
AVM05891.1|3881721_3883311_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	3.2e-19
>prophage 287
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3889065	3893366	4607960		Clostridioides_phage(50.0%)	4	NA	NA
AVM05896.1|3889065_3889632_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
AVM05897.1|3890043_3890757_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AVM05898.1|3890795_3891782_-	GTP-binding protein	NA	NA	NA	NA	NA
AVM05899.1|3891899_3893366_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.3e-43
>prophage 288
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3907863	3908721	4607960		Catovirus(100.0%)	1	NA	NA
AVM05913.1|3907863_3908721_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
>prophage 289
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3912791	3916577	4607960	tRNA	Acinetobacter_phage(50.0%)	5	NA	NA
AVM05918.1|3912791_3914783_+	colicin I receptor	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
AVM05919.1|3914814_3915651_-	S-formylglutathione hydrolase YeiG	NA	NA	NA	NA	NA
AVM05920.1|3915578_3915755_-	hypothetical protein	NA	NA	NA	NA	NA
AVM05921.1|3915811_3915925_+|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AVM05922.1|3915908_3916577_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 290
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3920271	3921792	4607960		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVM05927.1|3920271_3921792_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	3.4e-10
>prophage 291
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3942194	3951636	4607960		Enterobacteria_phage(85.71%)	10	NA	NA
AVM05947.1|3942194_3943121_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
AVM05948.1|3943125_3943857_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AVM05949.1|3943837_3943945_-	hypothetical protein	NA	NA	NA	NA	NA
AVM05950.1|3944004_3944736_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AVM05951.1|3944957_3946643_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AVM05952.1|3946639_3947359_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVM05953.1|3947405_3947876_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AVM05954.1|3947916_3948378_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AVM05955.1|3948502_3950503_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.4	0.0e+00
AVM05956.1|3950499_3951636_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 292
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	3963268	4014048	4607960	integrase,plate,tRNA,tail	Escherichia_phage(32.0%)	56	3987569:3987591	4009725:4009747
AVM05962.1|3963268_3965302_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	2.3e-54
AVM05963.1|3965433_3966543_+	protein mrp	NA	NA	NA	NA	NA
AVM05964.1|3966805_3966994_+	DUF2574 domain-containing protein	NA	NA	NA	NA	NA
AVM05965.1|3967876_3968068_+	hypothetical protein	NA	NA	NA	NA	NA
AVM05966.1|3968015_3968414_-	hypothetical protein	NA	NA	NA	NA	NA
AVM05967.1|3968750_3969002_+	hypothetical protein	NA	NA	NA	NA	NA
AVM05968.1|3969096_3969360_+	hypothetical protein	NA	NA	NA	NA	NA
AVM05969.1|3969553_3970219_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AVM05970.1|3970322_3970754_-	hypothetical protein	NA	NA	NA	NA	NA
AVM06714.1|3970800_3971040_-	transcription factor	NA	NA	NA	NA	NA
AVM05971.1|3971368_3972157_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AVM05972.1|3972153_3972954_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AVM05973.1|3973018_3973837_+	hypothetical protein	NA	D0R7H8	Paenibacillus_phage	38.0	2.9e-24
AVM05974.1|3973888_3974635_+	transcriptional regulator	NA	NA	NA	NA	NA
AVM05975.1|3974608_3975574_-	sugar kinase	NA	NA	NA	NA	NA
AVM05976.1|3975570_3976575_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	5.8e-14
AVM05977.1|3976571_3977849_-	MFS transporter	NA	NA	NA	NA	NA
AVM05978.1|3978105_3979158_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AVM05979.1|3979457_3980312_+	tagatose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AVM05980.1|3980340_3981603_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
AVM05981.1|3981612_3982065_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
AVM05982.1|3982095_3982380_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
AVM05983.1|3982383_3983739_+	galactitol permease IIC component	NA	NA	NA	NA	NA
AVM05984.1|3983786_3984827_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
AVM05985.1|3984926_3985706_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AVM05986.1|3985787_3986687_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
AVM05987.1|3987091_3987409_+	hypothetical protein	NA	NA	NA	NA	NA
AVM05988.1|3987396_3987612_+	hypothetical protein	NA	NA	NA	NA	NA
3987569:3987591	attL	AAAAAATAAGCCCGTGTAAGGGA	NA	NA	NA	NA
AVM05989.1|3987674_3988688_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
AVM05990.1|3988803_3989103_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
AVM05991.1|3989224_3989500_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
AVM05992.1|3989677_3990178_+	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
AVM05993.1|3990241_3990466_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	95.9	1.5e-31
AVM05994.1|3990465_3990765_+	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
AVM05995.1|3990767_3990992_+	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	1.5e-34
AVM05996.1|3990988_3991264_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
AVM05997.1|3991253_3993536_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
AVM05998.1|3993624_3994848_+	hypothetical protein	NA	NA	NA	NA	NA
AVM06715.1|3994894_3995347_+	hypothetical protein	NA	NA	NA	NA	NA
AVM05999.1|3995346_3997314_+	exonuclease SbcC	NA	NA	NA	NA	NA
AVM06000.1|3998615_3999401_-	hypothetical protein	NA	NA	NA	NA	NA
AVM06001.1|3999484_4000120_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
AVM06002.1|4000116_4000464_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	1.1e-57
AVM06003.1|4000468_4001377_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	8.3e-161
AVM06004.1|4001369_4001900_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	1.3e-102
AVM06005.1|4001910_4004769_+	hypothetical protein	NA	A0A0A0YPY9	Escherichia_phage	76.7	0.0e+00
AVM06006.1|4004980_4006093_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AVM06007.1|4006070_4006298_-	hypothetical protein	NA	NA	NA	NA	NA
AVM06008.1|4007138_4007321_-	hypothetical protein	NA	A0A0F7LCJ0	Escherichia_phage	81.6	2.4e-11
AVM06009.1|4007340_4008531_+|tail	phage tail protein	tail	Q858V1	Yersinia_virus	98.2	2.6e-223
AVM06010.1|4008543_4009323_+	hypothetical protein	NA	A0A0F7LDR0	Escherichia_phage	98.8	1.9e-73
AVM06011.1|4009368_4009623_+	transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AVM06012.1|4009895_4011257_-	peptidase	NA	Q6DW11	Phage_TP	99.7	1.9e-217
4009725:4009747	attR	AAAAAATAAGCCCGTGTAAGGGA	NA	NA	NA	NA
AVM06013.1|4011402_4011735_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AVM06014.1|4011925_4012648_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
AVM06015.1|4012644_4014048_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 293
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4027163	4028516	4607960		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVM06023.1|4027163_4028516_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	1.9e-07
>prophage 294
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4033233	4043624	4607960		Catovirus(20.0%)	8	NA	NA
AVM06026.1|4033233_4033875_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
AVM06027.1|4033966_4034548_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
AVM06028.1|4034569_4036423_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AVM06029.1|4036696_4038280_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
AVM06030.1|4038938_4040078_+	lipoprotein	NA	NA	NA	NA	NA
AVM06031.1|4040083_4040527_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AVM06032.1|4040529_4042692_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	1.9e-17
AVM06033.1|4042784_4043624_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	4.4e-07
>prophage 295
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4047868	4054662	4607960		Synechococcus_phage(25.0%)	6	NA	NA
AVM06039.1|4047868_4048990_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
AVM06040.1|4048992_4049958_+	GDP-fucose synthetase	NA	D1LW79	Prochlorococcus_phage	51.1	1.3e-87
AVM06041.1|4049960_4050440_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AVM06042.1|4050436_4051660_+	colanic acid biosynthesis glycosyltransferase WcaI	NA	NA	NA	NA	NA
AVM06043.1|4051662_4053099_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	7.4e-47
AVM06044.1|4053291_4054662_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	2.2e-32
>prophage 296
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4060260	4069117	4607960		Enterobacteria_phage(42.86%)	8	NA	NA
AVM06049.1|4060260_4061655_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
AVM06050.1|4061829_4062723_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AVM06051.1|4063095_4064181_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	3.9e-101
AVM06052.1|4064180_4065080_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
AVM06053.1|4065138_4066017_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	8.7e-107
AVM06054.1|4066021_4066567_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.9	1.6e-47
AVM06055.1|4066570_4067995_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AVM06056.1|4068004_4069117_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	25.7	1.3e-14
>prophage 297
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4075132	4080939	4607960		Hokovirus(25.0%)	4	NA	NA
AVM06063.1|4075132_4076557_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.7	8.4e-59
AVM06064.1|4076590_4077955_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.8	1.3e-32
AVM06065.1|4078118_4079525_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.6	2.8e-38
AVM06066.1|4079772_4080939_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.7e-110
>prophage 298
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4088294	4089194	4607960		Cellulophaga_phage(100.0%)	1	NA	NA
AVM06075.1|4088294_4089194_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	7.0e-11
>prophage 299
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4096397	4097564	4607960		Stx2-converting_phage(100.0%)	1	NA	NA
AVM06082.1|4096397_4097564_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	5.5e-226
>prophage 300
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4128490	4129021	4607960		Escherichia_phage(100.0%)	1	NA	NA
AVM06104.1|4128490_4129021_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 301
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4132565	4133237	4607960		Bacillus_phage(100.0%)	1	NA	NA
AVM06723.1|4132565_4133237_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 302
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4146324	4147839	4607960		Cedratvirus(100.0%)	1	NA	NA
AVM06123.1|4146324_4147839_+	arabinose import ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
>prophage 303
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4157926	4163570	4607960		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
AVM06134.1|4157926_4159588_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
AVM06135.1|4159633_4161235_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
AVM06136.1|4161253_4162114_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AVM06137.1|4162116_4163166_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AVM06138.1|4163180_4163570_+	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 304
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4168822	4170556	4607960	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVM06144.1|4168822_4170556_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 305
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4177172	4179223	4607960		Synechococcus_phage(50.0%)	3	NA	NA
AVM06150.1|4177172_4177916_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
AVM06151.1|4177956_4178352_-	hypothetical protein	NA	NA	NA	NA	NA
AVM06152.1|4178404_4179223_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
>prophage 306
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4183241	4190499	4607960		Bacillus_virus(50.0%)	9	NA	NA
AVM06157.1|4183241_4183763_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
AVM06158.1|4183764_4184367_-	hypothetical protein	NA	NA	NA	NA	NA
AVM06724.1|4184437_4184503_+	hypothetical protein	NA	NA	NA	NA	NA
AVM06159.1|4184641_4185253_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AVM06160.1|4185261_4186272_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AVM06161.1|4186612_4187398_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AVM06162.1|4187394_4188150_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
AVM06725.1|4188228_4189161_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVM06163.1|4189176_4190499_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 307
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4194497	4195973	4607960		Cyanophage(100.0%)	1	NA	NA
AVM06167.1|4194497_4195973_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
>prophage 308
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4204029	4208498	4607960		Klebsiella_phage(33.33%)	7	NA	NA
AVM06175.1|4204029_4204692_-	DNA polymerase III subunit epsilon	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
AVM06176.1|4204715_4205372_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AVM06177.1|4205473_4205704_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
AVM06178.1|4205842_4206217_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AVM06179.1|4206220_4207093_+	hypothetical protein	NA	NA	NA	NA	NA
AVM06180.1|4207105_4207447_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AVM06181.1|4207841_4208498_+	serine/threonine-protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
>prophage 309
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4215994	4218043	4607960	protease,tail	Moraxella_phage(100.0%)	1	NA	NA
AVM06187.1|4215994_4218043_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
>prophage 310
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4223395	4226554	4607960	transposase	Escherichia_phage(33.33%)	3	NA	NA
AVM06195.1|4223395_4224412_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AVM06196.1|4224574_4224784_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AVM06197.1|4225738_4226554_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
>prophage 311
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4231618	4233175	4607960		Moraxella_phage(100.0%)	1	NA	NA
AVM06205.1|4231618_4233175_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 312
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4237037	4245143	4607960	tRNA	Pandoravirus(33.33%)	8	NA	NA
AVM06209.1|4237037_4238399_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
AVM06210.1|4238472_4238652_+	YoaH family protein	NA	NA	NA	NA	NA
AVM06211.1|4238771_4239131_-	DUF1889 domain-containing protein	NA	NA	NA	NA	NA
AVM06212.1|4239492_4239837_-	hypothetical protein	NA	NA	NA	NA	NA
AVM06213.1|4239968_4241879_+	ATP-dependent helicase	NA	A0A127AW80	Bacillus_phage	31.7	6.5e-91
AVM06214.1|4241936_4242632_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AVM06215.1|4242671_4243253_+	hypothetical protein	NA	NA	NA	NA	NA
AVM06216.1|4243457_4245143_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 313
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4261021	4265598	4607960		Bacillus_phage(100.0%)	3	NA	NA
AVM06235.1|4261021_4262512_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	4.9e-09
AVM06236.1|4262692_4264168_-	hypothetical protein	NA	NA	NA	NA	NA
AVM06237.1|4264314_4265598_-	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 314
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4268916	4269771	4607960		Indivirus(100.0%)	1	NA	NA
AVM06239.1|4268916_4269771_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.6	2.5e-10
>prophage 315
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4278581	4282667	4607960		Staphylococcus_phage(50.0%)	4	NA	NA
AVM06249.1|4278581_4279562_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	7.9e-08
AVM06250.1|4279698_4280457_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AVM06251.1|4280574_4281933_+	MFS transporter	NA	NA	NA	NA	NA
AVM06252.1|4282025_4282667_-	bifunctional pyrazinamidase/nicotinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
>prophage 316
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4287593	4289555	4607960		Streptococcus_phage(100.0%)	1	NA	NA
AVM06259.1|4287593_4289555_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 317
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4295153	4295807	4607960		Bacillus_phage(100.0%)	1	NA	NA
AVM06266.1|4295153_4295807_-	sulfate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.0	5.1e-11
>prophage 318
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4302534	4303755	4607960		Klosneuvirus(100.0%)	1	NA	NA
AVM06274.1|4302534_4303755_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 319
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4311231	4312059	4607960		Bacillus_virus(100.0%)	1	NA	NA
AVM06282.1|4311231_4312059_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 320
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4318388	4320650	4607960		Tupanvirus(100.0%)	1	NA	NA
AVM06290.1|4318388_4320650_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	2.3e-143
>prophage 321
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4331944	4351483	4607960	tRNA	Tupanvirus(22.22%)	19	NA	NA
AVM06304.1|4331944_4333873_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
AVM06305.1|4333876_4334419_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
AVM06306.1|4334515_4334713_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVM06307.1|4334765_4335122_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVM06735.1|4335244_4335289_+|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AVM06308.1|4335572_4336556_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
AVM06309.1|4336570_4338958_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AVM06310.1|4338962_4339262_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AVM06311.1|4339362_4340343_+	vitamin B12 import system permease BtuC	NA	NA	NA	NA	NA
AVM06312.1|4340405_4340957_+	glutathione peroxidase	NA	NA	NA	NA	NA
AVM06313.1|4340956_4341706_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	1.2e-08
AVM06314.1|4341783_4342248_+	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
AVM06315.1|4343269_4344706_+	YdiU family protein	NA	NA	NA	NA	NA
AVM06316.1|4344709_4344901_-	hypothetical protein	NA	NA	NA	NA	NA
AVM06317.1|4345032_4346079_-	phospho-2-dehydro-3-deoxyheptonate aldolase Trp-sensitive	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
AVM06318.1|4346235_4347069_-	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AVM06319.1|4347180_4347348_+	hypothetical protein	NA	NA	NA	NA	NA
AVM06320.1|4347401_4349780_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	1.2e-171
AVM06736.1|4349836_4351483_-	cyclohexanecarboxylate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	7.7e-32
>prophage 322
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4370128	4375212	4607960		Lake_Baikal_phage(33.33%)	5	NA	NA
AVM06337.1|4370128_4370497_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
AVM06338.1|4370505_4371993_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AVM06339.1|4372002_4372749_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	1.1e-06
AVM06340.1|4372723_4373995_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
AVM06341.1|4373991_4375212_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.2	1.1e-91
>prophage 323
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4383501	4385768	4607960		Escherichia_phage(50.0%)	3	NA	NA
AVM06737.1|4383501_4384170_+	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
AVM06350.1|4384166_4384952_+	protein PhsC	NA	NA	NA	NA	NA
AVM06351.1|4384955_4385768_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 324
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4391272	4400153	4607960		Orpheovirus(20.0%)	10	NA	NA
AVM06356.1|4391272_4391914_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
AVM06357.1|4391953_4393102_-	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
AVM06358.1|4393392_4394604_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AVM06359.1|4394716_4395649_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVM06360.1|4395645_4396671_-	PurR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
AVM06361.1|4396658_4396883_-	hypothetical protein	NA	NA	NA	NA	NA
AVM06362.1|4396969_4397059_+	YnhF family membrane protein	NA	NA	NA	NA	NA
AVM06363.1|4397224_4398394_+	MFS transporter	NA	NA	NA	NA	NA
AVM06364.1|4398628_4399210_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
AVM06365.1|4399337_4400153_-	murein DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 325
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4408955	4410454	4607960		Indivirus(50.0%)	2	NA	NA
AVM06373.1|4408955_4409852_+	oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
AVM06738.1|4409932_4410454_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 326
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4417365	4418640	4607960	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AVM06381.1|4417365_4418640_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.1	3.3e-83
>prophage 327
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4438515	4440327	4607960		Vaccinia_virus(100.0%)	1	NA	NA
AVM06403.1|4438515_4440327_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 328
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4469466	4514801	4607960	holin,tail,transposase	Escherichia_phage(26.47%)	58	NA	NA
AVM06431.1|4469466_4470081_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AVM06432.1|4470123_4470978_-	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AVM06433.1|4470979_4471597_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AVM06742.1|4471607_4474031_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
AVM06434.1|4474091_4476518_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	5.0e-213
AVM06435.1|4476716_4477022_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AVM06743.1|4477129_4477840_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AVM06436.1|4477842_4478403_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AVM06437.1|4478437_4478779_-	hypothetical protein	NA	NA	NA	NA	NA
AVM06438.1|4478913_4479240_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AVM06439.1|4479276_4479465_+	hypothetical protein	NA	NA	NA	NA	NA
AVM06440.1|4479445_4480660_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AVM06441.1|4480671_4481691_+	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AVM06442.1|4481748_4481853_+	transporter	NA	NA	NA	NA	NA
AVM06443.1|4483192_4483444_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AVM06444.1|4483516_4485988_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.2	5.0e-59
AVM06445.1|4486081_4486273_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVM06446.1|4486269_4486458_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AVM06447.1|4486960_4487161_+	hypothetical protein	NA	NA	NA	NA	NA
AVM06744.1|4487129_4487495_-	hypothetical protein	NA	NA	NA	NA	NA
AVM06448.1|4487506_4487659_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
AVM06449.1|4487827_4488235_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
AVM06450.1|4488315_4488543_+	transcriptional regulator	NA	NA	NA	NA	NA
AVM06451.1|4488526_4489048_+	hypothetical protein	NA	NA	NA	NA	NA
AVM06452.1|4488974_4489994_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	5.2e-55
AVM06453.1|4490034_4490457_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.3e-65
AVM06454.1|4490453_4490687_+	methyltransferase	NA	I6S1S6	Salmonella_phage	67.9	2.9e-17
AVM06455.1|4490740_4491406_+	hypothetical protein	NA	NA	NA	NA	NA
AVM06456.1|4491961_4492174_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
AVM06457.1|4492390_4492642_+	hypothetical protein	NA	NA	NA	NA	NA
AVM06458.1|4492708_4492987_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
AVM06459.1|4492988_4493639_+	DUF968 domain-containing protein	NA	Q8SBE5	Shigella_phage	70.3	2.6e-68
AVM06460.1|4493656_4494034_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
AVM06461.1|4494189_4494714_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
AVM06462.1|4495083_4496246_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AVM06463.1|4497131_4497320_+	hypothetical protein	NA	NA	NA	NA	NA
AVM06464.1|4497524_4498247_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVM06465.1|4498437_4498653_+|holin	holin	holin	A5LH82	Enterobacteria_phage	94.4	2.9e-32
AVM06466.1|4498657_4499209_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	49.4	3.3e-35
AVM06467.1|4499156_4499417_-	hypothetical protein	NA	NA	NA	NA	NA
AVM06468.1|4499530_4500064_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
AVM06469.1|4500060_4500558_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AVM06470.1|4500921_4501134_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AVM06745.1|4501144_4501333_+	cold-shock protein	NA	NA	NA	NA	NA
AVM06746.1|4501480_4501636_+	hypothetical protein	NA	NA	NA	NA	NA
AVM06747.1|4501808_4501982_+	protein GnsB	NA	NA	NA	NA	NA
AVM06471.1|4502277_4502484_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
AVM06472.1|4502637_4503800_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AVM06473.1|4505235_4505835_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	96.0	4.5e-107
AVM06474.1|4505899_4508278_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.8	3.4e-137
AVM06475.1|4508277_4508559_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	4.5e-17
AVM06476.1|4508568_4509273_+	chaperone of endosialidase	NA	A0A1X7QGH6	Escherichia_phage	61.7	1.9e-59
AVM06477.1|4509283_4509577_+	hypothetical protein	NA	NA	NA	NA	NA
AVM06478.1|4509804_4510395_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AVM06479.1|4510710_4510944_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AVM06480.1|4511729_4513013_+	MFS transporter	NA	NA	NA	NA	NA
AVM06481.1|4513101_4514562_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.3	2.8e-41
AVM06482.1|4514597_4514801_-	protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 329
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4520165	4521056	4607960		Bacillus_phage(100.0%)	1	NA	NA
AVM06488.1|4520165_4521056_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.7	6.2e-20
>prophage 330
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4524058	4525436	4607960		Streptococcus_phage(50.0%)	3	NA	NA
AVM06493.1|4524058_4524442_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
AVM06494.1|4524461_4524896_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVM06495.1|4525115_4525436_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	42.3	7.2e-19
>prophage 331
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4533382	4534330	4607960		Bacillus_phage(100.0%)	1	NA	NA
AVM06749.1|4533382_4534330_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	9.6e-19
>prophage 332
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4541149	4542550	4607960		Escherichia_phage(100.0%)	1	NA	NA
AVM06750.1|4541149_4542550_+	outer membrane autotransporter barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	4.0e-106
>prophage 333
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4558488	4565424	4607960		Bacillus_phage(50.0%)	3	NA	NA
AVM06526.1|4558488_4560174_+	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.6	7.7e-11
AVM06527.1|4560211_4562584_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AVM06528.1|4562628_4565424_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	3.4e-19
>prophage 334
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4570703	4574510	4607960		Bacillus_virus(50.0%)	2	NA	NA
AVM06532.1|4570703_4572086_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
AVM06533.1|4572086_4574510_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 335
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4578826	4580732	4607960		Planktothrix_phage(100.0%)	2	NA	NA
AVM06538.1|4578826_4579813_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	2.9e-18
AVM06539.1|4579805_4580732_+	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	7.0e-14
>prophage 336
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4584005	4585446	4607960		Tupanvirus(50.0%)	2	NA	NA
AVM06544.1|4584005_4585016_+	zinc-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
AVM06545.1|4585161_4585446_+	transcriptional regulator	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 337
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4591602	4591893	4607960		Enterobacteria_phage(100.0%)	1	NA	NA
AVM06550.1|4591602_4591893_+	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 338
CP027430	Escherichia coli strain AS19-RrmA- chromosome, complete genome	4607960	4598777	4600322	4607960		Escherichia_phage(100.0%)	1	NA	NA
AVM06553.1|4598777_4600322_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	4.9e-20
