The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027667	Melaminivora sp. SC2-9 chromosome, complete genome	3754020	3519658	3561718	3754020	integrase,transposase,protease	uncultured_Caudovirales_phage(50.0%)	40	3505802:3505817	3563866:3563881
3505802:3505817	attL	GCGTCGACCGATGCCC	NA	NA	NA	NA
AVO50656.1|3519658_3521761_+|protease	BREX system Lon protease-like protein BrxL	protease	NA	NA	NA	NA
AVO50657.1|3521788_3523645_-	relaxase	NA	NA	NA	NA	NA
AVO51198.1|3523961_3524588_+|integrase	integrase	integrase	NA	NA	NA	NA
AVO50658.1|3524673_3524991_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AVO50659.1|3525476_3525839_+	DUF3742 domain-containing protein	NA	NA	NA	NA	NA
AVO50660.1|3525852_3527376_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AVO50661.1|3527391_3527763_-	hypothetical protein	NA	NA	NA	NA	NA
AVO50662.1|3527759_3529178_-	integrating conjugative element protein	NA	NA	NA	NA	NA
AVO50663.1|3529188_3530136_-	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
AVO50664.1|3530132_3530579_-	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
AVO50665.1|3530723_3531218_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AVO50666.1|3531403_3532168_-	disulfide bond formation protein DsbA	NA	NA	NA	NA	NA
AVO50667.1|3532183_3535093_-	conjugative transfer ATPase	NA	NA	NA	NA	NA
AVO50668.1|3535092_3535542_-	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
AVO50669.1|3535522_3536932_-	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
AVO51199.1|3536921_3537851_-	TIGR03749 family integrating conjugative element protein	NA	NA	NA	NA	NA
AVO50670.1|3537856_3538549_-	TIGR03746 family integrating conjugative element protein	NA	NA	NA	NA	NA
AVO50671.1|3538545_3538956_-	TIGR03750 family conjugal transfer protein	NA	NA	NA	NA	NA
AVO50672.1|3538969_3539329_-	TIGR03745 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
AVO50673.1|3539345_3539579_-	TIGR03758 family integrating conjugative element protein	NA	NA	NA	NA	NA
AVO50674.1|3539575_3539959_-	RAQPRD family plasmid	NA	NA	NA	NA	NA
AVO50675.1|3540057_3540819_-	TIGR03747 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
AVO50676.1|3540815_3542999_-	conjugative coupling factor TraD, PFGI-1 class	NA	NA	NA	NA	NA
AVO50677.1|3543003_3543552_-	integrating conjugative element protein	NA	NA	NA	NA	NA
AVO50678.1|3543548_3544154_-	lytic transglycosylase	NA	NA	NA	NA	NA
AVO50679.1|3544135_3544873_-	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
AVO50680.1|3544887_3545523_-	hypothetical protein	NA	NA	NA	NA	NA
AVO50681.1|3545519_3546098_-	integrating conjugative element protein pill, pfgi-1	NA	NA	NA	NA	NA
AVO51200.1|3546317_3547040_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.5	3.6e-90
AVO50682.1|3547032_3547455_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	6.5e-52
AVO50683.1|3547469_3547709_-	hypothetical protein	NA	NA	NA	NA	NA
AVO50684.1|3547705_3548527_-	arsenite S-adenosylmethyltransferase	NA	NA	NA	NA	NA
AVO50685.1|3549353_3550391_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVO51201.1|3550618_3552121_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVO50686.1|3555674_3557231_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AVO50687.1|3557535_3558738_+|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	55.1	5.0e-121
AVO50688.1|3558885_3559107_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AVO50689.1|3559111_3559939_+	hypothetical protein	NA	NA	NA	NA	NA
AVO50690.1|3559925_3560807_+	replication protein C	NA	NA	NA	NA	NA
AVO51202.1|3561013_3561718_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
3563866:3563881	attR	GCGTCGACCGATGCCC	NA	NA	NA	NA
>prophage 2
CP027667	Melaminivora sp. SC2-9 chromosome, complete genome	3754020	3565578	3613070	3754020	tRNA,integrase,transposase	Escherichia_phage(25.0%)	54	3563618:3563637	3618953:3618972
3563618:3563637	attL	GCCGGCATCACCGGCGCCAC	NA	NA	NA	NA
AVO51205.1|3565578_3566283_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVO50696.1|3566459_3567224_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AVO50697.1|3567311_3567425_+	NTP-binding protein	NA	NA	NA	NA	NA
AVO50698.1|3567730_3568231_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVO50699.1|3568249_3568429_+	hypothetical protein	NA	NA	NA	NA	NA
AVO51204.1|3568358_3569198_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AVO50700.1|3569191_3569539_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVO50701.1|3569702_3570494_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AVO50702.1|3570510_3570633_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
AVO50703.1|3570617_3571091_-	trimethoprim-resistant dihydrofolate reductase DfrA6	NA	A0A1B2IBQ4	Erwinia_phage	33.7	2.4e-18
AVO50704.1|3571170_3571725_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
AVO51206.1|3571809_3572364_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
AVO50705.1|3572524_3573538_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVO50706.1|3573476_3573791_+|transposase	transposase	transposase	NA	NA	NA	NA
AVO50707.1|3573893_3574631_+	resolvase	NA	NA	NA	NA	NA
AVO50708.1|3574627_3574852_+	hypothetical protein	NA	NA	NA	NA	NA
AVO50709.1|3575062_3576556_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVO50710.1|3576586_3576838_+	hypothetical protein	NA	NA	NA	NA	NA
AVO50711.1|3576731_3577034_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AVO50712.1|3577120_3577936_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
AVO50713.1|3578370_3579408_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVO50714.1|3579974_3581741_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AVO50715.1|3581754_3582114_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AVO51207.1|3582240_3582570_-	transcriptional regulator	NA	NA	NA	NA	NA
AVO50716.1|3582709_3584989_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
AVO50717.1|3585125_3585431_-	hypothetical protein	NA	NA	NA	NA	NA
AVO50718.1|3585500_3585812_-	hypothetical protein	NA	NA	NA	NA	NA
AVO50719.1|3585912_3587034_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVO50720.1|3587098_3587746_-	hypothetical protein	NA	NA	NA	NA	NA
AVO50721.1|3587829_3588237_-	hypothetical protein	NA	NA	NA	NA	NA
AVO50722.1|3588331_3589030_-	hypothetical protein	NA	NA	NA	NA	NA
AVO50723.1|3589083_3589995_-	hypothetical protein	NA	NA	NA	NA	NA
AVO51208.1|3590372_3591185_-	GTPase	NA	NA	NA	NA	NA
AVO50724.1|3591465_3591744_-	uridylate kinase	NA	NA	NA	NA	NA
AVO50725.1|3591838_3592576_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVO50726.1|3592788_3593181_-	hypothetical protein	NA	NA	NA	NA	NA
AVO50727.1|3593202_3593415_-	hypothetical protein	NA	NA	NA	NA	NA
AVO50728.1|3593745_3593991_-	hypothetical protein	NA	NA	NA	NA	NA
AVO50729.1|3594514_3596527_-	DNA topoisomerase III	NA	A0A0G2Y4W4	Acanthamoeba_polyphaga_mimivirus	24.2	1.2e-10
AVO50730.1|3596796_3597237_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AVO50731.1|3597310_3597838_-|integrase	integrase	integrase	NA	NA	NA	NA
AVO50732.1|3597834_3598620_-	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
AVO50733.1|3598805_3600047_-	hypothetical protein	NA	NA	NA	NA	NA
AVO50734.1|3600050_3600611_-	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
AVO50735.1|3600626_3602255_-	hypothetical protein	NA	NA	NA	NA	NA
AVO50736.1|3602247_3602496_-	hypothetical protein	NA	NA	NA	NA	NA
AVO50737.1|3602479_3603355_-	cobyrinic acid a,c-diamide synthase	NA	NA	NA	NA	NA
AVO50738.1|3603397_3603610_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AVO50739.1|3603749_3604505_-	hypothetical protein	NA	NA	NA	NA	NA
AVO50740.1|3605073_3607002_-|integrase	integrase	integrase	A0A0U1UNT3	Pseudomonas_phage	45.0	2.9e-94
AVO50741.1|3607422_3610047_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.6	1.8e-78
AVO50742.1|3610075_3611089_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.5	2.8e-16
AVO50743.1|3611115_3611889_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AVO50744.1|3611846_3613070_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
3618953:3618972	attR	GTGGCGCCGGTGATGCCGGC	NA	NA	NA	NA
