The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	554705	611740	5074586	protease,lysis,tRNA,tail,integrase	Enterobacteria_phage(40.38%)	64	592780:592794	617656:617670
AVQ74956.1|554705_556091_+|tRNA	cysteinyl-tRNA synthetase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
AVQ74957.1|556126_556648_-	hypothetical protein	NA	NA	NA	NA	NA
AVQ74958.1|556755_556968_-	putative RNA-binding protein	NA	NA	NA	NA	NA
AVQ74959.1|556969_557836_-	bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AVQ74960.1|558198_559362_-|integrase	putative integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
AVQ74961.1|559588_559894_-	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	1.4e-48
AVQ74962.1|559893_560256_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
AVQ74963.1|560246_560783_-	deoxyribonucleoside 5'-monophosphate phosphatase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
AVQ74964.1|560910_561735_-	hypothetical protein	NA	U5P439	Shigella_phage	99.6	1.0e-149
AVQ74965.1|561800_562163_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
AVQ74966.1|562886_563534_-	putative HTH-type transcriptional regulator	NA	K7PKK1	Enterobacteria_phage	99.1	1.2e-116
AVQ74967.1|563676_563937_+	hypothetical protein	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
AVQ74968.1|563929_564487_+	putative DNA-binding transcriptional regulator	NA	K7PGU3	Enterobacteria_phage	96.8	1.1e-96
AVQ74969.1|564483_565632_+	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	86.4	2.7e-177
AVQ74970.1|565628_566495_+	hypothetical protein	NA	K7PLX4	Enterobacteria_phage	75.5	9.4e-114
AVQ74971.1|566491_566716_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	95.9	2.4e-37
AVQ74972.1|566712_567531_+	putative defective phage replication protein O	NA	A5LH71	Enterobacteria_phage	88.1	2.8e-123
AVQ74973.1|567533_568022_+	hypothetical protein	NA	A0A291AWV6	Escherichia_phage	96.3	1.5e-84
AVQ74974.1|568021_568675_+	putative methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
AVQ74975.1|568671_568998_+	LexA DNA-binding transcriptional repressor	NA	A0A291AWY9	Escherichia_phage	98.1	2.7e-53
AVQ74976.1|568994_569390_+	endodeoxyribonuclease RUS (Holliday junction resolvase)	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
AVQ74977.1|569552_570368_+	hypothetical protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
AVQ74978.1|570375_571365_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
AVQ74979.1|571382_571754_+	putative antitermination protein	NA	Q8W638	Enterobacteria_phage	59.2	8.3e-35
AVQ74980.1|571829_572447_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ74981.1|572725_572923_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
AVQ74982.1|573183_573765_+	GadW DNA-binding transcriptional dual regulator	NA	NA	NA	NA	NA
AVQ74983.1|574534_576496_+	putative 9-O-acetyl-N-acetylneuraminate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.5	6.6e-240
AVQ74984.1|576852_577122_+	hypothetical protein	NA	S5MW40	Escherichia_phage	76.4	1.8e-10
AVQ74985.1|577197_577413_+|lysis	putative phage lysis protein	lysis	G9L6J5	Escherichia_phage	100.0	9.0e-34
AVQ74986.1|577417_577768_+	hypothetical protein	NA	B6DZ91	Enterobacteria_phage	91.1	6.0e-51
AVQ74987.1|577831_578365_+	putative lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	2.1e-100
AVQ74988.1|578663_579101_+	putative murein endopeptidase	NA	A0A088CBQ1	Shigella_phage	95.2	2.3e-68
AVQ74989.1|579302_579824_+	hypothetical protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
AVQ74990.1|580532_580673_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ74991.1|581386_581935_+	putative packaging protein	NA	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
AVQ74992.1|583816_584023_+	hypothetical protein	NA	K7PM10	Enterobacteria_phage	55.4	3.0e-10
AVQ74993.1|584019_585612_+	hypothetical protein	NA	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
AVQ74994.1|585601_587107_+	putative inner membrane peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	1.0e-99
AVQ74995.1|587143_587491_+	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
AVQ74996.1|587548_588577_+	hypothetical protein	NA	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
AVQ74997.1|588628_589003_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ74998.1|588995_589349_+	hypothetical protein	NA	A0A0K2FJB7	Enterobacteria_phage	65.0	5.8e-38
AVQ74999.1|589360_589939_+	hypothetical protein	NA	A0A2R9YJK4	Escherichia_phage	91.7	3.9e-79
AVQ75000.1|589935_590331_+	hypothetical protein	NA	A0A2R9YJI2	Escherichia_phage	99.2	8.5e-70
AVQ75001.1|590338_591079_+	hypothetical protein	NA	A0A2I6TC77	Escherichia_phage	99.6	7.8e-133
AVQ75002.1|591094_591517_+	hypothetical protein	NA	A0A0K2FIQ8	Enterobacteria_phage	95.7	1.5e-69
AVQ75003.1|591498_591933_+	hypothetical protein	NA	A0A0K2FJB3	Enterobacteria_phage	98.3	1.0e-63
AVQ75004.1|591925_594487_+|tail	putative tail protein	tail	A0A2R9YJM8	Escherichia_phage	89.6	0.0e+00
592780:592794	attL	CCGCCTGAAAGAGAA	NA	NA	NA	NA
AVQ75005.1|594483_594813_+	hypothetical protein	NA	Q687F2	Enterobacteria_phage	99.1	4.7e-58
AVQ75006.1|594812_595511_+	hypothetical protein	NA	H6WZM3	Escherichia_phage	96.1	1.2e-127
AVQ75007.1|595521_596265_+	CysO-cysteine peptidase	NA	S5MQI8	Escherichia_phage	94.3	4.9e-143
AVQ75008.1|596261_596843_+	hypothetical protein	NA	H6WZM5	Escherichia_phage	92.7	2.5e-86
AVQ75009.1|597186_600879_+	hypothetical protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.7	0.0e+00
AVQ75010.1|600946_601546_+	hypothetical protein	NA	Q9EV15	Enterobacteria_phage	92.0	9.8e-102
AVQ75011.1|601697_603758_+	putative membrane protein	NA	A0A1X7QGG5	Escherichia_phage	65.7	7.1e-152
AVQ75012.1|603754_604033_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
AVQ75013.1|604042_604336_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ75014.1|604528_605185_-	putative SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVQ75015.1|605742_607227_-	Carboxylesterase B	NA	NA	NA	NA	NA
AVQ75016.1|607413_608367_-|protease	outer membrane protease VII (outer membrane protein 3b)	protease	NA	NA	NA	NA
AVQ75017.1|609169_609469_-|integrase	putative integrase	integrase	B9UDL9	Salmonella_phage	80.0	6.5e-30
AVQ75018.1|609886_610543_-	putative SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVQ75019.1|610786_611740_-|protease	outer membrane protease VII (outer membrane protein 3b)	protease	NA	NA	NA	NA
617656:617670	attR	TTCTCTTTCAGGCGG	NA	NA	NA	NA
>prophage 2
CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	920848	930968	5074586	protease	Vibrio_phage(33.33%)	6	NA	NA
AVQ75303.1|920848_922795_+	MacAB-TolC macrolide efflux transport system - membrane subunit	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
AVQ75304.1|922867_923092_-	DNA replication inhibitor	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AVQ75305.1|923414_923735_+|protease	specificity factor for ClpA-ClpP chaperone-protease complex	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AVQ75306.1|923765_926042_+	ClpAXP	NA	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AVQ75307.1|926754_927738_+	CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
AVQ75308.1|927734_930968_+	CRISPR-associated nuclease/helicase Cas3 subtype I-F/YPEST	NA	A0A2I7RCU8	Vibrio_phage	28.0	1.0e-83
>prophage 3
CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	957088	995287	5074586	tail	Escherichia_phage(40.91%)	48	NA	NA
AVQ75329.1|957088_957886_-	pyruvate formate-lyase activating enzyme	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
AVQ75330.1|957917_958913_-	site-specific recombinase	NA	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
AVQ75331.1|959006_959255_-	hypothetical protein	NA	Q1JS25	Enterobacteria_phage	100.0	1.2e-42
AVQ75332.1|959422_959779_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
AVQ75333.1|959789_959960_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
AVQ75334.1|959956_960457_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	3.8e-91
AVQ75335.1|960520_960733_+	hypothetical protein	NA	S4TP68	Salmonella_phage	92.9	8.6e-29
AVQ75336.1|960747_960993_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ75337.1|960989_961280_+	hypothetical protein	NA	M1RZ07	Escherichia_phage	81.7	5.5e-34
AVQ75338.1|961279_961504_+	hypothetical protein	NA	A0A0F7LDI3	Escherichia_phage	97.3	8.5e-35
AVQ75339.1|961500_961776_+	hypothetical protein	NA	S4TP00	Salmonella_phage	97.8	1.9e-44
AVQ75340.1|961765_964051_+	hypothetical protein	NA	Q858T4	Yersinia_virus	98.2	0.0e+00
AVQ75341.1|964050_964503_+	hypothetical protein	NA	Q2P9X4	Enterobacteria_phage	96.7	1.4e-79
AVQ75342.1|964502_964709_+	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	94.0	1.5e-30
AVQ75343.1|964932_965664_+	hypothetical protein	NA	A0A218M4H5	Erwinia_phage	77.4	4.2e-107
AVQ75344.1|965775_966558_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ75345.1|966906_967968_-	hypothetical protein	NA	Q7Y4E8	Escherichia_virus	99.7	1.9e-201
AVQ75346.1|968135_969677_+	hypothetical protein	NA	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AVQ75347.1|969691_970438_+	putative DNA replication protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AVQ75348.1|970527_972300_-	hypothetical protein	NA	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
AVQ75349.1|972473_973328_+	hypothetical protein	NA	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
AVQ75350.1|973386_974460_+	hypothetical protein	NA	Q94MH9	Enterobacteria_phage	98.9	1.6e-200
AVQ75351.1|974463_975207_+	hypothetical protein	NA	A0A0F7LDU4	Escherichia_phage	98.8	8.6e-124
AVQ75352.1|975306_975816_+	hypothetical protein	NA	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AVQ75353.1|975815_976019_+	hypothetical protein	NA	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
AVQ75354.1|976022_976304_+	hypothetical protein	NA	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AVQ75355.1|976303_976801_+	hypothetical protein	NA	A0A0F7LBS0	Escherichia_phage	98.8	9.9e-92
AVQ75356.1|976815_977241_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	94.3	4.0e-57
AVQ75357.1|977228_977654_+	hypothetical protein	NA	Q858W0	Yersinia_virus	95.7	8.0e-66
AVQ75358.1|977640_977799_+	hypothetical protein	NA	M1RZ27	Escherichia_phage	100.0	2.6e-22
AVQ75359.1|977761_978229_+	hypothetical protein	NA	U5N0S7	Enterobacteria_phage	96.8	1.3e-80
AVQ75360.1|978221_978674_+	hypothetical protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	4.1e-76
AVQ75361.1|978740_979376_+	hypothetical protein	NA	U5N3F0	Enterobacteria_phage	96.7	2.7e-110
AVQ75362.1|979372_979720_+	hypothetical protein	NA	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
AVQ75363.1|979724_980633_+	hypothetical protein	NA	U5N3T9	Enterobacteria_phage	100.0	1.5e-162
AVQ75364.1|980625_981156_+	hypothetical protein	NA	Q858V5	Yersinia_virus	96.6	8.9e-99
AVQ75365.1|981166_983908_+	putative membrane protein	NA	Q858V4	Yersinia_virus	99.7	0.0e+00
AVQ75366.1|983911_984439_+|tail	putative tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	92.0	4.9e-89
AVQ75367.1|984860_985703_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ75368.1|985809_985917_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ75369.1|986082_987273_+|tail	Putative prophage major tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	6.2e-225
AVQ75370.1|987285_987804_+	hypothetical protein	NA	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AVQ75371.1|987860_988136_+	hypothetical protein	NA	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AVQ75372.1|988280_990728_+	Chromosome partition protein Smc	NA	Q7Y4C8	Escherichia_virus	95.8	0.0e+00
AVQ75373.1|990742_991222_+	hypothetical protein	NA	Q7Y4C7	Escherichia_virus	98.1	2.1e-83
AVQ75374.1|991221_992385_+	hypothetical protein	NA	A0A0F7LDZ2	Escherichia_phage	99.0	1.2e-204
AVQ75375.1|992466_992685_+	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
AVQ75376.1|993004_995287_-	pyruvate formate-lyase (inactive)	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 4
CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	1215742	1258488	5074586	tail,integrase,lysis	Enterobacteria_phage(54.72%)	58	1214903:1214916	1252550:1252563
1214903:1214916	attL	AAACATTTTGCATC	NA	NA	NA	NA
AVQ75582.1|1215742_1216993_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
AVQ75583.1|1217106_1218249_-|integrase	putative integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
AVQ75584.1|1218238_1218475_-	putative excisionase	NA	NA	NA	NA	NA
AVQ75585.1|1218614_1218854_-	hypothetical protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
AVQ75586.1|1218837_1219164_-	hypothetical protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
AVQ75587.1|1219935_1220118_-	hypothetical protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
AVQ75588.1|1220114_1220795_-	putative exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
AVQ75589.1|1220791_1221577_-	hypothetical protein	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AVQ75590.1|1221582_1221879_-	hypothetical protein	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
AVQ75591.1|1221954_1222098_-	hypothetical protein	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
AVQ75592.1|1222066_1222231_-	hypothetical protein	NA	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
AVQ75593.1|1222303_1222672_-	hypothetical protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
AVQ75594.1|1222854_1223055_-	hypothetical protein	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
AVQ75595.1|1223268_1223850_+	hypothetical protein	NA	K7P6T7	Enterobacteria_phage	92.7	1.4e-92
AVQ75596.1|1223866_1224139_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
AVQ75597.1|1224575_1225325_-	hypothetical protein	NA	NA	NA	NA	NA
AVQ75598.1|1225324_1225882_-	hypothetical protein	NA	NA	NA	NA	NA
AVQ75599.1|1225921_1226575_-	putative repressor protein	NA	A0A0N7BTS4	Escherichia_phage	100.0	6.2e-126
AVQ75600.1|1226692_1226908_+	hypothetical protein	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
AVQ75601.1|1227049_1227346_+	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
AVQ75602.1|1227378_1228278_+	putative defective phage replication protein O	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
AVQ75603.1|1228274_1228976_+	hypothetical protein	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
AVQ75604.1|1228972_1229263_+	hypothetical protein	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
AVQ75605.1|1229336_1229777_+	hypothetical protein	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
AVQ75606.1|1229773_1230301_+	putative methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
AVQ75607.1|1230476_1230818_+	hypothetical protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
AVQ75608.1|1231024_1231387_+	endodeoxyribonuclease RUS (Holliday junction resolvase)	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
AVQ75609.1|1231386_1231524_+	small protein	NA	K7PHH3	Enterobacteria_phage	68.3	6.0e-07
AVQ75610.1|1231609_1231993_+	putative antitermination protein	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
AVQ75611.1|1232181_1233264_-	outer membrane porin protein	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
AVQ75612.1|1233852_1234068_+|lysis	putative phage lysis protein	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AVQ75613.1|1234067_1234565_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
AVQ75614.1|1234561_1235023_+	putative murein endopeptidase	NA	A0A0K2FJD0	Enterobacteria_phage	97.4	4.6e-75
AVQ75615.1|1235054_1235348_-	hypothetical protein	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
AVQ75616.1|1235828_1236155_+	TonB energy transducing system - TonB subunit	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
AVQ75617.1|1236277_1236631_-	hypothetical protein	NA	NA	NA	NA	NA
AVQ75618.1|1237106_1237655_+	putative packaging protein	NA	A0A0U2S671	Escherichia_phage	84.2	1.8e-57
AVQ75619.1|1237626_1239555_+|tail	putative tail fiber assembly protein	tail	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
AVQ75620.1|1239538_1239745_+	hypothetical protein	NA	K7PM10	Enterobacteria_phage	55.4	3.0e-10
AVQ75621.1|1239741_1241334_+	hypothetical protein	NA	K7P6U7	Enterobacteria_phage	61.1	6.5e-185
AVQ75622.1|1241323_1242829_+	putative inner membrane peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
AVQ75623.1|1242865_1243213_+	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
AVQ75624.1|1243270_1244299_+	hypothetical protein	NA	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
AVQ75625.1|1244350_1244725_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ75626.1|1244717_1245071_+	hypothetical protein	NA	A0A0K2FJB7	Enterobacteria_phage	64.1	2.2e-37
AVQ75627.1|1245082_1245661_+	hypothetical protein	NA	A0A2R9YJK4	Escherichia_phage	91.7	3.9e-79
AVQ75628.1|1245657_1246053_+	hypothetical protein	NA	A0A2R9YJI2	Escherichia_phage	99.2	8.5e-70
AVQ75629.1|1246060_1246801_+	hypothetical protein	NA	A0A2I6TC77	Escherichia_phage	99.6	7.8e-133
AVQ75630.1|1246816_1247239_+	hypothetical protein	NA	A0A0K2FIQ8	Enterobacteria_phage	95.7	1.5e-69
AVQ75631.1|1247220_1247655_+	hypothetical protein	NA	A0A0K2FJB3	Enterobacteria_phage	98.3	1.0e-63
AVQ75632.1|1247647_1250209_+|tail	putative tail protein	tail	A0A0K2FI43	Enterobacteria_phage	94.6	0.0e+00
AVQ75633.1|1250205_1250535_+	hypothetical protein	NA	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
AVQ75634.1|1250534_1251233_+	hypothetical protein	NA	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
AVQ75635.1|1251382_1251982_+	hypothetical protein	NA	C6ZCZ3	Enterobacteria_phage	98.5	1.6e-120
AVQ75636.1|1251978_1252551_+	hypothetical protein	NA	A0A2R9YJH6	Escherichia_phage	99.5	3.0e-84
AVQ75637.1|1252611_1256094_+	hypothetical protein	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
1252550:1252563	attR	GATGCAAAATGTTT	NA	NA	NA	NA
AVQ75638.1|1256152_1258213_+	putative membrane protein	NA	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
AVQ75639.1|1258209_1258488_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
>prophage 5
CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	1365321	1411916	5074586	tail,integrase,lysis	Escherichia_phage(40.91%)	56	1359966:1359979	1372892:1372905
1359966:1359979	attL	TTCCCGCTTTCTTT	NA	NA	NA	NA
AVQ75748.1|1365321_1366452_-|integrase	putative integrase	integrase	O21940	Phage_21	51.4	3.4e-103
AVQ75749.1|1366742_1369214_-	hypothetical protein	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
AVQ75750.1|1369306_1369498_-	hypothetical protein	NA	NA	NA	NA	NA
AVQ75751.1|1369494_1369683_-	cell division inhibition protein	NA	NA	NA	NA	NA
AVQ75752.1|1370083_1370248_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ75753.1|1370248_1370470_-	hypothetical protein	NA	NA	NA	NA	NA
AVQ75754.1|1370499_1370628_-	small protein	NA	NA	NA	NA	NA
AVQ75755.1|1370629_1370866_-	hypothetical protein	NA	M4QQ57	Salicola_phage	51.1	1.4e-06
AVQ75756.1|1371077_1371416_-	LexA repressor	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
AVQ75757.1|1371807_1372050_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
AVQ75758.1|1372033_1372459_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ75759.1|1372530_1373601_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
1372892:1372905	attR	AAAGAAAGCGGGAA	NA	NA	NA	NA
AVQ75760.1|1373641_1374064_+	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	87.8	4.1e-62
AVQ75761.1|1374195_1375218_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ75762.1|1375233_1376235_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ75763.1|1376795_1377008_+	small toxic polypeptide	NA	A0A0U2QV81	Escherichia_phage	98.5	3.1e-26
AVQ75764.1|1377455_1378502_+	hypothetical protein	NA	U5P0K4	Shigella_phage	54.8	3.8e-109
AVQ75765.1|1378514_1378889_+	endodeoxyribonuclease RUS (Holliday junction resolvase)	NA	V5URS4	Shigella_phage	62.7	1.1e-34
AVQ75766.1|1378885_1379707_+	putative antitermination protein Q	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
AVQ75767.1|1379931_1380129_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
AVQ75768.1|1380279_1381329_+	DNA adenine methyltransferase	NA	S5MDR0	Escherichia_phage	95.1	3.7e-197
AVQ75769.1|1382603_1382831_+	hypothetical protein	NA	Q20GJ1	Phage_258-320	91.8	1.8e-32
AVQ75770.1|1383099_1383315_+|lysis	putative phage lysis protein	lysis	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
AVQ75771.1|1383319_1383664_+	hypothetical protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
AVQ75772.1|1383629_1383902_-	hypothetical protein	NA	NA	NA	NA	NA
AVQ75773.1|1384176_1384542_+	putative lysozyme	NA	Q08J98	Stx2-converting_phage	99.2	3.9e-69
AVQ75774.1|1384840_1385305_+	putative murein endopeptidase	NA	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
AVQ75775.1|1385612_1386023_-	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	75.6	1.7e-52
AVQ75776.1|1386700_1387249_+	putative packaging protein	NA	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
AVQ75777.1|1387220_1388687_+|tail	putative tail fiber assembly protein	tail	O64317	Escherichia_phage	68.9	3.0e-205
AVQ75778.1|1388674_1389148_+	hypothetical protein	NA	A0A2I6TC92	Escherichia_phage	58.4	1.4e-42
AVQ75779.1|1389131_1389338_+	hypothetical protein	NA	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AVQ75780.1|1389334_1390927_+	hypothetical protein	NA	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
AVQ75781.1|1390916_1392422_+	putative inner membrane peptidase	NA	A0A2I6TC87	Escherichia_phage	53.8	9.3e-101
AVQ75782.1|1392458_1392806_+	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
AVQ75783.1|1392863_1393892_+	hypothetical protein	NA	C6ZCY2	Enterobacteria_phage	61.6	1.0e-114
AVQ75784.1|1393942_1394317_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ75785.1|1394309_1394663_+	hypothetical protein	NA	A0A0K2FJB7	Enterobacteria_phage	70.9	6.7e-42
AVQ75786.1|1394678_1395212_+	hypothetical protein	NA	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
AVQ75787.1|1395208_1395604_+	hypothetical protein	NA	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AVQ75788.1|1395611_1396364_+	hypothetical protein	NA	Q687F6	Enterobacteria_phage	98.4	1.2e-133
AVQ75789.1|1396377_1396809_+	hypothetical protein	NA	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
AVQ75790.1|1396835_1397249_+	hypothetical protein	NA	S5MDP5	Escherichia_phage	82.2	1.6e-42
AVQ75791.1|1397229_1399803_+|tail	putative tail protein	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
AVQ75792.1|1399799_1400069_+	hypothetical protein	NA	A0A2R9YJM0	Escherichia_phage	93.3	2.7e-43
AVQ75793.1|1400128_1400827_+	hypothetical protein	NA	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
AVQ75794.1|1400975_1401575_+	hypothetical protein	NA	K7PLW1	Enterobacteria_phage	94.0	1.8e-116
AVQ75795.1|1401571_1402114_+	hypothetical protein	NA	A0A291AWV5	Escherichia_phage	83.5	3.7e-76
AVQ75796.1|1402271_1402526_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ75797.1|1402592_1406072_+	hypothetical protein	NA	A0A291AWT4	Escherichia_phage	89.8	0.0e+00
AVQ75798.1|1406139_1406739_+	hypothetical protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
AVQ75799.1|1406890_1409998_+|tail	Qin prophage, putative side tail fiber assembly protein	tail	A0A0P0ZCC1	Stx2-converting_phage	90.5	4.4e-52
AVQ75800.1|1409997_1410582_+|tail	putative tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
AVQ75801.1|1410636_1411293_-	putative SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVQ75802.1|1411361_1411631_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
AVQ75803.1|1411745_1411916_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
>prophage 6
CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	2207355	2247248	5074586	tail	Escherichia_phage(39.53%)	47	NA	NA
AVQ76532.1|2207355_2208717_+	putative peptidase	NA	Q6DW11	Phage_TP	99.5	5.5e-217
AVQ76533.1|2208989_2209208_-	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
AVQ76534.1|2209289_2210453_-	hypothetical protein	NA	U5N3V4	Enterobacteria_phage	99.0	7.0e-205
AVQ76535.1|2210452_2210932_-	hypothetical protein	NA	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
AVQ76536.1|2210946_2213394_-	hypothetical protein	NA	M1T2S3	Escherichia_phage	99.1	0.0e+00
AVQ76537.1|2213538_2213814_-	hypothetical protein	NA	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AVQ76538.1|2213870_2214389_-	hypothetical protein	NA	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
AVQ76539.1|2214401_2215592_-|tail	Putative prophage major tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	2.8e-225
AVQ76540.1|2215922_2216300_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ76541.1|2216322_2216907_-	Tyrosine recombinase XerC	NA	A0A1V0E036	Clostridioides_phage	31.5	5.2e-07
AVQ76542.1|2217013_2217856_-	hypothetical protein	NA	NA	NA	NA	NA
AVQ76543.1|2218277_2218805_-|tail	putative tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	91.4	8.3e-89
AVQ76544.1|2218808_2221544_-	putative membrane protein	NA	Q858V4	Yersinia_virus	81.7	0.0e+00
AVQ76545.1|2221554_2222085_-	hypothetical protein	NA	Q858V5	Yersinia_virus	98.3	7.3e-101
AVQ76546.1|2222077_2222986_-	hypothetical protein	NA	A0A0F7LCJ3	Escherichia_phage	99.7	2.2e-161
AVQ76547.1|2222990_2223338_-	hypothetical protein	NA	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
AVQ76548.1|2223334_2223970_-	hypothetical protein	NA	Q858V7	Yersinia_virus	97.6	2.2e-112
AVQ76549.1|2224115_2225195_+	GTP pyrophosphokinase YwaC	NA	NA	NA	NA	NA
AVQ76550.1|2225275_2225728_-	hypothetical protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	1.5e-75
AVQ76551.1|2225720_2226188_-	hypothetical protein	NA	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
AVQ76552.1|2226150_2226309_-	hypothetical protein	NA	A0A0F7LCN5	Escherichia_phage	98.1	9.9e-22
AVQ76553.1|2226295_2226721_-	hypothetical protein	NA	Q858W0	Yersinia_virus	97.2	2.3e-65
AVQ76554.1|2226708_2227134_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
AVQ76555.1|2227148_2227646_-	hypothetical protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	6.9e-93
AVQ76556.1|2227645_2227927_-	hypothetical protein	NA	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AVQ76557.1|2227930_2228134_-	hypothetical protein	NA	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
AVQ76558.1|2228133_2228643_-	hypothetical protein	NA	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AVQ76559.1|2228742_2229486_-	hypothetical protein	NA	Q858W5	Yersinia_virus	97.2	3.3e-123
AVQ76560.1|2229489_2230179_-	hypothetical protein	NA	Q94MI3	Enterobacteria_phage	99.5	4.9e-121
AVQ76561.1|2230346_2231888_+	hypothetical protein	NA	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AVQ76562.1|2231902_2232649_+	putative DNA replication protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AVQ76563.1|2232702_2233149_-	hypothetical protein	NA	A0A0F7LBR8	Escherichia_phage	99.3	3.0e-71
AVQ76564.1|2233207_2234062_-	hypothetical protein	NA	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
AVQ76565.1|2234235_2236008_+	hypothetical protein	NA	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
AVQ76566.1|2236007_2237042_+	hypothetical protein	NA	Q858W8	Yersinia_virus	99.7	1.2e-200
AVQ76567.1|2237381_2239214_-	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	32.1	2.0e-89
AVQ76568.1|2239330_2241613_-	hypothetical protein	NA	A0A0F7LBQ2	Escherichia_phage	97.9	0.0e+00
AVQ76569.1|2241602_2241878_-	hypothetical protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
AVQ76570.1|2241874_2242099_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
AVQ76571.1|2242101_2242401_-	hypothetical protein	NA	S4TUD1	Salmonella_phage	100.0	8.4e-46
AVQ76572.1|2242400_2242625_-	hypothetical protein	NA	S4TP68	Salmonella_phage	98.6	1.4e-32
AVQ76573.1|2242688_2243189_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
AVQ76574.1|2243185_2243356_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
AVQ76575.1|2243366_2243642_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
AVQ76576.1|2243756_2244056_+	hypothetical protein	NA	Q1JS83	Enterobacteria_phage	100.0	3.3e-50
AVQ76577.1|2245615_2245933_-	uncharacterized protein	NA	NA	NA	NA	NA
AVQ76578.1|2246348_2247248_+	lipid kinase	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
>prophage 7
CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	2284721	2294166	5074586		Enterobacteria_phage(85.71%)	10	NA	NA
AVQ76611.1|2284721_2285858_+	hypothetical protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.2e-161
AVQ76612.1|2285854_2287858_+	uncharacterized protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
AVQ76613.1|2287982_2288444_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AVQ76614.1|2288484_2288955_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AVQ76615.1|2289001_2289721_-	putative response regulator in two-component system with YpdA	NA	NA	NA	NA	NA
AVQ76616.1|2289717_2291403_-	putative sensory kinase in two-component system with YpdB	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AVQ76617.1|2291624_2292356_+	MlrA DNA binding transcriptional activator	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
AVQ76618.1|2292415_2292523_+	small putative membrane protein	NA	NA	NA	NA	NA
AVQ76619.1|2292503_2293235_-	YehW/YehX/YehY/YehZ ABC transporter	NA	NA	NA	NA	NA
AVQ76620.1|2293239_2294166_-	YehW/YehX/YehY/YehZ ABC transporter	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 8
CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	2531825	2575523	5074586	protease,integrase	Enterobacteria_phage(76.67%)	66	2532894:2532910	2575597:2575613
AVQ76830.1|2531825_2532758_+	putative inner membrane protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
2532894:2532910	attL	CTGCAGGGGACACCATT	NA	NA	NA	NA
AVQ76831.1|2533069_2534227_+|integrase	integrase	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
AVQ76832.1|2534466_2535264_-	galactoside O-acetyltransferase monomer	NA	C7U0V2	Enterobacteria_phage	99.1	3.1e-79
AVQ76833.1|2535417_2538363_-	hypothetical protein	NA	A5VW57	Enterobacteria_phage	99.4	0.0e+00
AVQ76834.1|2538463_2539366_-	hypothetical protein	NA	Q0H8C7	Salmonella_phage	97.0	1.5e-167
AVQ76835.1|2539428_2539602_-	hypothetical protein	NA	NA	NA	NA	NA
AVQ76836.1|2539598_2539751_-	hypothetical protein	NA	NA	NA	NA	NA
AVQ76837.1|2539865_2540114_+	hypothetical protein	NA	G0ZNE9	Cronobacter_phage	50.0	1.5e-08
AVQ76838.1|2540113_2540650_+|protease	ATP-dependent Clp protease proteolytic subunit 1	protease	NA	NA	NA	NA
AVQ76839.1|2540698_2541148_-	ribosome-dependent mRNA interferase, toxin of the YafO-YafN toxin-antitoxin system	NA	G8C7Q9	Escherichia_phage	60.3	9.1e-44
AVQ76840.1|2541156_2541723_-	hypothetical protein	NA	NA	NA	NA	NA
AVQ76841.1|2541898_2542249_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ76842.1|2542266_2544279_-	hypothetical protein	NA	A0A2I7QW93	Vibrio_phage	36.7	2.9e-97
AVQ76843.1|2544278_2545730_-	hypothetical protein	NA	A0A2H4FND5	Salmonella_phage	61.0	7.5e-148
AVQ76844.1|2545740_2546433_-	hypothetical protein	NA	A5VW66	Enterobacteria_phage	99.6	2.5e-117
AVQ76845.1|2546435_2546891_-	hypothetical protein	NA	A5VW67	Enterobacteria_phage	100.0	1.4e-87
AVQ76846.1|2546890_2547592_-	hypothetical protein	NA	A5VW68	Enterobacteria_phage	100.0	3.2e-120
AVQ76847.1|2547591_2549010_-	hypothetical protein	NA	A5VW69	Enterobacteria_phage	100.0	4.2e-276
AVQ76848.1|2549019_2549481_-	hypothetical protein	NA	A5VW70	Enterobacteria_phage	100.0	7.1e-84
AVQ76849.1|2549461_2549650_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
AVQ76850.1|2549691_2550945_-	hypothetical protein	NA	A5VW72	Enterobacteria_phage	99.0	3.1e-235
AVQ76851.1|2550963_2551509_-	hypothetical protein	NA	A5VW73	Enterobacteria_phage	100.0	9.6e-80
AVQ76852.1|2551633_2552380_-	putative DNA replication protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AVQ76853.1|2552394_2553936_-	hypothetical protein	NA	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AVQ76854.1|2554050_2554443_-	hypothetical protein	NA	A5VW73	Enterobacteria_phage	100.0	1.5e-39
AVQ76855.1|2554533_2556732_-	hypothetical protein	NA	A5VW74	Enterobacteria_phage	100.0	0.0e+00
AVQ76856.1|2556733_2558149_-	hypothetical protein	NA	A5VW75	Enterobacteria_phage	100.0	3.1e-279
AVQ76857.1|2558145_2558586_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
AVQ76858.1|2558588_2558831_-	hypothetical protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AVQ76859.1|2559058_2559601_-	hypothetical protein	NA	A5VW78	Enterobacteria_phage	100.0	1.4e-99
AVQ76860.1|2559806_2559950_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	8.4e-20
AVQ76861.1|2559946_2560384_-	putative murein endopeptidase	NA	A5VW79	Enterobacteria_phage	100.0	2.0e-72
AVQ76862.1|2560380_2560857_-	hypothetical protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
AVQ76863.1|2560840_2561164_-	hypothetical protein	NA	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AVQ76864.1|2561760_2562279_-	hypothetical protein	NA	A5VW83	Enterobacteria_phage	99.4	3.4e-95
AVQ76865.1|2562275_2562464_-	hypothetical protein	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
AVQ76866.1|2562460_2562823_-	endodeoxyribonuclease RUS (Holliday junction resolvase)	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
AVQ76867.1|2562819_2563110_-	hypothetical protein	NA	A5VW86	Enterobacteria_phage	100.0	1.0e-51
AVQ76868.1|2563109_2563832_-	hypothetical protein	NA	A5VW87	Enterobacteria_phage	100.0	5.4e-131
AVQ76869.1|2563824_2564001_-	hypothetical protein	NA	G9L691	Escherichia_phage	100.0	5.7e-26
AVQ76870.1|2563993_2564413_-	hypothetical protein	NA	A0A088CQ65	Enterobacteria_phage	73.3	5.9e-53
AVQ76871.1|2564415_2564592_-	hypothetical protein	NA	A5VW90	Enterobacteria_phage	96.6	4.3e-26
AVQ76872.1|2564588_2564999_-	hypothetical protein	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	1.1e-69
AVQ76873.1|2565010_2565196_-	hypothetical protein	NA	NA	NA	NA	NA
AVQ76874.1|2565198_2565513_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	65.6	1.9e-24
AVQ76875.1|2565628_2565835_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	95.6	6.7e-26
AVQ76876.1|2565907_2567284_-	primosome	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
AVQ76877.1|2567280_2568075_-	hypothetical protein	NA	A5VW95	Enterobacteria_phage	86.8	8.0e-144
AVQ76878.1|2568137_2568410_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
AVQ76879.1|2568432_2568726_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
AVQ76880.1|2568834_2569020_-	DNA-binding transcriptional regulator for DicB	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
AVQ76881.1|2569391_2569751_+	putative repressor protein	NA	A5VW98	Enterobacteria_phage	100.0	3.7e-64
AVQ76882.1|2570272_2570572_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	98.0	4.5e-31
AVQ76883.1|2570580_2571051_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.8e-87
AVQ76884.1|2571245_2571416_+	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	100.0	1.3e-24
AVQ76885.1|2571412_2571571_+	hypothetical protein	NA	A5VWA6	Enterobacteria_phage	100.0	2.4e-23
AVQ76886.1|2571672_2572278_+	hypothetical protein	NA	A5VWA8	Enterobacteria_phage	100.0	3.2e-108
AVQ76887.1|2572277_2572661_+	hypothetical protein	NA	A5VWA9	Enterobacteria_phage	100.0	4.7e-65
AVQ76888.1|2572684_2572981_+	hypothetical protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
AVQ76889.1|2573075_2573525_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	100.0	2.9e-74
AVQ76890.1|2573589_2573889_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	100.0	1.5e-58
AVQ76891.1|2573890_2574463_+	hypothetical protein	NA	A5VWB3	Enterobacteria_phage	100.0	4.0e-105
AVQ76892.1|2574462_2574657_+	hypothetical protein	NA	A5VWB4	Enterobacteria_phage	82.4	2.0e-24
AVQ76893.1|2574740_2575025_+	hypothetical protein	NA	A5VWB6	Enterobacteria_phage	100.0	2.4e-50
AVQ76894.1|2575097_2575265_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
AVQ76895.1|2575322_2575523_+	prophage excisionase and response regulator inhibitor	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2575597:2575613	attR	CTGCAGGGGACACCATT	NA	NA	NA	NA
>prophage 9
CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	2840523	2877229	5074586	tail,integrase	Salmonella_phage(90.0%)	46	2840356:2840401	2874452:2874497
2840356:2840401	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
AVQ77122.1|2840523_2841006_+	DNA ligase	NA	Q19UP0	Mannheimia_phage	34.3	1.6e-17
AVQ77123.1|2841319_2842420_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	3.4e-177
AVQ77124.1|2842416_2842902_-	hypothetical protein	NA	E5G6Q2	Salmonella_phage	80.6	6.3e-67
AVQ77125.1|2842898_2845976_-	hypothetical protein	NA	E5G6Q1	Salmonella_phage	62.9	0.0e+00
AVQ77126.1|2846102_2846405_-	hypothetical protein	NA	A0A1S6KZZ9	Salmonella_phage	88.0	5.9e-39
AVQ77127.1|2846459_2846975_-	hypothetical protein	NA	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
AVQ77128.1|2846984_2848157_-|tail	Putative prophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	1.6e-204
AVQ77129.1|2848291_2848894_-|tail	putative tail fiber assembly protein	tail	M1SV83	Escherichia_phage	79.9	3.6e-88
AVQ77130.1|2848893_2850519_-|tail	putative side tail fiber protein	tail	M1TAS6	Escherichia_phage	66.2	6.4e-188
AVQ77131.1|2850515_2851121_-	hypothetical protein	NA	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
AVQ77132.1|2851113_2852022_-	hypothetical protein	NA	A0A1S6KZY6	Salmonella_phage	90.4	4.6e-143
AVQ77133.1|2852008_2852368_-	hypothetical protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	4.7e-51
AVQ77134.1|2852364_2852943_-	hypothetical protein	NA	A0A1S6KZX7	Salmonella_phage	86.5	2.1e-93
AVQ77135.1|2853081_2854782_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ77136.1|2854837_2855296_-	hypothetical protein	NA	A0A1S6L001	Salmonella_phage	84.2	2.2e-61
AVQ77137.1|2855288_2855720_-	hypothetical protein	NA	E5G6N3	Salmonella_phage	91.6	4.2e-70
AVQ77138.1|2855815_2856244_-	hypothetical protein	NA	E5G6N2	Salmonella_phage	73.8	1.6e-45
AVQ77139.1|2856240_2856618_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AVQ77140.1|2856619_2857132_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.1	4.4e-87
AVQ77141.1|2857112_2857328_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AVQ77142.1|2857331_2857535_-	hypothetical protein	NA	E5G6M9	Salmonella_phage	92.5	1.4e-31
AVQ77143.1|2857534_2857999_-	hypothetical protein	NA	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
AVQ77144.1|2858094_2858745_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	94.4	2.8e-110
AVQ77145.1|2858748_2859807_-	hypothetical protein	NA	E5G6M6	Salmonella_phage	93.4	2.9e-181
AVQ77146.1|2859823_2860657_-	hypothetical protein	NA	A0A1S6KZW9	Salmonella_phage	90.6	4.1e-122
AVQ77147.1|2860799_2862566_+	hypothetical protein	NA	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
AVQ77148.1|2862565_2863600_+	hypothetical protein	NA	E5G6M3	Salmonella_phage	87.4	6.5e-170
AVQ77149.1|2863647_2865057_-	hypothetical protein	NA	NA	NA	NA	NA
AVQ77150.1|2865378_2865612_-	DNA damage-inducible protein I	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AVQ77151.1|2865622_2865811_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AVQ77152.1|2865964_2866261_-	hypothetical protein	NA	E5G6L9	Salmonella_phage	92.9	5.4e-45
AVQ77153.1|2866317_2868405_-	hypothetical protein	NA	E5G6L9	Salmonella_phage	99.0	0.0e+00
AVQ77154.1|2868401_2869259_-	DNA adenine methyltransferase	NA	E5G6L8	Salmonella_phage	95.8	2.3e-157
AVQ77155.1|2869255_2869483_-	hypothetical protein	NA	E5G6L7	Salmonella_phage	97.3	3.0e-35
AVQ77156.1|2869482_2869716_-	hypothetical protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
AVQ77157.1|2869783_2870125_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AVQ77158.1|2870147_2870372_-	hypothetical protein	NA	NA	NA	NA	NA
AVQ77159.1|2870546_2871056_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	99.4	3.4e-87
AVQ77160.1|2871088_2871331_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
AVQ77161.1|2871452_2872085_+	hypothetical protein	NA	A0A1S6KZZ7	Salmonella_phage	51.9	4.8e-59
AVQ77162.1|2872087_2873107_+|integrase	putative integrase	integrase	E5G6L0	Salmonella_phage	92.9	1.4e-185
AVQ77163.1|2873111_2874335_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	38.8	3.6e-74
AVQ77164.1|2874881_2875079_+	hypothetical protein	NA	NA	NA	NA	NA
2874452:2874497	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
AVQ77165.1|2875075_2875864_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ77166.1|2875951_2876245_-	hypothetical protein	NA	NA	NA	NA	NA
AVQ77167.1|2876455_2877229_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.2	3.6e-40
>prophage 10
CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	2880265	2915574	5074586	tail,integrase	Shigella_phage(53.19%)	52	2893254:2893271	2919491:2919508
AVQ77169.1|2880265_2880394_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	95.1	1.9e-15
AVQ77170.1|2880423_2880915_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	4.8e-06
AVQ77171.1|2880917_2881361_+	hypothetical protein	NA	A0A0F7LDZ0	Escherichia_phage	50.3	4.8e-37
AVQ77172.1|2881332_2881935_-|tail	putative tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	3.4e-94
AVQ77173.1|2881934_2882678_-	hypothetical protein	NA	O22004	Shigella_phage	92.6	3.7e-50
AVQ77174.1|2882681_2883266_-	hypothetical protein	NA	O22003	Shigella_phage	98.5	1.0e-111
AVQ77175.1|2883256_2884315_-	hypothetical protein	NA	U5P424	Shigella_phage	97.7	2.6e-198
AVQ77176.1|2884301_2884727_-	hypothetical protein	NA	U5P0R9	Shigella_phage	98.6	7.4e-80
AVQ77177.1|2884726_2885275_-	hypothetical protein	NA	Q8SBG6	Shigella_phage	98.9	5.6e-96
AVQ77178.1|2885274_2886354_-	hypothetical protein	NA	Q8SBG7	Shigella_phage	99.4	1.5e-206
AVQ77179.1|2886350_2887679_-	hypothetical protein	NA	Q8SBG8	Shigella_phage	98.6	7.2e-246
AVQ77180.1|2887739_2889575_-	hypothetical protein	NA	Q8SBG9	Shigella_phage	98.4	7.7e-307
AVQ77181.1|2889716_2889986_-	hypothetical protein	NA	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
AVQ77182.1|2889985_2890342_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
AVQ77183.1|2890341_2891838_-	hypothetical protein	NA	M1FN90	Enterobacteria_phage	95.6	4.3e-263
AVQ77184.1|2891821_2891992_-	hypothetical protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
AVQ77185.1|2892000_2892561_-	hypothetical protein	NA	S5FM61	Shigella_phage	98.9	1.5e-104
AVQ77186.1|2892557_2893064_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
AVQ77187.1|2893038_2893449_-	hypothetical protein	NA	M1FJ87	Enterobacteria_phage	96.3	1.1e-72
2893254:2893271	attL	GCGCGGTTTCCTGCCAGG	NA	NA	NA	NA
AVQ77188.1|2893445_2893769_-	hypothetical protein	NA	U5P072	Shigella_phage	99.1	1.1e-56
AVQ77189.1|2893771_2893972_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
AVQ77190.1|2894021_2895227_-	hypothetical protein	NA	U5P0G9	Shigella_phage	99.5	9.1e-224
AVQ77191.1|2895241_2895892_-	hypothetical protein	NA	U5P4H2	Shigella_phage	100.0	2.5e-119
AVQ77192.1|2895869_2897111_-	hypothetical protein	NA	U5P411	Shigella_phage	99.3	6.5e-241
AVQ77193.1|2897110_2897293_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
AVQ77194.1|2897304_2899038_-	putative DNA-binding transcriptional regulator	NA	U5P0Q5	Shigella_phage	98.6	0.0e+00
AVQ77195.1|2899034_2899529_-	hypothetical protein	NA	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
AVQ77196.1|2899654_2900005_-	hypothetical protein	NA	M1FQV2	Enterobacteria_phage	95.7	3.4e-62
AVQ77197.1|2900107_2900548_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ77198.1|2900654_2900906_-	hypothetical protein	NA	NA	NA	NA	NA
AVQ77199.1|2900976_2901414_-	putative murein endopeptidase	NA	K7P710	Enterobacteria_phage	92.3	5.3e-65
AVQ77200.1|2901410_2901887_-	hypothetical protein	NA	K7PKV2	Enterobacteria_phage	93.0	2.8e-83
AVQ77201.1|2902329_2902665_-	hypothetical protein	NA	NA	NA	NA	NA
AVQ77202.1|2902850_2903603_-	putative antitermination protein Q	NA	Q8SBE4	Shigella_phage	98.0	1.1e-134
AVQ77203.1|2903616_2904606_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	98.2	1.3e-191
AVQ77204.1|2904613_2905411_-	hypothetical protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	5.8e-150
AVQ77205.1|2905430_2905820_-	endodeoxyribonuclease RUS (Holliday junction resolvase)	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
AVQ77206.1|2905816_2906143_-	LexA DNA-binding transcriptional repressor	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
AVQ77207.1|2906139_2906793_-	putative methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	1.6e-126
AVQ77208.1|2906792_2907281_-	hypothetical protein	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
AVQ77209.1|2907283_2908225_-	putative defective phage replication protein O	NA	U5P0A0	Shigella_phage	98.4	1.3e-153
AVQ77210.1|2908234_2908573_-	hypothetical protein	NA	U5P0J9	Shigella_phage	95.5	3.9e-55
AVQ77211.1|2908569_2909121_-	putative DNA-binding transcriptional regulator	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
AVQ77212.1|2909164_2909365_-	putative DNA-binding transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
AVQ77213.1|2909455_2910130_+	putative repressor protein	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
AVQ77214.1|2910332_2910845_-	hypothetical protein	NA	NA	NA	NA	NA
AVQ77215.1|2911313_2911676_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	98.3	1.2e-59
AVQ77216.1|2911741_2912566_+	hypothetical protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AVQ77217.1|2912693_2913218_+	deoxyribonucleoside 5'-monophosphate phosphatase	NA	S5MW55	Escherichia_phage	98.3	5.4e-96
AVQ77218.1|2913326_2914193_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ77219.1|2914234_2914441_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
AVQ77220.1|2914401_2915574_+|integrase	putative integrase	integrase	I6PDJ1	Cronobacter_phage	67.5	3.3e-146
2919491:2919508	attR	CCTGGCAGGAAACCGCGC	NA	NA	NA	NA
>prophage 11
CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	2991234	2998374	5074586		Escherichia_phage(83.33%)	6	NA	NA
AVQ77299.1|2991234_2993796_+	MutHLS complex, methyl-directed mismatch repair	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.0e-31
AVQ77300.1|2993901_2994558_+	protein-tyrosine-phosphatase / phosphoprotein phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
AVQ77301.1|2994608_2995376_-	putative DNA-binding transcriptional regulator, DEOR-type	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
AVQ77302.1|2995571_2996480_+	putative dehydrogenase, with NAD(P)-binding Rossmann-fold domain	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
AVQ77303.1|2996476_2997739_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
AVQ77304.1|2997735_2998374_+	putative class II aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 12
CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	4859883	4869907	5074586	transposase	Shigella_phage(30.0%)	11	NA	NA
AVQ78999.1|4859883_4861386_-	putative ATPase	NA	A0A248XCZ8	Klebsiella_phage	44.8	1.4e-83
AVQ79000.1|4861515_4862535_-	putative alcohol dehydrogenase, Zn-dependent and NAD(P)-binding	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
AVQ79001.1|4863348_4864173_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
AVQ79002.1|4864221_4864794_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
AVQ79003.1|4864894_4865245_+|transposase	transposase ORF A, IS3 family	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
AVQ79004.1|4865164_4866316_-|transposase	transposase of IS30	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
AVQ79005.1|4866632_4867046_+|transposase	transposase	transposase	Q716C2	Shigella_phage	95.6	1.5e-61
AVQ79006.1|4867042_4867285_+	IS3 element protein InsF	NA	Q716C2	Shigella_phage	92.4	4.7e-39
AVQ79007.1|4867367_4867625_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ79008.1|4868182_4868950_-	ferric dicitrate ABC transporter - ATP binding subunit	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AVQ79009.1|4868950_4869907_-	ferric dicitrate ABC transporter - membrane subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
>prophage 13
CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	4995600	5044529	5074586	integrase,lysis	Enterobacteria_phage(46.15%)	61	4994802:4994816	5024325:5024339
4994802:4994816	attL	GCGATGGCGGAAATC	NA	NA	NA	NA
AVQ79128.1|4995600_4996815_+|integrase	putative integrase	integrase	A0A291AWU1	Escherichia_phage	99.3	1.6e-236
AVQ79129.1|4997190_4998186_-	hypothetical protein	NA	NA	NA	NA	NA
AVQ79130.1|4998753_4999374_-	hypothetical protein	NA	A5LH60	Enterobacteria_phage	95.1	2.6e-118
AVQ79131.1|4999373_4999736_-	hypothetical protein	NA	U5P092	Shigella_phage	95.8	1.3e-64
AVQ79132.1|4999726_5000263_-	deoxyribonucleoside 5'-monophosphate phosphatase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
AVQ79133.1|5000390_5001215_-	hypothetical protein	NA	U5P439	Shigella_phage	99.6	1.0e-149
AVQ79134.1|5001280_5001643_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
AVQ79135.1|5002365_5003013_-	putative HTH-type transcriptional regulator	NA	K7PKK1	Enterobacteria_phage	99.1	5.2e-117
AVQ79136.1|5003155_5003416_+	hypothetical protein	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
AVQ79137.1|5003408_5003960_+	putative DNA-binding transcriptional regulator	NA	Q8SBF4	Shigella_phage	99.5	1.7e-100
AVQ79138.1|5003956_5005108_+	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	99.2	1.6e-214
AVQ79139.1|5005104_5005329_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	4.8e-38
AVQ79140.1|5005325_5006144_+	putative defective phage replication protein O	NA	A5LH71	Enterobacteria_phage	87.8	6.2e-123
AVQ79141.1|5006146_5006635_+	hypothetical protein	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	1.4e-85
AVQ79142.1|5006634_5006961_+	LexA DNA-binding transcriptional repressor	NA	U5P451	Shigella_phage	96.3	1.1e-51
AVQ79143.1|5006957_5007347_+	endodeoxyribonuclease RUS (Holliday junction resolvase)	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	2.1e-68
AVQ79144.1|5007366_5008164_+	hypothetical protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	9.8e-150
AVQ79145.1|5008171_5009161_+	hypothetical protein	NA	S5FV02	Shigella_phage	99.4	4.7e-194
AVQ79146.1|5009174_5009927_+	putative antitermination protein Q	NA	K7PGU5	Enterobacteria_phage	96.4	1.1e-131
AVQ79147.1|5010198_5010288_-	hypothetical protein	NA	NA	NA	NA	NA
AVQ79148.1|5010342_5010555_-	cold shock protein	NA	NA	NA	NA	NA
AVQ79149.1|5010855_5011071_+	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	76.5	2.6e-25
AVQ79150.1|5011832_5012039_+|lysis	putative S lysis protein	lysis	A5LH82	Enterobacteria_phage	89.7	2.4e-28
AVQ79151.1|5012043_5012595_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	50.6	4.2e-35
AVQ79152.1|5012542_5012803_-	hypothetical protein	NA	NA	NA	NA	NA
AVQ79153.1|5012916_5013450_+	putative lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
AVQ79154.1|5013446_5013944_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ79155.1|5014304_5014520_+	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	74.3	1.6e-22
AVQ79156.1|5015194_5015368_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ79157.1|5015663_5015870_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
AVQ79158.1|5016422_5016914_+	hypothetical protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
AVQ79159.1|5016913_5019016_+	hypothetical protein	NA	K7PH40	Enterobacteria_phage	99.7	0.0e+00
AVQ79160.1|5019012_5019225_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AVQ79161.1|5019224_5020733_+	hypothetical protein	NA	K7PJP3	Enterobacteria_phage	99.8	1.6e-289
AVQ79162.1|5022789_5023113_+	hypothetical protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
AVQ79163.1|5023105_5023381_+	hypothetical protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AVQ79164.1|5023392_5023806_+	hypothetical protein	NA	A5LH33	Enterobacteria_phage	88.5	9.5e-56
AVQ79165.1|5023964_5024366_+	hypothetical protein	NA	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
5024325:5024339	attR	GCGATGGCGGAAATC	NA	NA	NA	NA
AVQ79166.1|5024376_5024502_+	hypothetical protein	NA	A5LH35	Enterobacteria_phage	100.0	4.0e-10
AVQ79167.1|5024495_5025119_+	hypothetical protein	NA	A5LH35	Enterobacteria_phage	99.5	6.1e-107
AVQ79168.1|5025179_5025566_+	hypothetical protein	NA	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
AVQ79169.1|5025586_5025904_+	hypothetical protein	NA	A5LH37	Enterobacteria_phage	100.0	1.5e-53
AVQ79170.1|5025875_5028941_+	hypothetical protein	NA	A0A291AWX1	Escherichia_phage	99.4	0.0e+00
AVQ79171.1|5028940_5029270_+	hypothetical protein	NA	A5LH39	Enterobacteria_phage	100.0	1.7e-60
AVQ79172.1|5029279_5029978_+	hypothetical protein	NA	A5LH40	Enterobacteria_phage	98.3	6.2e-132
AVQ79173.1|5030127_5030727_+	hypothetical protein	NA	A0A291AWX4	Escherichia_phage	95.5	3.7e-117
AVQ79174.1|5030723_5031272_+	hypothetical protein	NA	K7PH50	Enterobacteria_phage	98.4	1.5e-93
AVQ79175.1|5031332_5033402_+	hypothetical protein	NA	A5LH43	Enterobacteria_phage	98.8	0.0e+00
AVQ79176.1|5033702_5034809_+	hypothetical protein	NA	Q9EYE7	Enterobacteria_phage	94.3	4.3e-196
AVQ79177.1|5034876_5035476_+	hypothetical protein	NA	Q9EV15	Enterobacteria_phage	92.5	2.6e-102
AVQ79178.1|5035540_5036986_+	putative membrane protein	NA	A0A2D1UII2	Escherichia_phage	90.9	2.0e-55
AVQ79179.1|5037912_5038152_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	55.8	1.2e-15
AVQ79180.1|5038204_5038909_+	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	61.7	4.6e-58
AVQ79181.1|5038919_5039213_+	hypothetical protein	NA	NA	NA	NA	NA
AVQ79182.1|5039440_5039695_-	putative site-specific recombinase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	40.0	5.0e-07
AVQ79183.1|5039715_5040030_-	putative site-specific recombinase	NA	NA	NA	NA	NA
AVQ79184.1|5040346_5040580_-	cold shock protein, putative DNA-binding transcriptional regulator	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AVQ79185.1|5041188_5041437_-	DNA damage-inducible protein I	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
AVQ79186.1|5041656_5043243_+	peptide chain release factor RF3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
AVQ79187.1|5043635_5044241_+	hyperosmotically inducible periplasmic protein	NA	NA	NA	NA	NA
AVQ79188.1|5044367_5044529_+	uncharacterized protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 1
CP026854	Escherichia coli strain MS7163 plasmid pMS7163A, complete sequence	133843	105780	111572	133843		Shigella_phage(33.33%)	6	NA	NA
AVQ79330.1|105780_107721_-	MacAB-TolC macrolide efflux transport system - membrane subunit	NA	G9BWD6	Planktothrix_phage	39.0	3.0e-35
AVQ79331.1|107717_108899_-	MacAB-TolC macrolide efflux transport system - membrane fusion protein	NA	A0A140XAI1	Dickeya_phage	55.7	1.0e-09
AVQ79332.1|109798_110089_+	hypothetical protein	NA	Q716C2	Shigella_phage	59.3	4.8e-30
AVQ79333.1|110037_110211_+	hypothetical protein	NA	Q716C2	Shigella_phage	90.4	3.5e-20
AVQ79334.1|110358_111246_-	hypothetical protein	NA	Q6H9S3	Enterobacteria_phage	99.0	5.8e-167
AVQ79335.1|111245_111572_-	Insertion element uncharacterized 12.0 kDa protein	NA	Q6H9S4	Enterobacteria_phage	99.1	4.9e-55
