The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027804	Aeromonas hydrophila strain KN-Mc-1R2 chromosome, complete genome	4911246	3114148	3144810	4911246	capsid,terminase,integrase,portal,head,holin,tail	Aeromonas_virus(85.19%)	37	3113956:3113986	3148080:3148110
3113956:3113986	attL	AAGGCGCTCAAAGCGCCTTTTTATTCATTTC	NA	NA	NA	NA
AVP85190.1|3114148_3115129_-|integrase	integrase	integrase	A0A0F7LA05	Escherichia_phage	54.3	3.2e-94
AVP86874.1|3115213_3115513_-	transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	64.6	1.9e-29
AVP85191.1|3115632_3115959_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	63.3	3.0e-20
AVP86875.1|3115964_3116516_+	hypothetical protein	NA	A5X9F7	Aeromonas_virus	55.0	5.4e-38
AVP85192.1|3116529_3116955_+	hypothetical protein	NA	NA	NA	NA	NA
AVP85193.1|3116994_3117180_+	hypothetical protein	NA	NA	NA	NA	NA
AVP86876.1|3117203_3117470_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVP85194.1|3118183_3118468_+	hypothetical protein	NA	NA	NA	NA	NA
AVP85195.1|3118467_3121035_+	hypothetical protein	NA	A5X9G4	Aeromonas_virus	39.3	3.9e-123
AVP85196.1|3121390_3123217_+	hypothetical protein	NA	NA	NA	NA	NA
AVP85197.1|3123557_3123854_-	hypothetical protein	NA	NA	NA	NA	NA
AVP85198.1|3124512_3124830_-	hypothetical protein	NA	NA	NA	NA	NA
AVP85199.1|3125022_3125277_-	transcriptional regulator	NA	A5X9H0	Aeromonas_virus	66.2	2.4e-25
AVP85200.1|3125335_3126151_-|portal	phage portal protein	portal	A5X9H1	Aeromonas_virus	76.6	2.8e-115
AVP85201.1|3126068_3128198_-|terminase	terminase	terminase	A5X9H3	Aeromonas_virus	67.1	5.3e-243
AVP85202.1|3128375_3129293_+|capsid	capsid protein	capsid	A5X9H4	Aeromonas_virus	48.8	4.4e-69
AVP85203.1|3129303_3130383_+|capsid	phage major capsid protein, P2 family	capsid	A5X9H5	Aeromonas_virus	69.9	2.5e-140
AVP85204.1|3130385_3131111_+|terminase	terminase	terminase	A5X9H6	Aeromonas_virus	74.1	9.4e-99
AVP86877.1|3131216_3131678_+|head	head protein	head	A5X9H7	Aeromonas_virus	69.9	1.3e-50
AVP85205.1|3131674_3132190_+	hypothetical protein	NA	A5X9H8	Aeromonas_virus	57.6	1.0e-54
AVP85206.1|3132215_3133340_+	DUF2586 domain-containing protein	NA	A5X9I0	Aeromonas_virus	85.6	5.0e-184
AVP85207.1|3133343_3133799_+	DUF2597 domain-containing protein	NA	A5X9I1	Aeromonas_virus	84.7	1.8e-68
AVP85208.1|3133809_3134019_+	hypothetical protein	NA	A5X9I2	Aeromonas_virus	82.6	2.7e-27
AVP85209.1|3134042_3134369_+|holin	phage holin, lambda family	holin	A5X9I3	Aeromonas_virus	59.4	4.0e-25
AVP85210.1|3134355_3134817_+	lysozyme	NA	A5X9I5	Aeromonas_virus	86.3	9.2e-76
AVP85211.1|3134813_3135248_+	hypothetical protein	NA	NA	NA	NA	NA
AVP85212.1|3135371_3135635_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	64.4	4.0e-23
AVP85213.1|3135823_3137878_+|tail	phage tail tape measure protein	tail	A5X9I9	Aeromonas_virus	59.2	5.7e-202
AVP85214.1|3137874_3138198_+	DUF2590 domain-containing protein	NA	A5X9J0	Aeromonas_virus	90.7	3.9e-49
AVP85215.1|3138194_3139376_+	hypothetical protein	NA	A5X9J1	Aeromonas_virus	65.7	1.6e-143
AVP85216.1|3139368_3140052_+	hypothetical protein	NA	A5X9J2	Aeromonas_virus	51.5	8.7e-38
AVP85217.1|3140036_3140792_+	permease	NA	G0ZT38	Aeromonas_phage	96.3	1.6e-69
AVP85218.1|3140788_3141538_+	hypothetical protein	NA	NA	NA	NA	NA
AVP85219.1|3141537_3141774_+	hypothetical protein	NA	NA	NA	NA	NA
AVP86878.1|3141830_3142652_+	hypothetical protein	NA	A5X9J6	Aeromonas_virus	56.5	1.5e-76
AVP85220.1|3142648_3143200_+	hypothetical protein	NA	A5X9J7	Aeromonas_virus	72.6	2.2e-63
AVP85221.1|3143196_3144810_+	hypothetical protein	NA	A5X9J8	Aeromonas_virus	81.8	6.6e-262
3148080:3148110	attR	AAGGCGCTCAAAGCGCCTTTTTATTCATTTC	NA	NA	NA	NA
>prophage 2
CP027804	Aeromonas hydrophila strain KN-Mc-1R2 chromosome, complete genome	4911246	3745900	3753402	4911246		Staphylococcus_phage(50.0%)	8	NA	NA
AVP85706.1|3745900_3746485_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	3.3e-30
AVP85707.1|3746568_3747780_+	GlyGly-CTERM sorting domain-containing protein	NA	V5LS29	Emiliania_huxleyi_virus	26.6	1.0e-09
AVP85708.1|3747843_3748953_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	39.2	2.1e-65
AVP85709.1|3749094_3749748_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.4	2.7e-20
AVP85710.1|3749802_3750912_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.2	1.6e-49
AVP85711.1|3751008_3751458_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AVP85712.1|3751592_3752069_-	hypothetical protein	NA	NA	NA	NA	NA
AVP85713.1|3752148_3753402_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.5	2.3e-100
>prophage 3
CP027804	Aeromonas hydrophila strain KN-Mc-1R2 chromosome, complete genome	4911246	3998558	4008494	4911246	tRNA	uncultured_Mediterranean_phage(25.0%)	10	NA	NA
AVP85904.1|3998558_4000424_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
AVP85905.1|4000637_4002425_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.1	5.2e-74
AVP85906.1|4002513_4002957_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	1.7e-26
AVP85907.1|4002972_4003188_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVP85908.1|4003367_4004381_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	2.0e-107
AVP85909.1|4004465_4005449_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.1	1.7e-34
AVP85910.1|4005496_4006537_-	peptidoglycan-binding protein	NA	A0A0A7NU10	Lactobacillus_phage	36.2	5.1e-13
AVP86921.1|4006547_4007123_-	DedA family protein	NA	NA	NA	NA	NA
AVP85911.1|4007125_4007743_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	4.0e-34
AVP85912.1|4007747_4008494_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	54.1	7.2e-70
