The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP020392	Burkholderia thailandensis strain FDAARGOS_238 chromosome 1, complete sequence	3827809	154004	203591	3827809	capsid,portal,transposase,tail,head,terminase,integrase,plate,protease	uncultured_Caudovirales_phage(31.25%)	61	145602:145636	189721:189755
145602:145636	attL	CCATCCCGCTCAAACTATCCGCTCCCCGTAGTTCA	NA	NA	NA	NA
AVR23856.1|154004_154793_-	restriction endonuclease subunit M	NA	Q8W6S4	Burkholderia_virus	95.4	7.4e-150
AVR23857.1|154935_155481_-	lysozyme	NA	Q8W6S5	Burkholderia_virus	92.3	1.1e-80
AVR23858.1|155480_155978_-	glycosyl hydrolase	NA	A4JX20	Burkholderia_virus	77.6	2.5e-66
AVR23859.1|155970_156165_-	hypothetical protein	NA	NA	NA	NA	NA
AVR23860.1|156240_157293_-	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	44.2	1.0e-77
AVR23861.1|157302_157509_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	58.2	2.6e-14
AVR23862.1|157483_158365_-	oxidoreductase	NA	A0A2H4J875	uncultured_Caudovirales_phage	37.4	3.9e-30
AVR23863.1|158373_160782_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	33.8	1.5e-68
AVR23864.1|160869_161172_-|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	35.9	4.3e-05
AVR23865.1|161241_161745_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	49.4	4.7e-41
AVR23866.1|161755_162925_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	73.5	4.3e-162
AVR23867.1|162991_163444_-|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	79.3	1.8e-44
AVR23868.1|163459_164923_-	hypothetical protein	NA	A4JWL8	Burkholderia_virus	78.4	2.2e-216
AVR23869.1|164910_165486_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	43.5	1.2e-32
AVR23870.1|165478_166372_-|plate	baseplate J protein	plate	A0A1J0I2M3	Salmonella_phage	39.8	4.2e-48
AVR23871.1|166368_166713_-|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	49.1	1.0e-23
AVR23872.1|166709_166916_-	hypothetical protein	NA	NA	NA	NA	NA
AVR23873.1|166979_167660_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	34.4	1.5e-18
AVR23874.1|167662_168196_-	hypothetical protein	NA	Q9JML9	Wolbachia_phage	38.0	7.5e-21
AVR23875.1|168185_168716_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	28.5	2.0e-10
AVR23876.1|168717_169008_-	hypothetical protein	NA	NA	NA	NA	NA
AVR23877.1|169011_170037_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	58.8	2.2e-109
AVR23878.1|170071_170416_-|head	head decoration protein	head	NA	NA	NA	NA
AVR23879.1|170443_171511_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	37.7	2.8e-51
AVR23880.1|171507_173001_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.4	1.5e-135
AVR23881.1|172997_173204_-	hypothetical protein	NA	NA	NA	NA	NA
AVR23882.1|173214_175203_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.3	6.0e-180
AVR23883.1|175165_175735_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVR23884.1|175828_176017_-	hypothetical protein	NA	NA	NA	NA	NA
AVR23885.1|176236_177010_-	hypothetical protein	NA	NA	NA	NA	NA
AVR23886.1|177227_179720_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.8	8.5e-99
AVR26850.1|179841_180312_-	hypothetical protein	NA	NA	NA	NA	NA
AVR23887.1|180442_180622_-	hypothetical protein	NA	NA	NA	NA	NA
AVR26851.1|180685_181144_-	hypothetical protein	NA	NA	NA	NA	NA
AVR23888.1|181145_181601_+	hypothetical protein	NA	NA	NA	NA	NA
AVR26852.1|181608_181941_-	hypothetical protein	NA	NA	NA	NA	NA
AVR23889.1|181954_182482_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.5	9.7e-29
AVR26853.1|182570_182798_-	hypothetical protein	NA	NA	NA	NA	NA
AVR26854.1|182946_183432_+	helix-turn-helix domain-containing protein	NA	A0A193GYL7	Enterobacter_phage	41.2	4.4e-12
AVR23890.1|183963_184182_+	hypothetical protein	NA	NA	NA	NA	NA
AVR23891.1|184233_184569_+	hypothetical protein	NA	NA	NA	NA	NA
AVR23892.1|184565_185171_+	hypothetical protein	NA	NA	NA	NA	NA
AVR23893.1|185167_185617_+	ACP synthase	NA	NA	NA	NA	NA
AVR23894.1|185616_186933_+	pyridoxal phosphate biosynthetic protein PdxJ	NA	NA	NA	NA	NA
AVR23895.1|187046_187376_+	hypothetical protein	NA	NA	NA	NA	NA
AVR26855.1|187384_188173_+	hypothetical protein	NA	Q6J1P0	Burkholderia_virus	57.3	5.0e-21
AVR23896.1|188160_188391_+	hypothetical protein	NA	NA	NA	NA	NA
AVR23897.1|188424_189525_-|integrase	site-specific integrase	integrase	A0A2D1GMX8	Marinobacter_phage	31.0	1.5e-44
AVR23898.1|190694_191931_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	5.8e-157
189721:189755	attR	CCATCCCGCTCAAACTATCCGCTCCCCGTAGTTCA	NA	NA	NA	NA
AVR23899.1|192687_193521_-	sel1 repeat family protein	NA	NA	NA	NA	NA
AVR23900.1|194209_197077_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.2	6.6e-71
AVR23901.1|197206_197548_-	hypothetical protein	NA	NA	NA	NA	NA
AVR26856.1|197544_197802_-	hypothetical protein	NA	NA	NA	NA	NA
AVR26857.1|197794_197971_-	hypothetical protein	NA	NA	NA	NA	NA
AVR23902.1|198341_198821_-	hypothetical protein	NA	NA	NA	NA	NA
AVR23903.1|198820_198991_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AVR23904.1|199221_199734_-	DNA-binding protein	NA	NA	NA	NA	NA
AVR23905.1|199834_200197_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AVR23906.1|200196_200544_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	71.0	1.2e-40
AVR23907.1|200573_202136_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.1	3.5e-143
AVR23908.1|202353_203591_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	5.8e-157
>prophage 2
CP020392	Burkholderia thailandensis strain FDAARGOS_238 chromosome 1, complete sequence	3827809	382024	392905	3827809	protease	Agrobacterium_phage(16.67%)	10	NA	NA
AVR24061.1|382024_384325_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	3.6e-168
AVR24062.1|384321_384636_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A218MMY6	uncultured_virus	44.6	2.6e-13
AVR24063.1|385166_385370_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
AVR24064.1|385481_387077_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
AVR24065.1|387089_387269_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AVR24066.1|387241_388501_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	6.8e-12
AVR24067.1|388765_389344_+	pseudouridine synthase	NA	NA	NA	NA	NA
AVR24068.1|389604_389820_+	hypothetical protein	NA	NA	NA	NA	NA
AVR24069.1|390015_390525_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	5.0e-14
AVR24070.1|390790_392905_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.0	2.3e-57
>prophage 3
CP020392	Burkholderia thailandensis strain FDAARGOS_238 chromosome 1, complete sequence	3827809	680969	742761	3827809	bacteriocin,integrase,transposase	Burkholderia_virus(28.57%)	43	688968:688985	751202:751219
AVR24297.1|680969_683240_-|bacteriocin	bacteriocin biosynthesis cyclodehydratase	bacteriocin	NA	NA	NA	NA
AVR24298.1|683328_683691_-	hypothetical protein	NA	NA	NA	NA	NA
AVR24299.1|683692_684055_-	hypothetical protein	NA	NA	NA	NA	NA
AVR24300.1|684051_688113_-	TOMM system kinase/cyclase fusion protein	NA	A0A2R8FF19	Brazilian_cedratvirus	26.7	8.0e-14
AVR24301.1|688123_689131_-	FHA domain-containing protein	NA	NA	NA	NA	NA
688968:688985	attL	TCGTGCAGTTCCCAGCGC	NA	NA	NA	NA
AVR24302.1|689378_689744_+	hypothetical protein	NA	NA	NA	NA	NA
AVR24303.1|690245_690590_+	hypothetical protein	NA	NA	NA	NA	NA
AVR24304.1|690878_691256_+	hypothetical protein	NA	NA	NA	NA	NA
AVR24305.1|691312_691654_+	hypothetical protein	NA	NA	NA	NA	NA
AVR24306.1|692454_692670_+	hypothetical protein	NA	NA	NA	NA	NA
AVR24307.1|692642_695924_+	hypothetical protein	NA	NA	NA	NA	NA
AVR24308.1|695945_702044_+	hypothetical protein	NA	NA	NA	NA	NA
AVR26898.1|702308_702659_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AVR24309.1|702897_703749_+	hypothetical protein	NA	NA	NA	NA	NA
AVR24310.1|704140_705377_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	5.8e-157
AVR24311.1|705504_705822_+	hypothetical protein	NA	NA	NA	NA	NA
AVR24312.1|705994_706246_+	transcriptional regulator	NA	NA	NA	NA	NA
AVR24313.1|706242_706428_+	hypothetical protein	NA	NA	NA	NA	NA
AVR24314.1|706435_708016_-	hydrolase	NA	NA	NA	NA	NA
AVR24315.1|708328_709057_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
AVR26899.1|709619_710057_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVR24316.1|710673_712236_+	Fic family protein	NA	Q9AZ49	Lactococcus_phage	30.6	6.9e-06
AVR24317.1|712601_713336_-	hydrolase TatD	NA	NA	NA	NA	NA
AVR24318.1|713332_714619_-	hypothetical protein	NA	NA	NA	NA	NA
AVR24319.1|714615_715443_-	hypothetical protein	NA	NA	NA	NA	NA
AVR24320.1|715442_717323_-	NTPase KAP	NA	NA	NA	NA	NA
AVR24321.1|717940_720412_+	hypothetical protein	NA	NA	NA	NA	NA
AVR24322.1|720752_721175_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	37.8	4.1e-14
AVR24323.1|721258_722495_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	5.8e-157
AVR24324.1|722713_724276_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.1	3.5e-143
AVR24325.1|724305_724653_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	71.0	1.2e-40
AVR24326.1|724652_725015_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AVR24327.1|725071_725851_+	FRG domain-containing protein	NA	NA	NA	NA	NA
AVR24328.1|726133_726829_-	DUF2290 domain-containing protein	NA	NA	NA	NA	NA
AVR24329.1|726821_728939_-	hypothetical protein	NA	NA	NA	NA	NA
AVR24330.1|729097_730822_-	hypothetical protein	NA	NA	NA	NA	NA
AVR24331.1|731191_733105_-	ATP-dependent helicase	NA	NA	NA	NA	NA
AVR24332.1|733101_735447_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AVR24333.1|735950_736184_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVR24334.1|737348_737999_+	hypothetical protein	NA	NA	NA	NA	NA
AVR24335.1|738779_739214_-	hypothetical protein	NA	NA	NA	NA	NA
AVR26900.1|739210_741217_-|integrase	integrase	integrase	NA	NA	NA	NA
AVR24336.1|741216_742761_-|integrase	integrase	integrase	NA	NA	NA	NA
751202:751219	attR	TCGTGCAGTTCCCAGCGC	NA	NA	NA	NA
>prophage 4
CP020392	Burkholderia thailandensis strain FDAARGOS_238 chromosome 1, complete sequence	3827809	1623382	1657552	3827809	plate,protease,transposase	Liberibacter_phage(25.0%)	30	NA	NA
AVR25099.1|1623382_1623901_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.5	1.1e-21
AVR25100.1|1624171_1625389_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	43.0	3.9e-89
AVR25101.1|1626004_1628881_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.6	6.6e-71
AVR25102.1|1628993_1629320_-	hypothetical protein	NA	NA	NA	NA	NA
AVR25103.1|1629329_1629677_-	hypothetical protein	NA	NA	NA	NA	NA
AVR25104.1|1629669_1629882_-	hypothetical protein	NA	NA	NA	NA	NA
AVR26982.1|1629874_1630177_-	hypothetical protein	NA	NA	NA	NA	NA
AVR25105.1|1630706_1631009_-	hypothetical protein	NA	NA	NA	NA	NA
AVR25106.1|1631005_1631215_-	AlpA family phage regulatory protein	NA	E5E3Y1	Burkholderia_phage	52.5	5.7e-09
AVR25107.1|1631338_1631872_-	DNA-binding protein	NA	NA	NA	NA	NA
AVR25108.1|1633527_1633944_-	hypothetical protein	NA	NA	NA	NA	NA
AVR25109.1|1634202_1634406_+	hypothetical protein	NA	NA	NA	NA	NA
AVR25110.1|1634682_1635291_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	42.1	3.7e-24
AVR26983.1|1635872_1637369_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	56.7	3.8e-147
AVR25111.1|1637365_1638877_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	57.2	1.9e-138
AVR25112.1|1638869_1640078_+	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	56.0	1.0e-44
AVR25113.1|1643081_1643504_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	37.8	4.1e-14
AVR25114.1|1643587_1644824_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	5.8e-157
AVR25115.1|1645042_1646605_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.1	3.5e-143
AVR25116.1|1646634_1646982_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	71.0	1.2e-40
AVR25117.1|1646981_1647344_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AVR25118.1|1648540_1649326_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AVR25119.1|1649322_1650669_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVR25120.1|1650777_1651392_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AVR25121.1|1651765_1652455_+	hypothetical protein	NA	NA	NA	NA	NA
AVR25122.1|1652491_1653010_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AVR25123.1|1653026_1654517_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AVR25124.1|1654589_1655093_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AVR25125.1|1655120_1655633_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AVR26984.1|1655725_1657552_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 5
CP020392	Burkholderia thailandensis strain FDAARGOS_238 chromosome 1, complete sequence	3827809	1988134	1997365	3827809		Hokovirus(16.67%)	7	NA	NA
AVR25400.1|1988134_1990087_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.3	6.6e-147
AVR25401.1|1990350_1991481_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.0	1.8e-24
AVR25402.1|1991512_1993522_+	chloride transporter	NA	S4VT78	Pandoravirus	34.7	8.2e-52
AVR25403.1|1993697_1994513_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	32.9	3.3e-36
AVR25404.1|1994577_1995261_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	3.3e-05
AVR25405.1|1995257_1995785_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AVR25406.1|1995820_1997365_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	2.5e-24
>prophage 6
CP020392	Burkholderia thailandensis strain FDAARGOS_238 chromosome 1, complete sequence	3827809	2359384	2368066	3827809		Bacillus_phage(16.67%)	8	NA	NA
AVR25715.1|2359384_2360785_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.7	1.4e-79
AVR25716.1|2360753_2361740_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.9	6.7e-15
AVR25717.1|2361797_2362790_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
AVR25718.1|2362861_2363179_+	competence protein ComE	NA	NA	NA	NA	NA
AVR27038.1|2363513_2364416_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	4.3e-53
AVR25719.1|2364510_2365881_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
AVR25720.1|2365930_2366854_+	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	36.2	3.2e-43
AVR27039.1|2367223_2368066_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	26.8	6.5e-19
>prophage 1
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	0	5203	2940845		Bacillus_virus(100.0%)	5	NA	NA
AVR29659.1|430_2116_-	MFS transporter	NA	NA	NA	NA	NA
AVR27192.1|2229_3111_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVR27193.1|3107_3299_-	hypothetical protein	NA	NA	NA	NA	NA
AVR27194.1|3295_4399_-	N-acylglucosamine 2-epimerase	NA	NA	NA	NA	NA
AVR27195.1|4507_5203_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	42.4	3.0e-17
>prophage 2
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	9519	12690	2940845		uncultured_virus(100.0%)	1	NA	NA
AVR27201.1|9519_12690_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.3	4.8e-107
>prophage 3
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	23289	27149	2940845		Megavirus(50.0%)	3	NA	NA
AVR27208.1|23289_24942_-	dehydrogenase	NA	K7YWQ8	Megavirus	38.7	1.8e-12
AVR27209.1|25109_26051_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVR27210.1|26279_27149_-	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	33.9	6.7e-27
>prophage 4
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	34192	34999	2940845		Staphylococcus_phage(100.0%)	1	NA	NA
AVR27218.1|34192_34999_+	2,5-didehydrogluconate reductase DkgB	NA	A0A2H4PQR8	Staphylococcus_phage	34.2	1.6e-38
>prophage 5
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	58794	60912	2940845		Pseudomonas_phage(100.0%)	1	NA	NA
AVR27238.1|58794_60912_+	acyltransferase	NA	B5WZU0	Pseudomonas_phage	30.0	4.6e-37
>prophage 6
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	64720	66022	2940845		Burkholderia_virus(100.0%)	1	NA	NA
AVR29407.1|64720_66022_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	42.1	4.6e-72
>prophage 7
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	70302	71847	2940845		Salmonella_phage(100.0%)	1	NA	NA
AVR27245.1|70302_71847_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	46.9	4.0e-38
>prophage 8
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	77949	79569	2940845		Streptococcus_phage(100.0%)	1	NA	NA
AVR27249.1|77949_79569_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.7	9.0e-17
>prophage 9
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	87323	92797	2940845		Acanthamoeba_polyphaga_mimivirus(50.0%)	3	NA	NA
AVR27257.1|87323_88274_+	alpha/beta hydrolase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	29.9	1.8e-20
AVR27258.1|88323_89550_+	MexE family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVR27259.1|89611_92797_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	25.3	3.1e-05
>prophage 10
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	102445	104314	2940845		Hepacivirus(100.0%)	1	NA	NA
AVR27268.1|102445_104314_-	fatty acid--CoA ligase	NA	Q75ZG1	Hepacivirus	25.7	5.1e-32
>prophage 11
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	174483	175581	2940845		Bacillus_virus(100.0%)	1	NA	NA
AVR27305.1|174483_175581_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	32.5	1.2e-25
>prophage 12
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	180120	180666	2940845		Tupanvirus(100.0%)	1	NA	NA
AVR27310.1|180120_180666_+	HD domain-containing protein	NA	A0A2K9L141	Tupanvirus	34.1	2.2e-20
>prophage 13
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	186640	190541	2940845	transposase	Stx2-converting_phage(50.0%)	4	NA	NA
AVR27311.1|186640_187063_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	37.8	4.1e-14
AVR27312.1|187146_188383_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	5.8e-157
AVR27313.1|188601_190164_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.1	3.5e-143
AVR27314.1|190193_190541_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	71.0	1.2e-40
>prophage 14
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	212365	216376	2940845		Caulobacter_phage(50.0%)	3	NA	NA
AVR27340.1|212365_212974_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.2	9.2e-23
AVR27341.1|213204_214104_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AVR27342.1|214393_216376_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	44.3	8.9e-83
>prophage 15
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	238613	240326	2940845		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVR27350.1|238613_240326_+	thiamine pyrophosphate-binding protein	NA	M4QSI1	Ostreococcus_lucimarinus_virus	31.7	5.5e-65
>prophage 16
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	250072	254288	2940845		Aeropyrum_coil-shaped_virus(33.33%)	3	NA	NA
AVR29417.1|250072_251146_+	CDP-glucose 4,6-dehydratase	NA	J7Q7J8	Aeropyrum_coil-shaped_virus	29.6	8.1e-14
AVR27357.1|251149_252502_+	lipopolysaccharide biosynthesis protein RfbH	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	36.1	1.0e-50
AVR27358.1|252527_254288_+	GNAT family N-acetyltransferase	NA	A0A2K9L470	Tupanvirus	37.0	4.2e-36
>prophage 17
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	267474	268809	2940845		Streptococcus_phage(100.0%)	1	NA	NA
AVR27369.1|267474_268809_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	21.2	4.8e-08
>prophage 18
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	272039	273884	2940845		Bodo_saltans_virus(100.0%)	1	NA	NA
AVR27372.1|272039_273884_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	21.8	1.1e-10
>prophage 19
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	279944	281753	2940845		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVR27380.1|279944_281753_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.1	2.2e-19
>prophage 20
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	287298	289430	2940845		Mycoplasma_phage(50.0%)	2	NA	NA
AVR27384.1|287298_288279_-	putrescine ABC transporter permease PotH	NA	Q6GZ02	Mycoplasma_phage	23.0	5.5e-09
AVR29423.1|288275_289430_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.2	8.4e-25
>prophage 21
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	299308	305159	2940845		uncultured_virus(66.67%)	4	NA	NA
AVR27395.1|299308_299599_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	51.1	2.1e-17
AVR27396.1|299611_301252_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	59.3	1.5e-168
AVR27397.1|301566_302013_-	hypothetical protein	NA	NA	NA	NA	NA
AVR27398.1|302627_305159_+	adenosylcobalamin-dependent ribonucleoside-diphosphate reductase	NA	M4QT32	Loktanella_phage	37.3	7.2e-138
>prophage 22
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	311957	315845	2940845		Tupanvirus(100.0%)	1	NA	NA
AVR27404.1|311957_315845_+	AMP-dependent synthetase	NA	A0A2K9KZV5	Tupanvirus	20.3	5.9e-06
>prophage 23
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	318991	322656	2940845		Orpheovirus(50.0%)	3	NA	NA
AVR27407.1|318991_320599_-	alkyl hydroperoxide reductase subunit F	NA	A0A2I2L5E1	Orpheovirus	32.8	5.0e-36
AVR27408.1|320739_321303_-	peroxiredoxin	NA	NA	NA	NA	NA
AVR27409.1|321558_322656_-	chitin-binding protein	NA	C3TWS8	Euproctis_pseudoconspersa_nucleopolyhedrovirus	32.1	1.8e-24
>prophage 24
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	347243	417816	2940845	plate,holin	Vibrio_phage(25.0%)	56	NA	NA
AVR27424.1|347243_348011_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
AVR27425.1|348049_349051_-	HpnL family protein	NA	NA	NA	NA	NA
AVR27426.1|349047_349821_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
AVR27427.1|349817_350513_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
AVR27428.1|350878_352393_+	succinate CoA transferase	NA	NA	NA	NA	NA
AVR27429.1|354014_354959_+	hypothetical protein	NA	NA	NA	NA	NA
AVR29428.1|354992_355544_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AVR27430.1|355540_357052_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AVR27431.1|357195_357723_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AVR27432.1|357801_358233_+	type VI secretion protein	NA	NA	NA	NA	NA
AVR27433.1|358246_360109_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVR27434.1|360105_361095_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVR27435.1|361097_363941_+	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.0	1.2e-61
AVR27436.1|363931_366223_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AVR27437.1|366391_368680_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AVR27438.1|368683_370900_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
AVR27439.1|370899_371970_+	hypothetical protein	NA	NA	NA	NA	NA
AVR27440.1|371972_372689_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
AVR27441.1|372728_373118_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
AVR27442.1|373123_373717_+	type VI secretion system-associated lipoprotein	NA	NA	NA	NA	NA
AVR27443.1|373713_375075_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVR27444.1|375100_376885_+	hypothetical protein	NA	NA	NA	NA	NA
AVR27445.1|376881_380382_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AVR27446.1|380440_380800_+	hypothetical protein	NA	NA	NA	NA	NA
AVR27447.1|380822_381254_+	hypothetical protein	NA	NA	NA	NA	NA
AVR27448.1|381474_381846_+	hypothetical protein	NA	NA	NA	NA	NA
AVR27449.1|382022_382139_-	hypothetical protein	NA	NA	NA	NA	NA
AVR27450.1|382418_383318_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVR27451.1|383597_384875_+	glycosyltransferase	NA	NA	NA	NA	NA
AVR27452.1|384871_386443_+	MFS transporter	NA	NA	NA	NA	NA
AVR27453.1|386575_387541_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AVR27454.1|387593_389156_+	RND transporter	NA	NA	NA	NA	NA
AVR29429.1|389350_390619_+	hemolysin secretion protein D	NA	NA	NA	NA	NA
AVR29430.1|390811_391015_-	hypothetical protein	NA	NA	NA	NA	NA
AVR27455.1|391070_392744_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.0	1.3e-55
AVR27456.1|392862_394434_-	glycoside hydrolase 68 family protein	NA	NA	NA	NA	NA
AVR27457.1|394620_395637_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AVR27458.1|395788_395986_+	hypothetical protein	NA	NA	NA	NA	NA
AVR27459.1|395982_397182_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	26.8	1.4e-11
AVR27460.1|397374_398400_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
AVR27461.1|398557_398797_+	hypothetical protein	NA	NA	NA	NA	NA
AVR27462.1|398808_400083_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	6.9e-105
AVR27463.1|400154_401126_+	membrane dipeptidase	NA	NA	NA	NA	NA
AVR27464.1|401273_401807_+	4-vinyl reductase	NA	NA	NA	NA	NA
AVR27465.1|401867_403931_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AVR27466.1|403933_405859_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
AVR27467.1|405863_407045_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
AVR27468.1|407041_407827_+	drug:proton antiporter	NA	NA	NA	NA	NA
AVR29431.1|407878_409120_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
AVR27469.1|409140_410280_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVR27470.1|410389_411253_+	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVR27471.1|411432_413088_+	APC family permease	NA	NA	NA	NA	NA
AVR27472.1|413174_414050_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
AVR27473.1|414193_415093_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVR27474.1|415228_416782_+|holin	choline-sulfatase	holin	NA	NA	NA	NA
AVR29432.1|416817_417816_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
>prophage 25
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	437504	438979	2940845		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
AVR27490.1|437504_438278_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.4	7.6e-14
AVR27491.1|438277_438979_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.0	8.1e-15
>prophage 26
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	446979	461528	2940845		Tupanvirus(50.0%)	5	NA	NA
AVR27499.1|446979_451371_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.5	6.2e-36
AVR27500.1|451367_456980_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.7	4.5e-39
AVR27501.1|456976_458032_+	oxidoreductase	NA	NA	NA	NA	NA
AVR27502.1|458028_459759_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.1	3.9e-18
AVR27503.1|459755_461528_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.8	2.7e-14
>prophage 27
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	471356	473518	2940845		Moraxella_phage(50.0%)	2	NA	NA
AVR27513.1|471356_472658_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.9	2.3e-63
AVR27514.1|472897_473518_+	TIGR02594 family protein	NA	A0A0X8WP96	Ralstonia_phage	30.7	6.9e-18
>prophage 28
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	492436	496657	2940845		Staphylococcus_phage(50.0%)	3	NA	NA
AVR27529.1|492436_494140_+	AMP-dependent synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	33.8	1.0e-55
AVR27530.1|494218_495748_+	methylmalonate-semialdehyde dehydrogenase (CoA acylating)	NA	NA	NA	NA	NA
AVR27531.1|495760_496657_+	3-hydroxyisobutyrate dehydrogenase	NA	A0A077SLF7	Escherichia_phage	36.5	5.5e-32
>prophage 29
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	502887	506054	2940845		Planktothrix_phage(50.0%)	2	NA	NA
AVR27536.1|502887_504849_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.2	2.0e-34
AVR27537.1|504851_506054_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	47.8	3.0e-17
>prophage 30
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	510433	522241	2940845		Burkholderia_virus(28.57%)	11	NA	NA
AVR27541.1|510433_510715_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	83.0	1.7e-35
AVR27542.1|510783_511506_-	LysR family transcriptional regulator	NA	A4PE26	Ralstonia_virus	45.8	2.0e-32
AVR27543.1|511512_512115_-	hypothetical protein	NA	NA	NA	NA	NA
AVR27544.1|512456_512966_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.4	1.5e-18
AVR27545.1|512962_513388_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	48.3	2.4e-14
AVR27546.1|513449_513731_-	hypothetical protein	NA	NA	NA	NA	NA
AVR29440.1|513730_514195_-	hypothetical protein	NA	C7BGE3	Burkholderia_phage	61.0	8.8e-50
AVR27547.1|517156_517867_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	32.7	1.1e-30
AVR27548.1|518214_519330_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AVR27549.1|519374_519701_+	hypothetical protein	NA	NA	NA	NA	NA
AVR29441.1|519673_522241_-	hypothetical protein	NA	A0A1V0SFX9	Hokovirus	22.8	1.1e-05
>prophage 31
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	539938	541318	2940845		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AVR27563.1|539938_541318_-	two-component sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	31.5	2.1e-06
>prophage 32
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	550460	550679	2940845		Bacillus_phage(100.0%)	1	NA	NA
AVR29446.1|550460_550679_+	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	50.8	1.2e-06
>prophage 33
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	558759	560730	2940845		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
AVR27580.1|558759_560730_+	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	27.8	2.0e-26
>prophage 34
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	570515	572567	2940845		Bacillus_phage(100.0%)	2	NA	NA
AVR27589.1|570515_571844_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.6	3.1e-15
AVR27590.1|571844_572567_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.3	2.6e-32
>prophage 35
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	583033	584101	2940845		Planktothrix_phage(100.0%)	1	NA	NA
AVR27601.1|583033_584101_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	1.4e-29
>prophage 36
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	587845	589360	2940845		Bacillus_phage(100.0%)	1	NA	NA
AVR27603.1|587845_589360_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.4	2.7e-15
>prophage 37
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	602214	604146	2940845		Synechococcus_phage(100.0%)	1	NA	NA
AVR27616.1|602214_604146_-	carbamoyltransferase	NA	E3SL71	Synechococcus_phage	29.0	1.5e-42
>prophage 38
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	609984	610278	2940845		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
AVR27623.1|609984_610278_+	oxidoreductase	NA	A0A0P0YLZ9	Yellowstone_lake_phycodnavirus	47.0	8.3e-14
>prophage 39
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	622190	623699	2940845		Streptococcus_phage(100.0%)	1	NA	NA
AVR27634.1|622190_623699_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.4	6.2e-12
>prophage 40
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	628369	633199	2940845		Staphylococcus_phage(50.0%)	4	NA	NA
AVR27640.1|628369_630031_+	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	3.3e-30
AVR27641.1|630093_630279_-	hypothetical protein	NA	NA	NA	NA	NA
AVR27642.1|630377_631091_+	hypothetical protein	NA	NA	NA	NA	NA
AVR27643.1|631117_633199_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.3	4.0e-09
>prophage 41
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	645762	674461	2940845		Paenibacillus_phage(50.0%)	2	NA	NA
AVR27651.1|645762_662856_+	KR domain-containing protein	NA	D0R7J2	Paenibacillus_phage	32.7	1.2e-29
AVR27652.1|662530_674461_+	KR domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	26.4	4.0e-77
>prophage 42
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	678781	701117	2940845		Paenibacillus_phage(100.0%)	2	NA	NA
AVR27658.1|678781_684481_+	KR domain-containing protein	NA	D0R7J2	Paenibacillus_phage	33.6	1.1e-27
AVR27659.1|684506_701117_+	KR domain-containing protein	NA	D0R7J2	Paenibacillus_phage	25.2	1.6e-20
>prophage 43
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	732372	732981	2940845		Bacillus_virus(100.0%)	1	NA	NA
AVR27669.1|732372_732981_+	hypothetical protein	NA	G3MBP9	Bacillus_virus	36.9	1.6e-06
>prophage 44
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	737717	739358	2940845		uncultured_virus(100.0%)	1	NA	NA
AVR27673.1|737717_739358_-	histidine-type phosphatase	NA	A0A218MNG5	uncultured_virus	46.5	1.1e-65
>prophage 45
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	766173	767751	2940845		Staphylococcus_phage(100.0%)	1	NA	NA
AVR27697.1|766173_767751_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	7.7e-13
>prophage 46
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	773249	775535	2940845		uncultured_virus(100.0%)	1	NA	NA
AVR27704.1|773249_775535_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	31.2	1.4e-71
>prophage 47
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	785736	787275	2940845		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVR27714.1|785736_787275_+	sugar ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.9	2.9e-09
>prophage 48
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	793154	793931	2940845		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AVR29465.1|793154_793931_+	short chain dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.0	1.6e-11
>prophage 49
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	833433	835575	2940845		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVR27756.1|833433_834273_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	34.6	5.3e-05
AVR27757.1|834525_835575_+	alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	22.9	4.1e-10
>prophage 50
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	866994	868344	2940845		Klosneuvirus(100.0%)	1	NA	NA
AVR27786.1|866994_868344_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.6	1.5e-20
>prophage 51
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	887194	894695	2940845		Staphylococcus_phage(33.33%)	9	NA	NA
AVR27805.1|887194_887848_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.6	1.9e-42
AVR27806.1|887810_888623_-	hydroxymethylglutaryl-coenzyme A reductase	NA	NA	NA	NA	NA
AVR27807.1|888711_889323_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVR27808.1|889540_889984_-	DUF4902 domain-containing protein	NA	NA	NA	NA	NA
AVR27809.1|890057_890777_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AVR27810.1|890805_891522_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	42.6	2.0e-13
AVR27811.1|892088_893294_-	metallophosphoesterase	NA	NA	NA	NA	NA
AVR27812.1|893353_893938_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
AVR27813.1|894068_894695_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L4C1	Tupanvirus	33.0	3.8e-24
>prophage 52
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	902349	903147	2940845		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AVR27823.1|902349_903147_+	short chain dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.5	7.1e-07
>prophage 53
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	934671	935238	2940845		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVR27847.1|934671_935238_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	40.4	1.5e-22
>prophage 54
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	938512	940069	2940845		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVR27850.1|938512_940069_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.7	6.6e-17
>prophage 55
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	954582	960825	2940845		Planktothrix_phage(50.0%)	8	NA	NA
AVR27861.1|954582_955554_+	M23 family peptidase	NA	A0A292GJG6	Xanthomonas_phage	44.8	1.9e-14
AVR27862.1|955766_956651_+	PenI family class A extended-spectrum beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	55.9	8.0e-76
AVR27863.1|956697_956877_+	hypothetical protein	NA	NA	NA	NA	NA
AVR27864.1|957151_958024_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVR27865.1|958164_958500_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AVR27866.1|958786_959059_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVR27867.1|959179_959968_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.8	7.0e-23
AVR27868.1|959943_960825_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.9	7.1e-08
>prophage 56
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	968353	970339	2940845		Ralstonia_phage(100.0%)	1	NA	NA
AVR27873.1|968353_970339_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	3.2e-64
>prophage 57
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	993791	998926	2940845		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
AVR27889.1|993791_996581_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	23.4	4.2e-38
AVR29483.1|997315_998926_-	peptidase	NA	A0A1B0T6A2	Bacillus_phage	34.3	1.3e-31
>prophage 58
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1008641	1009409	2940845		Bacillus_phage(100.0%)	1	NA	NA
AVR27899.1|1008641_1009409_+	histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP	NA	W8CYL7	Bacillus_phage	31.4	5.4e-12
>prophage 59
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1014616	1028759	2940845	tRNA,transposase	Pseudomonas_phage(20.0%)	9	NA	NA
AVR27905.1|1014616_1015761_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	63.3	1.0e-99
AVR27906.1|1016300_1017014_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AVR27907.1|1017473_1018085_+	N-acylhomoserine lactone synthase	NA	NA	NA	NA	NA
AVR27908.1|1018169_1021373_+	hypothetical protein	NA	A0A2K9L3I8	Tupanvirus	29.2	1.8e-64
AVR27909.1|1021365_1022805_+	amidase	NA	NA	NA	NA	NA
AVR27910.1|1022913_1024119_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	24.2	3.9e-17
AVR27911.1|1024157_1025993_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AVR27912.1|1026279_1027488_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	31.7	9.0e-30
AVR27913.1|1027544_1028759_+	2-epi-5-epi-valiolone synthase	NA	A9YVT7	Ostreococcus_tauri_virus	27.9	6.5e-20
>prophage 60
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1035737	1042121	2940845	transposase	Stx2-converting_phage(40.0%)	6	NA	NA
AVR29485.1|1035737_1037006_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.3	1.3e-39
AVR27919.1|1037606_1038843_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	5.8e-157
AVR27920.1|1039183_1039546_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AVR27921.1|1039545_1039893_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	71.0	1.2e-40
AVR27922.1|1039922_1041485_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.1	3.5e-143
AVR27923.1|1041524_1042121_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	39.7	1.1e-28
>prophage 61
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1051315	1052200	2940845		Prochlorococcus_phage(100.0%)	1	NA	NA
AVR27930.1|1051315_1052200_-	FkbM family methyltransferase	NA	Q58M88	Prochlorococcus_phage	26.8	6.7e-06
>prophage 62
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1062872	1158939	2940845	plate,head,terminase,capsid,holin,protease,portal,tail	Burkholderia_virus(55.36%)	107	NA	NA
AVR27940.1|1062872_1063745_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVR27941.1|1064147_1064852_-	FAA hydrolase family protein	NA	NA	NA	NA	NA
AVR27942.1|1065015_1066035_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVR29486.1|1066594_1066750_+	hypothetical protein	NA	NA	NA	NA	NA
AVR27943.1|1066765_1067287_+	RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
AVR27944.1|1067283_1068096_+	anti-sigma factor	NA	NA	NA	NA	NA
AVR27945.1|1068139_1068955_+	YceI family protein	NA	NA	NA	NA	NA
AVR27946.1|1068994_1069354_+	hypothetical protein	NA	NA	NA	NA	NA
AVR27947.1|1069543_1070053_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AVR27948.1|1070049_1071054_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
AVR29487.1|1071730_1073770_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AVR27949.1|1074049_1074376_-	hypothetical protein	NA	NA	NA	NA	NA
AVR27950.1|1074378_1075071_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
AVR27951.1|1075193_1076453_-	monooxygenase	NA	NA	NA	NA	NA
AVR27952.1|1076665_1076920_-	hypothetical protein	NA	NA	NA	NA	NA
AVR27953.1|1076929_1077178_-	hypothetical protein	NA	NA	NA	NA	NA
AVR27954.1|1077255_1077549_-	hypothetical protein	NA	NA	NA	NA	NA
AVR27955.1|1077879_1078152_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
AVR27956.1|1078243_1079638_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.0	8.9e-21
AVR27957.1|1079634_1080324_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.8	6.3e-36
AVR27958.1|1080330_1083564_-	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
AVR27959.1|1083629_1085084_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVR27960.1|1085094_1086471_-	TolC family protein	NA	NA	NA	NA	NA
AVR27961.1|1086725_1087007_-	hypothetical protein	NA	NA	NA	NA	NA
AVR27962.1|1087367_1087508_-	hypothetical protein	NA	Q8W6Q2	Burkholderia_virus	58.7	9.8e-05
AVR27963.1|1087959_1088448_-	hypothetical protein	NA	NA	NA	NA	NA
AVR27964.1|1088704_1088863_+	cystathionine beta-synthase	NA	NA	NA	NA	NA
AVR27965.1|1089093_1089579_+	deacylase	NA	NA	NA	NA	NA
AVR27966.1|1089721_1090051_-	helix-turn-helix domain-containing protein	NA	A4JWW9	Burkholderia_virus	70.5	1.0e-36
AVR27967.1|1090287_1090440_+	hypothetical protein	NA	R4JMC2	Burkholderia_phage	76.0	2.5e-14
AVR27968.1|1090427_1091297_+	DUF550 domain-containing protein	NA	R4JG80	Burkholderia_phage	70.0	2.4e-101
AVR27969.1|1091287_1091617_-	hypothetical protein	NA	NA	NA	NA	NA
AVR27970.1|1091823_1092009_+	hypothetical protein	NA	A4JWW7	Burkholderia_virus	75.4	4.0e-14
AVR27971.1|1092005_1092227_+	hypothetical protein	NA	A4JWW6	Burkholderia_virus	91.8	2.4e-34
AVR27972.1|1092230_1092446_+	hypothetical protein	NA	A4JWW5	Burkholderia_virus	90.1	6.9e-26
AVR29489.1|1092454_1092592_+	hypothetical protein	NA	A4JWW4	Burkholderia_virus	86.7	2.2e-17
AVR27973.1|1092664_1093702_+	hypothetical protein	NA	Q8W6P3	Burkholderia_virus	75.2	8.3e-141
AVR29488.1|1093518_1095126_+	DNA cytosine methyltransferase	NA	Q6V7R9	Burkholderia_virus	38.5	1.1e-67
AVR27974.1|1095125_1096919_+	replication endonuclease	NA	A4JWW0	Burkholderia_virus	88.1	0.0e+00
AVR27975.1|1096934_1097201_+	hypothetical protein	NA	A4JWV9	Burkholderia_virus	91.8	3.6e-40
AVR27976.1|1097197_1097404_+	transcriptional regulator	NA	A4JWV8	Burkholderia_virus	97.1	2.8e-32
AVR27977.1|1097490_1098150_+	chromosome partitioning protein ParA	NA	A4JWV7	Burkholderia_virus	97.2	2.6e-111
AVR29490.1|1098332_1098500_+	ribbon-helix-helix protein, CopG family	NA	A4JWV6	Burkholderia_virus	88.7	4.3e-15
AVR27978.1|1098605_1099139_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	93.2	9.0e-91
AVR27979.1|1099135_1099873_+	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	94.3	4.1e-126
AVR27980.1|1099881_1101003_+	DUF3396 domain-containing protein	NA	A4JWV3	Burkholderia_virus	86.9	1.3e-192
AVR27981.1|1101555_1102611_-|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	96.6	2.1e-200
AVR27982.1|1102607_1104377_-|terminase	terminase	terminase	A4JWQ1	Burkholderia_virus	97.8	0.0e+00
AVR27983.1|1104520_1105330_+|capsid	capsid scaffolding protein	capsid	K4PAW2	Burkholderia_phage	95.5	1.4e-140
AVR27984.1|1105363_1106374_+|capsid	phage major capsid protein, P2 family	capsid	A4JWP9	Burkholderia_virus	91.1	2.3e-172
AVR27985.1|1106370_1107060_+|terminase	terminase	terminase	K4NX86	Burkholderia_phage	96.9	2.9e-113
AVR27986.1|1107159_1107639_+|head	phage head protein	head	A4JWU5	Burkholderia_virus	96.9	6.0e-78
AVR27987.1|1107638_1107890_+	hypothetical protein	NA	K4NXI9	Burkholderia_phage	80.7	1.4e-30
AVR27988.1|1107886_1108093_+|tail	phage tail protein	tail	K4PAW7	Burkholderia_phage	98.5	1.5e-30
AVR27989.1|1108107_1108452_+	hypothetical protein	NA	K4NZQ3	Burkholderia_phage	99.1	5.0e-50
AVR27990.1|1108453_1108726_+|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	100.0	8.8e-42
AVR27991.1|1108722_1109535_+	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	98.9	3.8e-149
AVR27992.1|1109531_1109972_+	protein LYSB	NA	K4NXJ2	Burkholderia_phage	91.8	7.7e-64
AVR27993.1|1109940_1110084_+	peptidase	NA	K4PAX1	Burkholderia_phage	93.6	3.9e-17
AVR27994.1|1110076_1110493_+|tail	bacteriophage tail completion protein R	tail	A4JWT7	Burkholderia_virus	100.0	3.3e-72
AVR27995.1|1110489_1110957_+	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	94.2	6.7e-74
AVR27996.1|1111083_1111614_+	hypothetical protein	NA	K4NX96	Burkholderia_phage	98.2	1.3e-92
AVR29491.1|1111779_1112556_-	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	96.5	1.6e-144
AVR27997.1|1112729_1113410_+|plate	phage baseplate assembly protein V	plate	A4JWT3	Burkholderia_virus	96.5	4.5e-119
AVR27998.1|1113406_1113769_+|plate	baseplate assembly protein	plate	A4JWY3	Burkholderia_virus	94.0	8.3e-56
AVR27999.1|1113765_1114671_+|plate	baseplate assembly protein	plate	K4NZR5	Burkholderia_phage	95.3	2.3e-155
AVR28000.1|1114663_1115218_+|tail	phage tail protein I	tail	A4JWT0	Burkholderia_virus	96.2	7.4e-96
AVR28001.1|1115219_1117592_+|tail	phage tail protein	tail	Q45YG3	Burkholderia_virus	91.1	0.0e+00
AVR28002.1|1117608_1118250_+|tail	tail assembly chaperone	tail	A4JWS8	Burkholderia_virus	87.4	1.5e-108
AVR28003.1|1118306_1119479_+|tail	phage tail protein	tail	A4JWS7	Burkholderia_virus	98.7	1.1e-221
AVR28004.1|1119494_1120004_+|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	97.6	9.2e-93
AVR28005.1|1120061_1120406_+|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	95.6	2.4e-52
AVR28006.1|1120414_1120528_+|tail	GpE family phage tail protein	tail	A4JWX5	Burkholderia_virus	100.0	1.9e-14
AVR28007.1|1120524_1123359_+	hypothetical protein	NA	Q45YG8	Burkholderia_virus	70.6	0.0e+00
AVR28008.1|1123376_1123802_+	oxidoreductase	NA	A4JWS2	Burkholderia_virus	97.9	3.7e-71
AVR28009.1|1123801_1124902_+	late control protein	NA	K4PAY4	Burkholderia_phage	96.2	2.8e-195
AVR28010.1|1125862_1126192_-	H-NS histone family protein	NA	NA	NA	NA	NA
AVR28011.1|1126205_1126721_-	prop effector	NA	NA	NA	NA	NA
AVR28012.1|1127097_1127304_+	hypothetical protein	NA	NA	NA	NA	NA
AVR28013.1|1127307_1128072_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
AVR28014.1|1128399_1128975_+	DUF2760 domain-containing protein	NA	NA	NA	NA	NA
AVR28015.1|1128971_1130819_+	Hsp70 family protein	NA	NA	NA	NA	NA
AVR28016.1|1130822_1133618_+	molecular chaperone DnaK	NA	A0A2H4UU19	Bodo_saltans_virus	25.8	3.8e-07
AVR29492.1|1133733_1134867_-	CapA family protein	NA	S4VS02	Pandoravirus	55.6	9.5e-114
AVR28017.1|1134973_1135408_-	GYD domain-containing protein	NA	NA	NA	NA	NA
AVR28018.1|1135404_1136109_-	hypothetical protein	NA	NA	NA	NA	NA
AVR28019.1|1136239_1136500_-	hypothetical protein	NA	NA	NA	NA	NA
AVR28020.1|1136557_1137991_-	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	45.2	6.0e-105
AVR28021.1|1138004_1138424_-	archease	NA	NA	NA	NA	NA
AVR28022.1|1138575_1139946_+	DUF3326 domain-containing protein	NA	NA	NA	NA	NA
AVR29493.1|1140186_1142601_+	divalent cation transporter	NA	NA	NA	NA	NA
AVR28023.1|1142773_1143397_-	hypothetical protein	NA	NA	NA	NA	NA
AVR28024.1|1143448_1145962_-	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	29.4	4.3e-58
AVR28025.1|1146020_1146500_-	hypothetical protein	NA	NA	NA	NA	NA
AVR28026.1|1146828_1147053_+	hypothetical protein	NA	NA	NA	NA	NA
AVR28027.1|1147375_1148185_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVR29494.1|1148265_1149696_-	thiamine pyridinylase	NA	NA	NA	NA	NA
AVR28028.1|1149773_1150574_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AVR28029.1|1150614_1150881_+	hypothetical protein	NA	NA	NA	NA	NA
AVR28030.1|1150817_1151558_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVR28031.1|1151573_1152563_-	thymidylate synthase	NA	NA	NA	NA	NA
AVR28032.1|1152564_1153020_-	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
AVR28033.1|1153016_1153508_-	NUDIX domain-containing protein	NA	A0A0E3JJF3	Streptomyces_phage	42.9	2.8e-14
AVR28034.1|1153873_1154062_-	hypothetical protein	NA	NA	NA	NA	NA
AVR28035.1|1154509_1156000_+	arginine-ornithine antiporter	NA	NA	NA	NA	NA
AVR28036.1|1156238_1156844_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AVR28037.1|1156950_1158939_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	45.1	1.4e-104
>prophage 63
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1162882	1164843	2940845		Staphylococcus_phage(50.0%)	2	NA	NA
AVR29496.1|1162882_1163815_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.5	1.5e-16
AVR28041.1|1163895_1164843_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.6	9.9e-24
>prophage 64
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1170086	1180536	2940845		Leptospira_phage(25.0%)	7	NA	NA
AVR28047.1|1170086_1173197_+	multidrug efflux protein	NA	S5VTK5	Leptospira_phage	21.5	2.8e-43
AVR29497.1|1173319_1174855_+	multidrug transporter	NA	NA	NA	NA	NA
AVR28048.1|1175213_1175858_+	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.0	9.4e-34
AVR28049.1|1175854_1177552_+	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
AVR28050.1|1177548_1178259_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVR28051.1|1178255_1179239_+	serine/threonine protein kinase	NA	A0A7H6	Microcystis_virus	28.6	8.2e-13
AVR28052.1|1179357_1180536_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	46.7	1.9e-24
>prophage 65
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1205244	1213531	2940845		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
AVR29502.1|1205244_1210023_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	39.9	1.2e-24
AVR28073.1|1210045_1211311_-	hypothetical protein	NA	NA	NA	NA	NA
AVR28074.1|1211326_1213531_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.0	2.4e-44
>prophage 66
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1220785	1222315	2940845		Escherichia_phage(100.0%)	1	NA	NA
AVR28084.1|1220785_1222315_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	45.2	4.1e-19
>prophage 67
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1242054	1249530	2940845		Tupanvirus(50.0%)	2	NA	NA
AVR28095.1|1242054_1245489_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	22.0	1.5e-48
AVR28096.1|1245528_1249530_-	KR domain-containing protein	NA	D0R7J2	Paenibacillus_phage	39.5	8.1e-51
>prophage 68
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1254113	1260940	2940845		Tupanvirus(50.0%)	2	NA	NA
AVR28098.1|1254113_1258664_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.2	1.4e-70
AVR28099.1|1258858_1260940_+	M3 family peptidase	NA	A0A1V0SD92	Indivirus	23.3	2.7e-29
>prophage 69
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1266265	1267762	2940845		Tupanvirus(100.0%)	1	NA	NA
AVR28105.1|1266265_1267762_+	amino acid adenylation protein	NA	A0A2K9KZV5	Tupanvirus	30.2	8.8e-51
>prophage 70
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1278522	1283241	2940845		Tupanvirus(100.0%)	1	NA	NA
AVR29506.1|1278522_1283241_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	20.5	5.2e-49
>prophage 71
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1288322	1297460	2940845		Tupanvirus(100.0%)	1	NA	NA
AVR28117.1|1288322_1297460_-	peptide synthase	NA	A0A2K9KZV5	Tupanvirus	24.6	3.1e-37
>prophage 72
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1302235	1303531	2940845		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVR28125.1|1302235_1303531_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	36.6	4.3e-46
>prophage 73
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1306966	1311976	2940845		Synechococcus_phage(50.0%)	4	NA	NA
AVR28128.1|1306966_1307650_+	Fe2+-dependent dioxygenase	NA	Q5GQB0	Synechococcus_phage	32.1	7.6e-18
AVR28129.1|1307843_1308419_-	cysteine hydrolase	NA	NA	NA	NA	NA
AVR28130.1|1308877_1309477_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
AVR28131.1|1310422_1311976_+	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	74.4	4.8e-07
>prophage 74
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1328555	1331675	2940845		Leptospira_phage(100.0%)	1	NA	NA
AVR28147.1|1328555_1331675_+	AcrB/AcrD/AcrF family protein	NA	S5VTK5	Leptospira_phage	23.1	5.5e-55
>prophage 75
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1341915	1343163	2940845		Planktothrix_phage(100.0%)	1	NA	NA
AVR28157.1|1341915_1343163_+	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	5.0e-23
>prophage 76
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1346270	1347272	2940845		Stx2-converting_phage(100.0%)	1	NA	NA
AVR28159.1|1346270_1347272_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	38.7	4.8e-37
>prophage 77
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1365474	1366497	2940845		Tupanvirus(100.0%)	1	NA	NA
AVR28171.1|1365474_1366497_-	histone deacetylase family protein	NA	A0A2K9L473	Tupanvirus	36.8	2.7e-27
>prophage 78
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1384361	1384952	2940845		Streptococcus_phage(100.0%)	1	NA	NA
AVR28187.1|1384361_1384952_+	DUF1949 domain-containing protein	NA	A0A1X9I5T8	Streptococcus_phage	35.6	4.0e-23
>prophage 79
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1394062	1396186	2940845		Bacillus_phage(100.0%)	1	NA	NA
AVR28195.1|1394062_1396186_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	24.9	6.7e-28
>prophage 80
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1412358	1416055	2940845		Bacillus_phage(66.67%)	3	NA	NA
AVR28206.1|1412358_1413477_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	47.3	1.2e-81
AVR28207.1|1413650_1414319_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	50.8	6.1e-28
AVR28208.1|1414585_1416055_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.5	2.4e-16
>prophage 81
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1426567	1432936	2940845		Planktothrix_phage(50.0%)	4	NA	NA
AVR28217.1|1426567_1428565_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.9	3.0e-22
AVR29517.1|1428605_1429634_-	isoaspartyl peptidase/L-asparaginase	NA	NA	NA	NA	NA
AVR28218.1|1429630_1430566_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AVR28219.1|1430905_1432936_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.0	5.1e-25
>prophage 82
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1440727	1442146	2940845		Tetraselmis_virus(100.0%)	1	NA	NA
AVR28227.1|1440727_1442146_+	NYN domain-containing protein	NA	A0A2P0VNQ4	Tetraselmis_virus	32.1	3.1e-05
>prophage 83
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1470744	1472442	2940845	holin	Catovirus(100.0%)	1	NA	NA
AVR28252.1|1470744_1472442_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	29.2	2.9e-50
>prophage 84
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1480547	1482698	2940845		Hokovirus(100.0%)	1	NA	NA
AVR28257.1|1480547_1482698_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	29.0	1.6e-16
>prophage 85
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1485961	1486165	2940845		Lake_Baikal_phage(100.0%)	1	NA	NA
AVR28265.1|1485961_1486165_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	65.7	4.5e-19
>prophage 86
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1503969	1504977	2940845		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVR28281.1|1503969_1504977_+	hydroxyacid dehydrogenase	NA	M1HFV8	Paramecium_bursaria_Chlorella_virus	29.9	2.7e-11
>prophage 87
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1509833	1512728	2940845		Escherichia_phage(100.0%)	3	NA	NA
AVR28286.1|1509833_1510724_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	57.8	3.8e-78
AVR28287.1|1510746_1512090_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	47.0	9.6e-89
AVR28288.1|1512086_1512728_+	aldolase	NA	A0A077SK32	Escherichia_phage	48.1	3.3e-39
>prophage 88
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1516376	1517069	2940845		Pandoravirus(100.0%)	1	NA	NA
AVR28292.1|1516376_1517069_+	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	S4VR59	Pandoravirus	35.7	2.8e-20
>prophage 89
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1521606	1522776	2940845		Bacillus_virus(100.0%)	1	NA	NA
AVR28297.1|1521606_1522776_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	1.5e-26
>prophage 90
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1539079	1540876	2940845		uncultured_phage(100.0%)	1	NA	NA
AVR28307.1|1539079_1540876_+	tetratricopeptide repeat protein	NA	D6PFH9	uncultured_phage	26.6	4.8e-11
>prophage 91
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1548798	1550406	2940845		Pike_perch_iridovirus(100.0%)	1	NA	NA
AVR28313.1|1548798_1550406_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	53.4	3.9e-20
>prophage 92
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1583220	1589130	2940845		Staphylococcus_phage(50.0%)	4	NA	NA
AVR28333.1|1583220_1584987_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	51.4	7.5e-134
AVR28334.1|1585176_1585302_-	acetyl-CoA synthetase	NA	NA	NA	NA	NA
AVR29526.1|1585543_1586803_+	GTP-binding protein	NA	NA	NA	NA	NA
AVR28335.1|1586757_1589130_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	28.2	4.0e-05
>prophage 93
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1595973	1597608	2940845		uncultured_virus(100.0%)	1	NA	NA
AVR28343.1|1595973_1597608_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	47.8	1.5e-128
>prophage 94
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1607680	1611452	2940845		Hokovirus(50.0%)	2	NA	NA
AVR28350.1|1607680_1610224_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	31.1	2.8e-12
AVR28351.1|1610450_1611452_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.9	1.9e-17
>prophage 95
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1631379	1632234	2940845		Bacillus_virus(100.0%)	1	NA	NA
AVR28368.1|1631379_1632234_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	46.5	2.8e-57
>prophage 96
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1641258	1642284	2940845		Rhizobium_phage(100.0%)	1	NA	NA
AVR28379.1|1641258_1642284_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	27.2	8.3e-08
>prophage 97
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1656768	1662718	2940845		Cronobacter_phage(50.0%)	2	NA	NA
AVR28388.1|1656768_1659654_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.8	9.5e-86
AVR28389.1|1659679_1662718_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.2	2.5e-20
>prophage 98
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1682835	1683399	2940845		Ralstonia_phage(100.0%)	1	NA	NA
AVR28401.1|1682835_1683399_-	lytic transglycosylase	NA	A0A0K2QQJ4	Ralstonia_phage	43.9	1.2e-16
>prophage 99
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1714900	1716220	2940845		Burkholderia_virus(100.0%)	1	NA	NA
AVR28433.1|1714900_1716220_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.9	1.1e-47
>prophage 100
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1721029	1722619	2940845		Klosneuvirus(100.0%)	1	NA	NA
AVR28437.1|1721029_1722619_-	peptidase S53	NA	A0A1V0SLL0	Klosneuvirus	41.8	5.8e-85
>prophage 101
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1732408	1733191	2940845		Bacillus_virus(100.0%)	1	NA	NA
AVR29542.1|1732408_1733191_-	taurine import ATP-binding protein TauB	NA	G3M9Y6	Bacillus_virus	41.5	3.9e-34
>prophage 102
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1742279	1745606	2940845		Tupanvirus(100.0%)	1	NA	NA
AVR28451.1|1742279_1745606_+	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L0Z8	Tupanvirus	30.1	3.5e-23
>prophage 103
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1775212	1777030	2940845		Enterobacteria_phage(100.0%)	1	NA	NA
AVR28469.1|1775212_1777030_-	EscC/YscC/HrcC family type III secretion system outer membrane ring protein	NA	G4WZN6	Enterobacteria_phage	26.0	1.4e-05
>prophage 104
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1822070	1823072	2940845		Wolbachia_phage(100.0%)	1	NA	NA
AVR28516.1|1822070_1823072_-	patatin	NA	A0A1B2LRS3	Wolbachia_phage	27.7	1.3e-10
>prophage 105
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1840058	1844551	2940845	integrase	Gordonia_phage(33.33%)	4	1829830:1829846	1850460:1850476
1829830:1829846	attL	GATGATCCGCACGGGCG	NA	NA	NA	NA
AVR28524.1|1840058_1841243_+	acyltransferase	NA	A0A166XZF2	Gordonia_phage	30.3	5.2e-14
AVR28525.1|1841801_1841984_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	60.3	2.2e-12
AVR28526.1|1842014_1842131_-|integrase	integrase	integrase	NA	NA	NA	NA
AVR29554.1|1842625_1844551_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	31.5	4.8e-17
1850460:1850476	attR	CGCCCGTGCGGATCATC	NA	NA	NA	NA
>prophage 106
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1859461	1861876	2940845		Pseudomonas_phage(50.0%)	2	NA	NA
AVR28540.1|1859461_1860589_+	acyltransferase	NA	B5WZU0	Pseudomonas_phage	28.5	1.4e-08
AVR28541.1|1860988_1861876_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	45.6	4.1e-64
>prophage 107
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1871106	1877632	2940845		Gordonia_phage(25.0%)	6	NA	NA
AVR28546.1|1871106_1872165_+	acyltransferase	NA	A0A166XZF2	Gordonia_phage	31.9	2.8e-19
AVR28547.1|1872200_1873244_+	GDP-mannose 4,6-dehydratase	NA	M1HKY0	Acanthocystis_turfacea_Chlorella_virus	55.8	9.6e-105
AVR28548.1|1873230_1874199_+	epimerase	NA	NA	NA	NA	NA
AVR28549.1|1874183_1874564_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AVR28550.1|1874656_1875847_-	O-succinylhomoserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	27.7	1.1e-16
AVR28551.1|1876096_1877632_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.5	1.9e-88
>prophage 108
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1882266	1883124	2940845		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
AVR28555.1|1882266_1883124_-	site-specific DNA-methyltransferase	NA	R4THJ7	Phaeocystis_globosa_virus	34.2	4.7e-33
>prophage 109
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1927994	1929107	2940845		Bacillus_virus(100.0%)	1	NA	NA
AVR28592.1|1927994_1929107_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	8.1e-25
>prophage 110
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1940048	1985709	2940845	tRNA,plate,integrase,tail	Burkholderia_phage(40.54%)	53	1944040:1944059	1973622:1973641
AVR28599.1|1940048_1941464_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	30.5	1.6e-41
AVR29569.1|1941452_1941596_+	6-phosphogluconate dehydrogenase	NA	NA	NA	NA	NA
AVR28600.1|1941675_1941894_-	hypothetical protein	NA	NA	NA	NA	NA
AVR28601.1|1941918_1942533_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
AVR28602.1|1942558_1943476_-	NAD-dependent protein deacetylase	NA	S5M4R0	Bacillus_phage	26.1	2.0e-13
AVR28603.1|1943472_1944897_-	cytosine permease	NA	NA	NA	NA	NA
1944040:1944059	attL	CGCGGCCGTCGCGCCGCTCG	NA	NA	NA	NA
AVR28604.1|1945429_1946407_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVR28605.1|1946423_1947641_+	acyltransferase	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	26.5	5.5e-27
AVR28606.1|1947945_1948647_-|tail	tail assembly chaperone	tail	E5E3Q6	Burkholderia_phage	59.7	1.1e-59
AVR28607.1|1948662_1950630_-|tail	phage tail protein	tail	Q45YG3	Burkholderia_virus	59.0	3.0e-131
AVR28608.1|1950629_1951211_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	86.5	1.5e-91
AVR28609.1|1951203_1952355_-|plate	baseplate protein	plate	A4JWL6	Burkholderia_virus	79.9	2.3e-168
AVR28610.1|1952351_1952705_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	82.9	4.2e-52
AVR28611.1|1952999_1953443_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVR28612.1|1953439_1954522_-	hypothetical protein	NA	A4JWL8	Burkholderia_virus	46.2	1.2e-70
AVR28613.1|1954537_1954981_+	hypothetical protein	NA	NA	NA	NA	NA
AVR28614.1|1954994_1955597_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	69.0	4.3e-65
AVR28615.1|1955593_1956799_-	phage protein D	NA	A4JWL3	Burkholderia_virus	70.6	2.5e-136
AVR28616.1|1956786_1956993_-	hypothetical protein	NA	A4JWL2	Burkholderia_virus	78.3	1.5e-25
AVR28617.1|1956992_1957895_-	hypothetical protein	NA	Q6QIA4	Burkholderia_phage	72.1	3.5e-71
AVR29570.1|1957896_1959990_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	50.2	2.6e-157
AVR29571.1|1960735_1961065_-|tail	phage tail assembly protein	tail	Q6QIA8	Burkholderia_phage	65.7	1.8e-25
AVR28618.1|1961377_1961902_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	90.8	1.0e-86
AVR28619.1|1961903_1963337_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	87.2	4.7e-243
AVR28620.1|1963340_1963586_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	62.5	1.7e-20
AVR28621.1|1963582_1964047_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	60.1	3.9e-42
AVR28622.1|1964046_1964466_-	hypothetical protein	NA	NA	NA	NA	NA
AVR28623.1|1964864_1965197_-	hypothetical protein	NA	Q6QIC3	Burkholderia_phage	77.8	1.9e-46
AVR28624.1|1965193_1965532_-	hypothetical protein	NA	A4JWP6	Burkholderia_virus	82.7	4.0e-44
AVR28625.1|1965566_1965827_-	hypothetical protein	NA	Q6QIC5	Burkholderia_phage	52.3	5.0e-10
AVR28626.1|1965825_1966167_+	hypothetical protein	NA	NA	NA	NA	NA
AVR29572.1|1966127_1966736_-	lytic transglycosylase domain-containing protein	NA	Q6QIC7	Burkholderia_phage	79.8	3.9e-90
AVR28627.1|1966738_1967086_-	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	79.1	1.2e-43
AVR28628.1|1967790_1968366_+	hypothetical protein	NA	NA	NA	NA	NA
AVR29573.1|1968520_1968940_-	XRE family transcriptional regulator	NA	A4JWR8	Burkholderia_virus	51.4	6.7e-25
AVR28629.1|1969070_1969313_+	DNA-binding protein	NA	Q6QID3	Burkholderia_phage	90.0	7.3e-32
AVR28630.1|1969472_1969721_-	hypothetical protein	NA	NA	NA	NA	NA
AVR28631.1|1969834_1970146_+	transcriptional regulator	NA	A4JWN4	Burkholderia_virus	80.0	1.7e-33
AVR28632.1|1970159_1971125_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	70.3	1.4e-102
AVR29574.1|1971139_1972936_+|integrase	integrase	integrase	Q6QIE0	Burkholderia_phage	80.2	4.3e-278
AVR28633.1|1972932_1974186_+	hypothetical protein	NA	Q6QIE1	Burkholderia_phage	69.1	5.5e-155
1973622:1973641	attR	CGCGGCCGTCGCGCCGCTCG	NA	NA	NA	NA
AVR28634.1|1974217_1974550_+	hypothetical protein	NA	Q6QIE2	Burkholderia_phage	58.2	2.5e-22
AVR28635.1|1974646_1975261_+	DUF3164 domain-containing protein	NA	A4JWM8	Burkholderia_virus	83.4	2.2e-93
AVR28636.1|1975351_1975708_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	76.8	1.1e-44
AVR28637.1|1977011_1977302_+	hypothetical protein	NA	NA	NA	NA	NA
AVR28638.1|1977395_1977581_+	hypothetical protein	NA	NA	NA	NA	NA
AVR28639.1|1977949_1979992_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.0	4.2e-35
AVR28640.1|1980050_1980389_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AVR28641.1|1980435_1982313_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.2	4.9e-67
AVR28642.1|1982409_1982856_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	3.3e-22
AVR28643.1|1983022_1983235_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVR28644.1|1983314_1984538_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AVR28645.1|1984668_1985709_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.0	1.7e-93
>prophage 111
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	1998095	2001627	2940845		Bacillus_phage(50.0%)	2	NA	NA
AVR28654.1|1998095_2000876_-	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	31.8	5.4e-70
AVR28655.1|2000877_2001627_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	37.8	4.3e-22
>prophage 112
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2012144	2012846	2940845		Bacillus_virus(100.0%)	1	NA	NA
AVR28667.1|2012144_2012846_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.2	1.1e-19
>prophage 113
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2031566	2033500	2940845		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
AVR28682.1|2031566_2032610_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	40.2	2.8e-59
AVR28683.1|2032606_2033500_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	41.7	9.0e-51
>prophage 114
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2038044	2043162	2940845		Tupanvirus(50.0%)	6	NA	NA
AVR28690.1|2038044_2039634_-	peptide synthase	NA	A0A2K9KZV5	Tupanvirus	30.0	1.2e-53
AVR28691.1|2040219_2040603_-	hypothetical protein	NA	NA	NA	NA	NA
AVR28692.1|2040676_2041042_-	transcriptional regulator	NA	NA	NA	NA	NA
AVR28693.1|2041025_2041487_-	vanillate O-demethylase oxidoreductase VanB	NA	NA	NA	NA	NA
AVR28694.1|2041652_2042306_-	DUF1345 domain-containing protein	NA	NA	NA	NA	NA
AVR28695.1|2042427_2043162_+	metallophosphoesterase	NA	A0A291L9W7	Bordetella_phage	39.0	5.7e-35
>prophage 115
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2057431	2062225	2940845		Bacillus_phage(50.0%)	3	NA	NA
AVR28708.1|2057431_2058853_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.5	5.6e-79
AVR28709.1|2058899_2060315_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
AVR28710.1|2060770_2062225_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	27.5	1.8e-45
>prophage 116
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2066643	2067678	2940845		Rhizobium_phage(100.0%)	1	NA	NA
AVR28714.1|2066643_2067678_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	29.2	3.3e-12
>prophage 117
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2079320	2083919	2940845		Salmonella_phage(50.0%)	4	NA	NA
AVR28725.1|2079320_2080514_+	MFS transporter	NA	S4TR35	Salmonella_phage	22.8	6.0e-10
AVR28726.1|2080748_2081765_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AVR28727.1|2082057_2082849_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AVR28728.1|2083148_2083919_-	short-chain dehydrogenase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	29.4	1.5e-09
>prophage 118
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2090746	2094408	2940845		Mollivirus(50.0%)	2	NA	NA
AVR28735.1|2090746_2091628_-	peroxidase	NA	A0A0M5KAH8	Mollivirus	31.4	1.1e-13
AVR28736.1|2092407_2094408_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.8	4.4e-29
>prophage 119
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2105469	2107152	2940845	holin	Klosneuvirus(100.0%)	1	NA	NA
AVR28748.1|2105469_2107152_+|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0SI18	Klosneuvirus	31.5	1.5e-59
>prophage 120
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2112525	2118746	2940845		Streptococcus_phage(50.0%)	4	NA	NA
AVR28754.1|2112525_2113809_-	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	33.1	4.8e-37
AVR28755.1|2114101_2114824_-	haloacid dehalogenase type II	NA	NA	NA	NA	NA
AVR28756.1|2115167_2116196_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
AVR28757.1|2116202_2118746_-	hybrid sensor histidine kinase/response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	29.9	3.4e-10
>prophage 121
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2122073	2123750	2940845		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVR28760.1|2122073_2123750_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.2	5.0e-10
>prophage 122
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2129866	2131447	2940845		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVR28764.1|2129866_2131447_-	Na+/H+ antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	31.8	8.0e-10
>prophage 123
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2164552	2165932	2940845		Clostridium_botulinum_C_phage(100.0%)	1	NA	NA
AVR28792.1|2164552_2165932_+	MBL fold metallo-hydrolase	NA	Q331V3	Clostridium_botulinum_C_phage	30.6	1.2e-17
>prophage 124
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2172075	2173032	2940845		Synechococcus_phage(100.0%)	1	NA	NA
AVR28800.1|2172075_2173032_+	LOG family protein	NA	A0A1D8KUT5	Synechococcus_phage	29.1	5.7e-11
>prophage 125
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2177268	2178960	2940845		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVR28806.1|2177268_2178960_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	6.7e-15
>prophage 126
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2183306	2184005	2940845		Planktothrix_phage(100.0%)	1	NA	NA
AVR28811.1|2183306_2184005_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	3.1e-38
>prophage 127
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2189697	2195562	2940845		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
AVR28818.1|2189697_2192697_+	ABC transporter ATP-binding protein/permease	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	2.3e-21
AVR28819.1|2192699_2193824_+	ABC transporter permease	NA	NA	NA	NA	NA
AVR28820.1|2194137_2195562_-	cytochrome P450	NA	S4VQU1	Pandoravirus	27.3	1.2e-20
>prophage 128
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2199704	2200730	2940845		Tupanvirus(100.0%)	1	NA	NA
AVR28825.1|2199704_2200730_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	28.6	1.2e-35
>prophage 129
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2215752	2220449	2940845		Geobacillus_virus(50.0%)	4	NA	NA
AVR28840.1|2215752_2217075_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	38.1	3.5e-67
AVR29596.1|2217780_2217960_+	beta-lactoglobulin I	NA	NA	NA	NA	NA
AVR28841.1|2218375_2219161_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
AVR29597.1|2219174_2220449_-	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	23.4	3.4e-11
>prophage 130
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2231718	2232168	2940845		Klebsiella_phage(100.0%)	1	NA	NA
AVR28849.1|2231718_2232168_+	hypothetical protein	NA	S6C8U2	Klebsiella_phage	39.2	1.2e-16
>prophage 131
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2263261	2264764	2940845		Tupanvirus(100.0%)	1	NA	NA
AVR28870.1|2263261_2264764_-	peptidase	NA	A0A2K9L1P3	Tupanvirus	31.5	1.1e-16
>prophage 132
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2279810	2281427	2940845		Synechococcus_phage(100.0%)	1	NA	NA
AVR28885.1|2279810_2281427_+	tryptophan 7-halogenase	NA	A0A1Z1LWL6	Synechococcus_phage	33.3	1.1e-59
>prophage 133
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2285544	2287362	2940845		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVR28889.1|2285544_2287362_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	46.5	4.2e-148
>prophage 134
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2296907	2298122	2940845		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVR29607.1|2296907_2298122_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	34.2	1.6e-26
>prophage 135
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2308251	2309934	2940845	holin	Klosneuvirus(100.0%)	1	NA	NA
AVR28904.1|2308251_2309934_+|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0SI18	Klosneuvirus	29.5	1.6e-48
>prophage 136
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2327187	2327943	2940845		Moraxella_phage(100.0%)	1	NA	NA
AVR28919.1|2327187_2327943_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	38.8	4.8e-37
>prophage 137
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2345548	2346682	2940845		Pandoravirus(100.0%)	1	NA	NA
AVR28935.1|2345548_2346682_+	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A291ATS8	Pandoravirus	40.7	1.0e-11
>prophage 138
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2353274	2354135	2940845		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AVR28940.1|2353274_2354135_+	KR domain-containing protein	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.2	4.6e-12
>prophage 139
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2361036	2362698	2940845		Catovirus(100.0%)	1	NA	NA
AVR28946.1|2361036_2362698_+	AMP-binding acetyl-CoA synthetase	NA	A0A1V0SBX8	Catovirus	24.4	4.3e-30
>prophage 140
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2376221	2387003	2940845		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
AVR28960.1|2376221_2380841_-	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.3	4.4e-24
AVR28961.1|2380863_2382129_-	hypothetical protein	NA	NA	NA	NA	NA
AVR28962.1|2382144_2384349_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.7	1.6e-45
AVR28963.1|2384345_2387003_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	2.7e-79
>prophage 141
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2394644	2397152	2940845		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AVR28971.1|2394644_2397152_-	serine/threonine protein kinase	NA	M1I231	Acanthocystis_turfacea_Chlorella_virus	27.0	6.3e-09
>prophage 142
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2427997	2429866	2940845		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVR28995.1|2427997_2429866_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	27.0	5.5e-26
>prophage 143
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2454499	2458481	2940845		Bacillus_phage(50.0%)	3	NA	NA
AVR29012.1|2454499_2455900_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.5	4.4e-20
AVR29013.1|2456071_2456893_+	porin	NA	NA	NA	NA	NA
AVR29014.1|2457083_2458481_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	32.0	1.2e-44
>prophage 144
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2463528	2465082	2940845		Staphylococcus_phage(100.0%)	1	NA	NA
AVR29019.1|2463528_2465082_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	1.2e-13
>prophage 145
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2468178	2469567	2940845		Bacillus_phage(100.0%)	1	NA	NA
AVR29022.1|2468178_2469567_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	8.8e-13
>prophage 146
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2478988	2480155	2940845		Streptococcus_phage(100.0%)	1	NA	NA
AVR29029.1|2478988_2480155_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	36.4	3.2e-40
>prophage 147
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2520170	2525718	2940845		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
AVR29075.1|2520170_2522564_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.1	1.0e-08
AVR29076.1|2522584_2523058_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AVR29077.1|2523067_2525311_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AVR29078.1|2525355_2525718_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	32.1	3.7e-11
>prophage 148
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2530090	2606919	2940845	tRNA,transposase,plate	Hokovirus(20.0%)	64	NA	NA
AVR29084.1|2530090_2530750_-	hypothetical protein	NA	A0A1V0SB89	Catovirus	33.3	5.5e-05
AVR29085.1|2530725_2531334_-	haloacid dehalogenase	NA	NA	NA	NA	NA
AVR29086.1|2531330_2532119_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVR29087.1|2532111_2533047_-|tRNA	tRNA-ribosyltransferase	tRNA	NA	NA	NA	NA
AVR29624.1|2533043_2534456_-	glycosyl transferase family A	NA	A0A0N9R0I0	Chrysochromulina_ericina_virus	42.8	2.3e-48
AVR29088.1|2534919_2537412_+	ABC transporter substrate-binding protein	NA	A0A1V0SGX0	Hokovirus	31.0	1.3e-43
AVR29089.1|2537496_2538243_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVR29090.1|2538251_2538524_+	hypothetical protein	NA	NA	NA	NA	NA
AVR29091.1|2538612_2539847_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.9	1.8e-102
AVR29092.1|2540454_2541117_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVR29093.1|2541735_2541930_+	hypothetical protein	NA	NA	NA	NA	NA
AVR29094.1|2542727_2545769_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	30.0	1.3e-40
AVR29095.1|2546011_2548657_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	32.6	1.6e-92
AVR29096.1|2548767_2549136_-	hypothetical protein	NA	NA	NA	NA	NA
AVR29097.1|2549141_2550197_+	TagK domain-containing protein	NA	NA	NA	NA	NA
AVR29098.1|2550180_2551035_+	ImpE protein superfamily protein	NA	NA	NA	NA	NA
AVR29099.1|2551021_2551540_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AVR29100.1|2551541_2553422_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVR29625.1|2553418_2554468_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVR29101.1|2554486_2555557_+	hypothetical protein	NA	NA	NA	NA	NA
AVR29102.1|2555612_2556641_+	fimbrial protein	NA	NA	NA	NA	NA
AVR29103.1|2556673_2558032_+	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	49.7	2.6e-110
AVR29104.1|2557924_2561377_-	RHS repeat protein	NA	NA	NA	NA	NA
AVR29105.1|2561389_2561659_-	hypothetical protein	NA	NA	NA	NA	NA
AVR29106.1|2561733_2564475_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.9e-35
AVR29107.1|2564542_2565112_-	hypothetical protein	NA	NA	NA	NA	NA
AVR29108.1|2565077_2565272_-	hypothetical protein	NA	NA	NA	NA	NA
AVR29109.1|2565302_2569211_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AVR29110.1|2569225_2570527_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
AVR29626.1|2570523_2571873_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVR29111.1|2571878_2572421_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AVR29112.1|2572548_2573031_-	Hcp1 family type VI secretion system effector	NA	NA	NA	NA	NA
AVR29113.1|2573231_2574731_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AVR29114.1|2574764_2575304_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AVR29115.1|2575647_2577324_-	hypothetical protein	NA	NA	NA	NA	NA
AVR29627.1|2577326_2577983_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AVR29116.1|2578046_2578619_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AVR29628.1|2578611_2581245_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AVR29117.1|2581467_2582208_-	pilus assembly protein	NA	NA	NA	NA	NA
AVR29118.1|2582274_2582829_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AVR29119.1|2583414_2584008_+	hypothetical protein	NA	NA	NA	NA	NA
AVR29120.1|2583980_2584187_-	hypothetical protein	NA	NA	NA	NA	NA
AVR29121.1|2584222_2585710_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
AVR29122.1|2585785_2587387_-	hypothetical protein	NA	K4F7R4	Cronobacter_phage	46.1	5.8e-08
AVR29123.1|2588243_2588441_-	hypothetical protein	NA	NA	NA	NA	NA
AVR29124.1|2588935_2590477_+	hypothetical protein	NA	NA	NA	NA	NA
AVR29125.1|2591486_2593553_+	FUSC family protein	NA	NA	NA	NA	NA
AVR29126.1|2593549_2593774_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
AVR29127.1|2593775_2594675_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVR29128.1|2594668_2596093_+	TolC family protein	NA	NA	NA	NA	NA
AVR29129.1|2596092_2597292_+	transcriptional regulator CynR	NA	NA	NA	NA	NA
AVR29130.1|2597424_2597664_+	hypothetical protein	NA	NA	NA	NA	NA
AVR29131.1|2597660_2597891_+	hypothetical protein	NA	NA	NA	NA	NA
AVR29132.1|2598285_2598588_+	hypothetical protein	NA	NA	NA	NA	NA
AVR29133.1|2598619_2598973_+	hypothetical protein	NA	NA	NA	NA	NA
AVR29134.1|2599205_2600129_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVR29135.1|2600800_2601943_+	porin	NA	NA	NA	NA	NA
AVR29136.1|2602092_2602299_-	hypothetical protein	NA	NA	NA	NA	NA
AVR29137.1|2602418_2602775_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
AVR29138.1|2603244_2603544_-	hypothetical protein	NA	NA	NA	NA	NA
AVR29139.1|2603582_2604275_-	hypothetical protein	NA	NA	NA	NA	NA
AVR29140.1|2604747_2605074_+	thioredoxin	NA	NA	NA	NA	NA
AVR29141.1|2605093_2605513_+	YjbQ family protein	NA	NA	NA	NA	NA
AVR29142.1|2605832_2606919_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	2.0e-44
>prophage 149
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2612740	2618656	2940845		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVR29145.1|2612740_2618656_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	37.2	2.1e-180
>prophage 150
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2625848	2634956	2940845		Moraxella_phage(100.0%)	1	NA	NA
AVR29152.1|2625848_2634956_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	31.4	3.7e-27
>prophage 151
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2645027	2645732	2940845		Planktothrix_phage(100.0%)	1	NA	NA
AVR29162.1|2645027_2645732_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	2.5e-32
>prophage 152
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2654941	2655370	2940845		Dinoroseobacter_phage(100.0%)	1	NA	NA
AVR29169.1|2654941_2655370_+	thioredoxin TrxC	NA	A0A0A7CHH9	Dinoroseobacter_phage	29.6	9.7e-11
>prophage 153
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2659678	2661037	2940845		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVR29174.1|2659678_2661037_-	3-carboxy-cis,cis-muconate cycloisomerase	NA	A0A1B1ISB0	uncultured_Mediterranean_phage	27.3	5.1e-05
>prophage 154
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2665207	2665936	2940845		Vibrio_phage(100.0%)	1	NA	NA
AVR29179.1|2665207_2665936_+	GTP cyclohydrolase I FolE	NA	A0A2I7S8W4	Vibrio_phage	44.4	1.7e-44
>prophage 155
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2698972	2701216	2940845		Vibrio_phage(50.0%)	2	NA	NA
AVR29214.1|2698972_2700004_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	76.5	2.8e-16
AVR29215.1|2700016_2701216_-	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	29.5	8.4e-36
>prophage 156
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2710533	2714310	2940845		Vibrio_phage(33.33%)	5	NA	NA
AVR29221.1|2710533_2711196_-	chromosome partitioning protein ParA	NA	K7R2R7	Vibrio_phage	29.8	9.4e-21
AVR29222.1|2711954_2712311_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	44.3	6.3e-16
AVR29223.1|2712604_2712802_-	hypothetical protein	NA	NA	NA	NA	NA
AVR29224.1|2712782_2713388_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AVR29225.1|2713752_2714310_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	31.2	2.2e-15
>prophage 157
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2718203	2719139	2940845		Bacillus_phage(100.0%)	1	NA	NA
AVR29229.1|2718203_2719139_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.0	3.3e-19
>prophage 158
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2726454	2729603	2940845		Planktothrix_phage(50.0%)	3	NA	NA
AVR29237.1|2726454_2727177_+	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.8	9.2e-38
AVR29238.1|2727189_2728260_+	peptidase C45	NA	NA	NA	NA	NA
AVR29239.1|2728256_2729603_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.0	1.4e-23
>prophage 159
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2742668	2748990	2940845		Acanthamoeba_polyphaga_mimivirus(50.0%)	3	NA	NA
AVR29244.1|2742668_2746808_+	cytochrome	NA	A0A2L2DJN2	Acanthamoeba_polyphaga_mimivirus	21.8	1.0e-19
AVR29245.1|2746840_2748289_+	monooxygenase	NA	NA	NA	NA	NA
AVR29246.1|2748288_2748990_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.4	7.3e-32
>prophage 160
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2755337	2757779	2940845		Bacillus_virus(100.0%)	1	NA	NA
AVR29640.1|2755337_2757779_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	33.3	3.2e-18
>prophage 161
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2782254	2784045	2940845		Loktanella_phage(100.0%)	1	NA	NA
AVR29643.1|2782254_2784045_-	ribonucleotide reductase-like protein	NA	M4QT32	Loktanella_phage	32.1	1.6e-62
>prophage 162
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2800894	2802295	2940845		Erysipelothrix_phage(100.0%)	1	NA	NA
AVR29285.1|2800894_2802295_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.7	1.8e-34
>prophage 163
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2813983	2814361	2940845		Sinorhizobium_phage(100.0%)	1	NA	NA
AVR29295.1|2813983_2814361_-	DUF3175 domain-containing protein	NA	A0A0F6TH17	Sinorhizobium_phage	62.0	3.3e-23
>prophage 164
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2845216	2846278	2940845		Salmonella_phage(100.0%)	1	NA	NA
AVR29321.1|2845216_2846278_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	55.1	2.0e-89
>prophage 165
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2880081	2881530	2940845		Mycobacterium_phage(100.0%)	1	NA	NA
AVR29351.1|2880081_2881530_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	28.6	1.3e-22
>prophage 166
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2890543	2892046	2940845		Acinetobacter_phage(100.0%)	1	NA	NA
AVR29360.1|2890543_2892046_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.3	2.2e-41
>prophage 167
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2896931	2899048	2940845		Planktothrix_phage(50.0%)	2	NA	NA
AVR29367.1|2896931_2897921_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	6.1e-16
AVR29368.1|2897917_2899048_+	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	26.2	4.1e-08
>prophage 168
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2919572	2920874	2940845		Pandoravirus(100.0%)	1	NA	NA
AVR29388.1|2919572_2920874_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	28.4	1.0e-15
>prophage 169
CP020391	Burkholderia thailandensis strain FDAARGOS_238 chromosome 2, complete sequence	2940845	2924838	2926467	2940845		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVR29391.1|2924838_2926467_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.1	2.2e-10
