The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	270390	325998	2688408	protease,transposase	Bacillus_virus(22.22%)	49	NA	NA
AVR78186.1|270390_271398_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVR78187.1|271477_272221_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78188.1|272264_272501_-|transposase	transposase	transposase	NA	NA	NA	NA
AVR78189.1|272400_273852_-	patatin	NA	NA	NA	NA	NA
AVR78190.1|274015_274627_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
AVR80229.1|274683_275034_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AVR78191.1|275191_275725_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AVR78192.1|275793_276216_-	DUF937 domain-containing protein	NA	NA	NA	NA	NA
AVR78193.1|276409_277393_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78194.1|277559_278528_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78195.1|278621_279098_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AVR78196.1|279090_279639_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
AVR78197.1|279651_280203_-	CreA protein	NA	NA	NA	NA	NA
AVR78198.1|280400_282155_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78199.1|282420_283923_+	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	27.3	1.5e-21
AVR78200.1|283990_285880_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
AVR78201.1|285880_286918_-	NgoFVII family restriction endonuclease	NA	NA	NA	NA	NA
AVR78202.1|286914_288039_-	DNA (cytosine-5-)-methyltransferase	NA	A7XXH6	Thermus_virus	38.5	5.6e-50
AVR78203.1|288406_289786_+	DNA repair protein RadA	NA	NA	NA	NA	NA
AVR78204.1|289772_290003_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78205.1|290270_290717_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.2	2.2e-26
AVR78206.1|291054_291393_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78207.1|291519_293085_+	GMP synthase (glutamine-hydrolyzing)	NA	A0A1V0SH76	Hokovirus	31.7	1.5e-21
AVR78208.1|293596_294388_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVR80230.1|294411_294585_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78209.1|294488_295088_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78210.1|295145_296021_+	chorismate mutase	NA	NA	NA	NA	NA
AVR78211.1|296164_298750_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
AVR78212.1|298989_300258_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.3	7.6e-128
AVR78213.1|300578_301520_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
AVR80231.1|301660_302428_+	M48 family peptidase	NA	NA	NA	NA	NA
AVR78214.1|302525_302765_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AVR78215.1|302938_305701_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AVR78216.1|306306_309546_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
AVR78217.1|309885_311730_-	polymerase	NA	NA	NA	NA	NA
AVR78218.1|311726_312086_-	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
AVR78219.1|312222_312873_-	oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB	NA	NA	NA	NA	NA
AVR78220.1|313233_313728_-	NemA protein	NA	NA	NA	NA	NA
AVR78221.1|313828_314302_-	iron-sulfur cluster repair protein DnrN	NA	NA	NA	NA	NA
AVR78222.1|314536_315373_+	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
AVR78223.1|315637_316498_+	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
AVR78224.1|316494_317568_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	2.6e-28
AVR78225.1|317713_318679_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.1e-37
AVR78226.1|318742_320035_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
AVR78227.1|320031_320910_-	endonuclease	NA	NA	NA	NA	NA
AVR78228.1|321013_321667_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
AVR80232.1|321947_322667_-	SCO family protein	NA	NA	NA	NA	NA
AVR78229.1|325369_325684_+	hypothetical protein	NA	A0A1B1P773	Bacillus_phage	48.5	3.0e-17
AVR78230.1|325698_325998_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	52.1	9.4e-21
>prophage 2
CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	359517	369066	2688408	transposase	Staphylococcus_phage(16.67%)	8	NA	NA
AVR78265.1|359517_361191_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	28.8	3.9e-31
AVR78266.1|361259_362240_+	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	47.8	2.8e-45
AVR78267.1|362341_364498_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2K9L285	Tupanvirus	33.8	9.2e-09
AVR78268.1|364606_364813_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AVR80235.1|364872_365490_-	guanylate kinase	NA	A0A240FAU9	Liberibacter_phage	29.1	1.1e-12
AVR78269.1|365656_366448_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVR80236.1|366487_367048_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.9	2.6e-32
AVR78270.1|367218_369066_+	lytic murein transglycosylase	NA	A0A0S2SXL7	Bacillus_phage	38.5	6.2e-14
>prophage 3
CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	569794	630427	2688408	transposase	Staphylococcus_prophage(16.67%)	51	NA	NA
AVR78439.1|569794_570751_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.6	3.8e-31
AVR78440.1|571144_574513_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78441.1|574958_575966_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVR78442.1|576019_576259_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78443.1|576704_577265_-	hypothetical protein	NA	NA	NA	NA	NA
AVR80248.1|577383_578811_-	oxidoreductase	NA	NA	NA	NA	NA
AVR78444.1|578999_579692_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78445.1|579935_580913_+	sel1 repeat family protein	NA	NA	NA	NA	NA
AVR78446.1|582288_582978_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AVR80249.1|582974_583697_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.9	7.8e-37
AVR78447.1|584085_584568_+	hypothetical protein	NA	NA	NA	NA	NA
AVR80250.1|584743_585181_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AVR78448.1|585264_586299_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.5	1.5e-70
AVR78449.1|586503_587574_+	AI-2E family transporter	NA	NA	NA	NA	NA
AVR78450.1|587642_587816_+	ABC transporter permease	NA	NA	NA	NA	NA
AVR78451.1|587838_588555_+	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
AVR78452.1|588797_591074_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AVR78453.1|591210_592089_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AVR78454.1|592432_592630_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AVR78455.1|592890_593502_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78456.1|593637_593979_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AVR78457.1|594064_594427_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78458.1|594505_596368_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.6	2.3e-109
AVR78459.1|596564_597413_+	squalene synthase HpnD	NA	NA	NA	NA	NA
AVR78460.1|597409_598723_+	oxidoreductase	NA	NA	NA	NA	NA
AVR78461.1|599023_599743_+	KR domain-containing protein	NA	NA	NA	NA	NA
AVR78462.1|599928_600879_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.9	4.9e-63
AVR78463.1|601156_602158_-	porphobilinogen synthase	NA	NA	NA	NA	NA
AVR78464.1|602311_603037_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78465.1|603175_603442_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78466.1|603625_605167_+	MFS transporter	NA	NA	NA	NA	NA
AVR78467.1|605511_606408_+	hypothetical protein	NA	A0A1B1P773	Bacillus_phage	44.4	2.5e-53
AVR78468.1|606709_608263_-	DUF945 domain-containing protein	NA	NA	NA	NA	NA
AVR78469.1|608543_609336_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVR78470.1|609395_610805_-	MFS transporter	NA	NA	NA	NA	NA
AVR78471.1|611232_612012_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
AVR78472.1|612008_612710_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78473.1|612706_614161_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
AVR78474.1|614465_616325_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AVR78475.1|616681_617161_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
AVR78476.1|617231_617903_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
AVR78477.1|617972_618695_+	nuclease	NA	NA	NA	NA	NA
AVR78478.1|618764_620600_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
AVR78479.1|620738_621059_-	stress response protein	NA	NA	NA	NA	NA
AVR78480.1|621917_622765_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AVR78481.1|623262_623946_-	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
AVR78482.1|623986_625105_-	methyltransferase	NA	NA	NA	NA	NA
AVR78483.1|626192_626390_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78484.1|626395_627610_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AVR78485.1|628814_629662_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AVR78486.1|629701_630427_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 4
CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	635794	709475	2688408	tRNA,transposase	Pseudomonas_phage(14.29%)	50	NA	NA
AVR78490.1|635794_636642_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AVR78491.1|638038_638831_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVR78492.1|639647_640877_+	ATPase	NA	NA	NA	NA	NA
AVR78493.1|640900_642313_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78494.1|642410_643217_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AVR78495.1|643582_644152_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78496.1|644217_644700_+	hypothetical protein	NA	NA	NA	NA	NA
AVR80253.1|644849_645632_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78497.1|645744_646404_+	phosphoesterase	NA	A0A2P9FID1	Pseudomonas_phage	35.3	4.6e-28
AVR78498.1|646670_647339_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78499.1|647657_647981_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78500.1|649088_650054_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.8	8.0e-37
AVR78501.1|650099_650552_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78502.1|650499_651639_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
AVR78503.1|651635_652217_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
AVR78504.1|652661_653915_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
AVR78505.1|654063_654855_-	spermidine synthase	NA	NA	NA	NA	NA
AVR78506.1|655267_656114_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AVR78507.1|656559_657360_-	phosphatidylserine decarboxylase family protein	NA	NA	NA	NA	NA
AVR78508.1|660481_661669_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78509.1|661674_662436_+	hypothetical protein	NA	NA	NA	NA	NA
AVR80254.1|663490_664459_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	35.7	3.8e-31
AVR78510.1|664845_665259_+|transposase	transposase	transposase	NA	NA	NA	NA
AVR78511.1|665532_666498_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	2.6e-35
AVR78512.1|666559_667879_-	MFS transporter	NA	NA	NA	NA	NA
AVR80255.1|667964_668060_+	pilS cassette	NA	NA	NA	NA	NA
AVR78513.1|668220_669081_-	proline/glycine betaine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	2.1e-25
AVR78514.1|669067_669931_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVR78515.1|671425_672838_-	cell filamentation protein Fic	NA	A0A1V0E025	Clostridioides_phage	29.6	4.6e-25
AVR78516.1|674595_675675_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78517.1|675696_676143_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78518.1|676222_677164_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
AVR78519.1|677477_678269_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVR78520.1|678920_679670_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVR78521.1|679901_680150_-	CsbD family protein	NA	NA	NA	NA	NA
AVR80256.1|680278_681808_-	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
AVR78522.1|681884_682094_-	copper chaperone	NA	A0A218MNH0	uncultured_virus	62.1	7.0e-15
AVR78523.1|682526_685013_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
AVR78524.1|685020_685743_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
AVR78525.1|685739_687782_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
AVR78526.1|687803_688643_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
AVR78527.1|688657_689308_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
AVR78528.1|689893_690907_+	subtype I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
AVR78529.1|690981_691275_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
AVR78530.1|703074_703867_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVR78531.1|704870_705089_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
AVR78532.1|705155_706679_-	hypothetical protein	NA	NA	NA	NA	NA
AVR80257.1|706825_707830_-	adenosine deaminase	NA	NA	NA	NA	NA
AVR78533.1|707847_708387_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78534.1|708464_709475_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 5
CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	723859	783175	2688408	integrase,tRNA,transposase	Salmonella_phage(22.22%)	49	719175:719195	767208:767228
719175:719195	attL	ACAAAAGGTCGTCTGAAAACC	NA	NA	NA	NA
AVR78546.1|723859_725149_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AVR80259.1|725324_726647_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AVR78547.1|726649_728692_+|integrase	integrase	integrase	NA	NA	NA	NA
AVR78548.1|728693_729104_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78549.1|729189_729606_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	66.4	1.6e-50
AVR78550.1|729650_730787_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	54.1	4.3e-114
AVR80260.1|731460_732243_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78551.1|732356_733016_+	phosphoesterase	NA	A0A2P9FID1	Pseudomonas_phage	35.3	1.3e-27
AVR78552.1|733230_734037_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AVR78553.1|734109_734973_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AVR78554.1|735056_735266_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78555.1|735337_737101_-	potassium transporter	NA	NA	NA	NA	NA
AVR78556.1|737769_738735_-	TIGR03571 family LLM class oxidoreductase	NA	NA	NA	NA	NA
AVR78557.1|738914_739814_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVR78558.1|740032_741376_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	43.9	2.1e-96
AVR78559.1|742419_743214_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AVR78560.1|743390_744398_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVR78561.1|744501_746061_+	transporter	NA	NA	NA	NA	NA
AVR78562.1|746329_747991_+	MFS transporter	NA	NA	NA	NA	NA
AVR78563.1|748077_749232_+	secretion protein HlyD	NA	NA	NA	NA	NA
AVR78564.1|749218_749398_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78565.1|750496_750676_+	endonuclease	NA	NA	NA	NA	NA
AVR78566.1|751252_751447_+	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
AVR78567.1|751459_751981_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78568.1|752060_752363_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AVR78569.1|752792_753599_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AVR78570.1|754063_754885_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78571.1|755405_756221_-	HNH endonuclease	NA	G0X580	Salmonella_phage	31.1	2.8e-06
AVR78572.1|756539_760223_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AVR78573.1|761026_762154_-	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AVR78574.1|762341_763043_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
AVR80261.1|763184_764978_+	elongation factor 4	NA	A0A1B0RXH7	Streptococcus_phage	24.6	6.0e-22
AVR78575.1|764977_765997_+	signal peptidase I	NA	NA	NA	NA	NA
AVR78576.1|766309_767194_+	EamA family transporter	NA	NA	NA	NA	NA
AVR78577.1|767517_768495_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
767208:767228	attR	ACAAAAGGTCGTCTGAAAACC	NA	NA	NA	NA
AVR78578.1|768804_769956_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78579.1|770133_770931_+	ABC transporter permease	NA	NA	NA	NA	NA
AVR78580.1|770927_771623_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.8	1.9e-19
AVR78581.1|771932_772559_+	cadmium transporter	NA	NA	NA	NA	NA
AVR78582.1|772854_773952_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78583.1|774065_774503_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
AVR78584.1|774607_775381_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AVR78585.1|775644_776769_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AVR78586.1|776767_777574_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AVR78587.1|777685_779212_-	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
AVR80262.1|779427_780681_+	peptidase	NA	NA	NA	NA	NA
AVR78588.1|780766_781429_+	YecA family protein	NA	G9E3U3	Emiliania_huxleyi_virus	44.1	2.5e-05
AVR78589.1|781500_781989_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
AVR78590.1|782215_783175_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	78.5	1.2e-112
>prophage 6
CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	1005679	1098825	2688408	tRNA,holin,protease,transposase,plate	uncultured_Caudovirales_phage(29.41%)	83	NA	NA
AVR78771.1|1005679_1006526_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AVR78772.1|1007558_1007822_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	50.0	3.0e-07
AVR78773.1|1008034_1011310_+	type VI secretion protein IcmF	NA	NA	NA	NA	NA
AVR78774.1|1011309_1012935_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AVR78775.1|1012944_1014711_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVR78776.1|1014674_1015784_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVR78777.1|1015804_1016344_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AVR78778.1|1016343_1016757_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AVR78779.1|1020059_1021178_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78780.1|1021248_1022781_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AVR78781.1|1022707_1023997_-	DUF2931 domain-containing protein	NA	NA	NA	NA	NA
AVR78782.1|1024018_1024228_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AVR78783.1|1024248_1026732_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.5	4.7e-25
AVR78784.1|1030781_1031354_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78785.1|1031364_1031808_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78786.1|1031919_1032462_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78787.1|1032486_1033239_-|protease	zinc protease	protease	NA	NA	NA	NA
AVR78788.1|1033242_1035720_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	22.9	2.6e-23
AVR78789.1|1035851_1036733_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78790.1|1036782_1037664_-	DUF1911 domain-containing protein	NA	NA	NA	NA	NA
AVR78791.1|1037676_1038312_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78792.1|1038887_1039784_+	hypothetical protein	NA	A0A1B1P773	Bacillus_phage	45.6	1.0e-54
AVR78793.1|1039844_1040564_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	NA	NA	NA	NA
AVR78794.1|1041554_1042520_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.1e-37
AVR78795.1|1042547_1042835_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78796.1|1044043_1044890_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AVR78797.1|1044883_1046140_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78798.1|1048323_1049559_-	hypothetical protein	NA	NA	NA	NA	NA
AVR80272.1|1049816_1050785_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	35.7	3.8e-31
AVR78799.1|1050720_1050981_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78800.1|1051705_1052173_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78801.1|1052076_1052427_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78802.1|1052731_1053841_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78803.1|1053857_1054043_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78804.1|1054327_1055953_-	hypothetical protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.7	1.1e-25
AVR78805.1|1055954_1056668_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78806.1|1056672_1056897_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78807.1|1056926_1057718_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVR78808.1|1057841_1058681_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78809.1|1058683_1059658_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78810.1|1059678_1060500_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78811.1|1060501_1062667_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.5	9.5e-22
AVR78812.1|1063461_1063980_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVR78813.1|1064043_1064409_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78814.1|1064500_1064890_+	epimerase	NA	NA	NA	NA	NA
AVR78815.1|1064886_1065369_+	DUF2269 domain-containing protein	NA	NA	NA	NA	NA
AVR78816.1|1065409_1066249_+	epimerase	NA	NA	NA	NA	NA
AVR78817.1|1066482_1067175_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AVR78818.1|1067459_1068296_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
AVR78819.1|1068304_1068511_+|holin	choline transporter	holin	NA	NA	NA	NA
AVR78820.1|1068467_1069256_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.6	1.3e-40
AVR78821.1|1069907_1070099_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78822.1|1070519_1071500_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78823.1|1071496_1072324_-|plate	phage baseplate protein	plate	A0A0M3LQN4	Mannheimia_phage	51.6	2.6e-68
AVR78824.1|1072888_1073830_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AVR78825.1|1073836_1074568_+	cytidine deaminase	NA	NA	NA	NA	NA
AVR78826.1|1074703_1075681_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	3.1e-36
AVR78827.1|1075856_1076219_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	50.5	1.0e-16
AVR78828.1|1076424_1076988_+	serine hydrolase family protein	NA	NA	NA	NA	NA
AVR78829.1|1077092_1077908_+	squalene synthase HpnC	NA	NA	NA	NA	NA
AVR78830.1|1078225_1079635_-	sel1 repeat family protein	NA	NA	NA	NA	NA
AVR78831.1|1079862_1080294_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AVR78832.1|1080286_1080562_+	RnfH family protein	NA	NA	NA	NA	NA
AVR78833.1|1080628_1081207_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AVR78834.1|1081234_1081441_+	dioxygenase	NA	NA	NA	NA	NA
AVR78835.1|1081437_1081821_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78836.1|1081910_1082180_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	61.8	1.1e-20
AVR78837.1|1082208_1082391_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78838.1|1082364_1084827_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.7	5.4e-215
AVR78839.1|1085026_1085293_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
AVR78840.1|1085294_1085912_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
AVR78841.1|1085911_1086898_+	lipoyl synthase	NA	NA	NA	NA	NA
AVR78842.1|1087056_1088868_-	translational GTPase TypA	NA	NA	NA	NA	NA
AVR78843.1|1089502_1089967_+	bacterioferritin	NA	NA	NA	NA	NA
AVR78844.1|1089989_1090463_+	bacterioferritin	NA	NA	NA	NA	NA
AVR78845.1|1090880_1093166_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.4	6.0e-168
AVR78846.1|1093458_1094271_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	25.6	8.0e-22
AVR78847.1|1094505_1095552_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.7	4.0e-119
AVR78848.1|1095579_1095816_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78849.1|1095885_1096926_-	oxidoreductase	NA	NA	NA	NA	NA
AVR78850.1|1097044_1097416_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
AVR78851.1|1097498_1097909_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78852.1|1097910_1098825_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 7
CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	1126846	1134448	2688408	protease	Pseudomonas_phage(16.67%)	9	NA	NA
AVR78876.1|1126846_1127149_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.1	5.9e-15
AVR80277.1|1127268_1128402_-	ribonucleotide-diphosphate reductase subunit beta	NA	W6AT53	Erwinia_phage	75.1	2.0e-164
AVR78877.1|1128620_1129577_-|protease	CAAX protease	protease	A3QSC6	Clostridium_virus	31.2	4.1e-25
AVR78878.1|1129579_1131859_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	68.4	4.2e-312
AVR78879.1|1132216_1132723_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
AVR78880.1|1132805_1133027_+	ribosome alternative rescue factor ArfA	NA	NA	NA	NA	NA
AVR78881.1|1132986_1133307_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	4.8e-23
AVR78882.1|1133371_1133617_-	recombinase RecA	NA	NA	NA	NA	NA
AVR78883.1|1134061_1134448_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	1.9e-53
>prophage 8
CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	1243701	1301747	2688408	tRNA,transposase	Bacillus_phage(16.67%)	53	NA	NA
AVR78974.1|1243701_1244838_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	54.1	4.3e-114
AVR78975.1|1244882_1245299_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	66.4	1.6e-50
AVR80283.1|1245501_1247949_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AVR78976.1|1248314_1249472_-	sugar transporter	NA	NA	NA	NA	NA
AVR78977.1|1249607_1249985_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78978.1|1250117_1251368_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.5e-99
AVR78979.1|1251531_1252437_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
AVR78980.1|1252669_1253164_-	thiol peroxidase	NA	NA	NA	NA	NA
AVR78981.1|1253316_1253691_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
AVR78982.1|1253933_1255241_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
AVR78983.1|1255233_1255668_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78984.1|1255810_1256650_+	hypothetical protein	NA	NA	NA	NA	NA
AVR78985.1|1256771_1258154_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.2	5.6e-52
AVR78986.1|1258306_1258735_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78987.1|1259051_1260827_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
AVR78988.1|1260884_1261562_-	hypothetical protein	NA	NA	NA	NA	NA
AVR78989.1|1261710_1264851_+	cell division protein FtsK	NA	G1FGP1	Mycobacterium_phage	48.6	1.5e-84
AVR78990.1|1265050_1265527_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AVR78991.1|1265760_1267881_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
AVR78992.1|1268118_1268985_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	36.3	1.1e-50
AVR80284.1|1269152_1270013_-	calcium-binding protein	NA	NA	NA	NA	NA
AVR78993.1|1271097_1271961_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.3	3.8e-38
AVR80285.1|1272504_1272753_-	glutaredoxin family protein	NA	NA	NA	NA	NA
AVR78994.1|1272916_1273117_-	bacterioferritin	NA	NA	NA	NA	NA
AVR78995.1|1273365_1274241_-	site-specific tyrosine recombinase XerD	NA	A0A1P8DJJ6	Virus_Rctr41k	29.7	2.5e-13
AVR78996.1|1274411_1274849_-	peroxiredoxin	NA	NA	NA	NA	NA
AVR78997.1|1274958_1275594_-	deoxynucleoside kinase	NA	NA	NA	NA	NA
AVR78998.1|1275815_1276313_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AVR78999.1|1276328_1276703_-	SirB family protein	NA	NA	NA	NA	NA
AVR79000.1|1276755_1277325_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	45.3	8.5e-39
AVR79001.1|1277406_1277697_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
AVR79002.1|1277744_1277942_+	hypothetical protein	NA	NA	NA	NA	NA
AVR80286.1|1278065_1279523_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AVR79003.1|1280104_1280734_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79004.1|1280734_1282030_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AVR79005.1|1282843_1283635_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVR79006.1|1284099_1285023_+	pseudouridine synthase	NA	NA	NA	NA	NA
AVR79007.1|1285127_1286621_-	cardiolipin synthase	NA	NA	NA	NA	NA
AVR79008.1|1286926_1287988_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
AVR79009.1|1288109_1289333_-	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
AVR80287.1|1289329_1290697_-	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
AVR79010.1|1290830_1291565_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AVR79011.1|1291845_1292142_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AVR79012.1|1292157_1293117_-	DNA-binding protein	NA	A0A1V0SF83	Hokovirus	24.7	8.8e-12
AVR79013.1|1293263_1293659_-	hypothetical protein	NA	NA	NA	NA	NA
AVR80288.1|1293878_1294952_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
AVR79014.1|1295081_1295564_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AVR79015.1|1295627_1296032_+|transposase	transposase	transposase	NA	NA	NA	NA
AVR79016.1|1295935_1296832_+	hypothetical protein	NA	A0A1B1P773	Bacillus_phage	44.8	1.8e-54
AVR79017.1|1297159_1297528_+	hypothetical protein	NA	NA	NA	NA	NA
AVR80289.1|1298086_1299055_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	35.7	6.6e-31
AVR79018.1|1299322_1300588_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79019.1|1300900_1301747_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	1323805	1366540	2688408	protease,transposase	Bacillus_phage(14.29%)	41	NA	NA
AVR79037.1|1323805_1324702_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.1	3.3e-53
AVR79038.1|1324873_1325653_+	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	24.3	5.0e-13
AVR79039.1|1326155_1326947_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVR79040.1|1327068_1327239_-	rubredoxin	NA	NA	NA	NA	NA
AVR79041.1|1327324_1328413_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVR79042.1|1328567_1329116_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AVR79043.1|1329381_1331073_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
AVR79044.1|1331618_1332944_+	MFS transporter	NA	NA	NA	NA	NA
AVR79045.1|1333487_1337321_+	FAD-linked oxidase	NA	NA	NA	NA	NA
AVR79046.1|1337700_1339362_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
AVR80290.1|1339491_1340073_-	peptidase C39	NA	NA	NA	NA	NA
AVR80291.1|1340215_1340374_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79047.1|1340580_1340958_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79048.1|1341015_1341381_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79049.1|1341610_1342024_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79050.1|1342073_1342526_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79051.1|1342566_1343436_-	meta-pathway of phenol degradation family protein	NA	NA	NA	NA	NA
AVR79052.1|1343668_1344568_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVR79053.1|1345167_1346175_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVR79054.1|1346171_1346357_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79055.1|1346349_1347936_-	cell division protein FtsK	NA	G1FGP1	Mycobacterium_phage	38.2	2.3e-33
AVR79056.1|1347951_1349997_-	DNA sulfur modification protein DndD	NA	NA	NA	NA	NA
AVR79057.1|1349999_1350218_-	hypothetical protein	NA	NA	NA	NA	NA
AVR80292.1|1350186_1351332_-	DNA phosphorothioation system sulfurtransferase DndC	NA	NA	NA	NA	NA
AVR79058.1|1351398_1351650_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVR79059.1|1351646_1351925_+	hypothetical protein	NA	NA	NA	NA	NA
AVR80293.1|1352008_1352977_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	35.7	6.6e-31
AVR79060.1|1352912_1353107_+	hypothetical protein	NA	NA	NA	NA	NA
AVR79061.1|1353856_1354648_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AVR79062.1|1355077_1356496_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
AVR79063.1|1356869_1357598_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AVR79064.1|1358115_1358913_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AVR79065.1|1359122_1360526_-	DNA polymerase III subunit epsilon	NA	A0A1P8VWC8	Flavobacterium_phage	34.9	1.1e-15
AVR79066.1|1361036_1361654_+	hemolysin III	NA	NA	NA	NA	NA
AVR79067.1|1361772_1362666_+	EamA family transporter	NA	NA	NA	NA	NA
AVR79068.1|1362689_1363049_+	STAS/SEC14 domain-containing protein	NA	NA	NA	NA	NA
AVR79069.1|1363091_1363343_-	branched-chain amino acid ABC transporter	NA	NA	NA	NA	NA
AVR79070.1|1363425_1363629_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	78.8	3.4e-22
AVR79071.1|1363695_1363962_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79072.1|1363941_1364253_+|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
AVR79073.1|1364254_1366540_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	8.7e-167
>prophage 10
CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	1868785	1933257	2688408	tRNA,protease,transposase	Wolbachia_phage(15.38%)	55	NA	NA
AVR79508.1|1868785_1869790_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AVR79509.1|1869913_1871095_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
AVR79510.1|1871181_1872513_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AVR79511.1|1872686_1873217_+	hypothetical protein	NA	NA	NA	NA	NA
AVR79512.1|1873580_1877186_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
AVR79513.1|1877462_1878989_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
AVR80312.1|1879510_1881022_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4QMK7	Micromonas_pusilla_virus	32.9	6.6e-38
AVR79514.1|1881169_1882261_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
AVR79515.1|1882638_1884513_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	39.9	2.5e-55
AVR79516.1|1884573_1885869_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	43.8	3.9e-87
AVR80313.1|1885936_1887106_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79517.1|1887675_1888116_-	prepilin-type cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AVR79518.1|1888219_1888666_-	prepilin-type cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AVR79519.1|1889891_1891934_-	DNA helicase RecG	NA	NA	NA	NA	NA
AVR79520.1|1892388_1893504_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AVR79521.1|1893687_1897170_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AVR79522.1|1897296_1899009_-	flotillin	NA	NA	NA	NA	NA
AVR80314.1|1899164_1900133_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	35.4	5.0e-31
AVR79523.1|1900212_1900482_-	hypothetical protein	NA	NA	NA	NA	NA
AVR80315.1|1900814_1901798_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	35.4	5.1e-31
AVR79524.1|1901718_1901979_+	hypothetical protein	NA	NA	NA	NA	NA
AVR79525.1|1901866_1902424_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79526.1|1902505_1903171_-	DUF1449 domain-containing protein	NA	NA	NA	NA	NA
AVR79527.1|1903398_1903881_-	peroxiredoxin	NA	NA	NA	NA	NA
AVR79528.1|1903949_1904177_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79529.1|1904309_1904654_+	hypothetical protein	NA	NA	NA	NA	NA
AVR79530.1|1904703_1905153_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
AVR79531.1|1905276_1905804_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79532.1|1905912_1906575_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79533.1|1906617_1907379_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79534.1|1907460_1907751_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79535.1|1907860_1908625_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79536.1|1908752_1909253_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79537.1|1909320_1909506_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79538.1|1909496_1910939_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AVR79539.1|1911103_1913377_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
AVR79540.1|1913522_1914590_+	addiction module protein	NA	D7RWK9	Brochothrix_phage	30.7	6.8e-29
AVR79541.1|1914866_1915874_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVR79542.1|1916008_1916284_+	hypothetical protein	NA	NA	NA	NA	NA
AVR79543.1|1916337_1917180_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AVR79544.1|1917372_1918041_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79545.1|1918372_1918711_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	52.8	7.6e-27
AVR79546.1|1918919_1919612_-	phage repressor protein C	NA	A5X9F5	Aeromonas_virus	37.4	5.2e-30
AVR79547.1|1919906_1920185_+	hypothetical protein	NA	NA	NA	NA	NA
AVR79548.1|1920644_1922954_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.4	2.6e-86
AVR79549.1|1923118_1924708_+	sensor histidine kinase	NA	NA	NA	NA	NA
AVR79550.1|1924700_1926305_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AVR79551.1|1926536_1927139_-	DUF4112 domain-containing protein	NA	NA	NA	NA	NA
AVR79552.1|1927522_1928590_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.1	2.1e-102
AVR79553.1|1928661_1929528_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.3	5.5e-106
AVR79554.1|1929680_1930532_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.4	2.2e-30
AVR79555.1|1931256_1931505_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AVR79556.1|1931707_1932241_+	isochorismatase	NA	NA	NA	NA	NA
AVR79557.1|1932259_1932757_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVR79558.1|1932840_1933257_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	45.5	1.7e-20
>prophage 11
CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	1938933	2010497	2688408	tRNA,transposase	Staphylococcus_prophage(16.67%)	54	NA	NA
AVR79563.1|1938933_1939726_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVR79564.1|1940060_1940372_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79565.1|1941370_1942162_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVR79566.1|1942696_1944325_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AVR79567.1|1944622_1945660_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AVR79568.1|1945879_1947211_+	MFS transporter	NA	NA	NA	NA	NA
AVR79569.1|1947378_1949487_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AVR79570.1|1949815_1950631_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVR80316.1|1953121_1954354_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79571.1|1954489_1955092_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
AVR79572.1|1955207_1955861_-	acetyltransferase	NA	NA	NA	NA	NA
AVR79573.1|1957640_1958051_+	DedA family protein	NA	NA	NA	NA	NA
AVR79574.1|1958155_1959349_+	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AVR79575.1|1959480_1960272_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AVR79576.1|1960296_1961100_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AVR79577.1|1961251_1962044_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AVR79578.1|1962040_1963024_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.3e-37
AVR79579.1|1963628_1964708_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
AVR79580.1|1964887_1965931_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AVR79581.1|1966246_1967041_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVR80317.1|1966997_1967228_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79582.1|1967491_1968457_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	4.4e-35
AVR80318.1|1968588_1969347_-	iron ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.8	8.8e-15
AVR79583.1|1969418_1970042_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79584.1|1970100_1971966_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	34.2	4.8e-54
AVR79585.1|1972127_1973126_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AVR80319.1|1973115_1974090_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	37.5	9.8e-51
AVR79586.1|1974523_1975291_+	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
AVR79587.1|1975505_1976306_-	cytochrome c1	NA	NA	NA	NA	NA
AVR79588.1|1976305_1977829_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
AVR79589.1|1977847_1978429_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AVR79590.1|1978551_1979301_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AVR79591.1|1979531_1980470_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVR79592.1|1980714_1981251_+	phenylphosphate carboxylase subunit delta	NA	A0A140XBD6	Dickeya_phage	44.4	6.0e-26
AVR79593.1|1981247_1981829_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AVR79594.1|1981809_1982340_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
AVR79595.1|1982432_1983167_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	2.0e-24
AVR79596.1|1983411_1984764_+	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AVR79597.1|1984830_1985145_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AVR79598.1|1985328_1986176_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AVR79599.1|1986596_1987037_+	hypothetical protein	NA	NA	NA	NA	NA
AVR79600.1|1987256_1988000_-	ABC transporter ATP-binding protein	NA	M1HS04	Acanthocystis_turfacea_Chlorella_virus	31.2	1.5e-11
AVR79601.1|1988001_1988934_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AVR79602.1|1989161_1989950_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVR79603.1|1991777_1994570_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.1	1.0e-76
AVR79604.1|1994807_1996136_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
AVR79605.1|1996339_1996747_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79606.1|1996959_1998243_+	glutamate-1-semialdehyde-2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	27.4	1.5e-11
AVR79607.1|1998499_1999432_-	autotransporter	NA	NA	NA	NA	NA
AVR80320.1|2000597_2003621_+	outer membrane insertion C- signal	NA	A0A2L1IV32	Escherichia_phage	64.1	3.4e-17
AVR79608.1|2004172_2005180_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVR79609.1|2005380_2006187_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AVR79610.1|2007056_2008370_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.3	4.8e-61
AVR79611.1|2009489_2010497_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 12
CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	2377031	2445911	2688408	tRNA,transposase	Bacillus_phage(15.0%)	60	NA	NA
AVR79947.1|2377031_2378009_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	3.1e-36
AVR79948.1|2378188_2379262_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79949.1|2380146_2380338_+	hypothetical protein	NA	NA	NA	NA	NA
AVR79950.1|2380697_2382170_+	pyruvate kinase	NA	NA	NA	NA	NA
AVR79951.1|2382228_2383194_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	4.0e-36
AVR79952.1|2383335_2384133_-	hypothetical protein	NA	A0A1B1P773	Bacillus_phage	44.4	2.9e-53
AVR79953.1|2384135_2384594_-|transposase	transposase	transposase	NA	NA	NA	NA
AVR79954.1|2384641_2385280_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79955.1|2385501_2386029_+	hypothetical protein	NA	NA	NA	NA	NA
AVR79956.1|2386255_2387263_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVR79957.1|2387500_2388193_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79958.1|2388372_2389620_-	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AVR79959.1|2389795_2390032_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	43.8	7.7e-10
AVR79960.1|2390967_2392419_+	TIGR00341 family protein	NA	NA	NA	NA	NA
AVR79961.1|2392472_2394389_-	bifunctional aminodeoxychorismate synthase component I/aminodeoxychorismate lyase	NA	S4VT78	Pandoravirus	29.1	1.5e-34
AVR79962.1|2394555_2395485_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
AVR79963.1|2395582_2396446_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AVR79964.1|2396793_2398614_+	putative heme utilization radical SAM enzyme HutW	NA	NA	NA	NA	NA
AVR79965.1|2399687_2400308_+	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
AVR79966.1|2400694_2401975_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7RVP5	Clostridium_phage	44.4	3.7e-05
AVR80343.1|2402255_2402759_+	peptide deformylase	NA	A0A2I7S809	Vibrio_phage	34.7	3.4e-15
AVR79967.1|2402902_2403829_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	29.9	7.5e-08
AVR79968.1|2403962_2404484_+	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	53.8	7.1e-40
AVR79969.1|2404601_2404886_-	peptidase	NA	NA	NA	NA	NA
AVR79970.1|2405163_2406423_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
AVR79971.1|2406388_2406982_+	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
AVR79972.1|2406985_2409109_+	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	23.7	9.4e-06
AVR79973.1|2409101_2410385_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AVR79974.1|2410762_2411983_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.0	1.2e-29
AVR79975.1|2412008_2412464_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AVR79976.1|2412548_2414855_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	40.2	9.0e-111
AVR80344.1|2414926_2415622_-	hypothetical protein	NA	NA	NA	NA	NA
AVR79977.1|2415811_2416033_-	hypothetical protein	NA	NA	NA	NA	NA
AVR80345.1|2415940_2416162_+	hypothetical protein	NA	NA	NA	NA	NA
AVR79978.1|2416303_2416870_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
AVR79979.1|2416991_2417243_+	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	56.8	1.3e-20
AVR79980.1|2417662_2418847_+	elongation factor Tu	NA	A0A1V0SC62	Catovirus	32.0	6.6e-09
AVR79981.1|2419048_2419321_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
AVR79982.1|2419323_2419857_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
AVR79983.1|2419963_2420398_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
AVR79984.1|2420397_2421093_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
AVR79985.1|2421158_2421302_+	hypothetical protein	NA	NA	NA	NA	NA
AVR79986.1|2421319_2421820_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
AVR79987.1|2421878_2422250_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
AVR79988.1|2422438_2426617_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.3	1.3e-22
AVR80346.1|2426581_2426734_-	histidine kinase	NA	NA	NA	NA	NA
AVR79989.1|2426782_2430958_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.1	4.5e-76
AVR79990.1|2431309_2431681_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
AVR79991.1|2431798_2432269_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
AVR79992.1|2432287_2434393_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.4	1.8e-57
AVR79993.1|2434484_2435669_+	elongation factor Tu	NA	A0A1V0SC62	Catovirus	32.0	6.6e-09
AVR79994.1|2435686_2435998_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
AVR80347.1|2436311_2437099_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AVR79995.1|2437612_2437801_+	hypothetical protein	NA	NA	NA	NA	NA
AVR79996.1|2437824_2439720_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
AVR79997.1|2439860_2441216_+	sel1 repeat family protein	NA	NA	NA	NA	NA
AVR79998.1|2441994_2442411_+	hypothetical protein	NA	NA	NA	NA	NA
AVR79999.1|2442596_2443055_+	hypothetical protein	NA	NA	NA	NA	NA
AVR80348.1|2443188_2444673_+	NTPase	NA	R9TRQ8	Vibrio_phage	31.5	7.2e-13
AVR80000.1|2445281_2445911_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.2	3.7e-43
>prophage 13
CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	2519896	2599909	2688408	transposase	Vibrio_phage(28.57%)	60	NA	NA
AVR80070.1|2519896_2520703_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AVR80071.1|2520866_2521841_-	hypothetical protein	NA	NA	NA	NA	NA
AVR80072.1|2522470_2523511_-	S-adenosyl-L-methionine-dependent methyltransferase	NA	NA	NA	NA	NA
AVR80073.1|2523983_2524439_+	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
AVR80074.1|2524435_2525389_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	NA	NA	NA	NA
AVR80075.1|2525444_2525708_+	cell division protein FtsL	NA	NA	NA	NA	NA
AVR80076.1|2525789_2527538_+	penicillin-binding protein	NA	NA	NA	NA	NA
AVR80077.1|2527562_2529041_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AVR80078.1|2529228_2529750_+	M23 family peptidase	NA	NA	NA	NA	NA
AVR80079.1|2529774_2530635_+	peptidase	NA	NA	NA	NA	NA
AVR80080.1|2530675_2531407_+	hypothetical protein	NA	NA	NA	NA	NA
AVR80081.1|2531457_2532825_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
AVR80082.1|2532827_2533016_+	hypothetical protein	NA	NA	NA	NA	NA
AVR80083.1|2533211_2534294_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AVR80084.1|2534457_2535117_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
AVR80085.1|2535113_2536241_-	oxidoreductase	NA	NA	NA	NA	NA
AVR80086.1|2536391_2536745_+	hypothetical protein	NA	NA	NA	NA	NA
AVR80087.1|2536818_2537703_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVR80088.1|2537717_2538197_+	hypothetical protein	NA	NA	NA	NA	NA
AVR80089.1|2538209_2538905_+	LrgB family protein	NA	NA	NA	NA	NA
AVR80090.1|2539214_2541407_-	tyrosine protein kinase	NA	NA	NA	NA	NA
AVR80354.1|2541455_2541902_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
AVR80091.1|2542061_2543195_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
AVR80092.1|2543286_2545179_-	nucleoside-diphosphate sugar epimerase	NA	A0A1V0SAI8	Catovirus	29.1	2.3e-19
AVR80093.1|2545374_2546550_-	aminotransferase	NA	A0A2K9L0G1	Tupanvirus	49.9	5.4e-104
AVR80094.1|2546542_2547325_-	formyl transferase	NA	NA	NA	NA	NA
AVR80095.1|2547372_2548059_-	HAD family hydrolase	NA	NA	NA	NA	NA
AVR80096.1|2548045_2549020_-	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
AVR80097.1|2549006_2549624_-	sugar transferase	NA	NA	NA	NA	NA
AVR80098.1|2549616_2550789_-	hypothetical protein	NA	NA	NA	NA	NA
AVR80099.1|2550803_2551877_-	hypothetical protein	NA	NA	NA	NA	NA
AVR80100.1|2551890_2553168_-	hypothetical protein	NA	NA	NA	NA	NA
AVR80101.1|2553337_2554756_-	hypothetical protein	NA	NA	NA	NA	NA
AVR80102.1|2554920_2556228_-	nucleotide sugar dehydrogenase	NA	M1HEP0	Acanthocystis_turfacea_Chlorella_virus	31.8	2.0e-43
AVR80103.1|2556653_2557310_-	histidine kinase	NA	NA	NA	NA	NA
AVR80104.1|2557430_2558321_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVR80105.1|2558317_2558596_+	hypothetical protein	NA	NA	NA	NA	NA
AVR80106.1|2558764_2559385_+	hypothetical protein	NA	NA	NA	NA	NA
AVR80107.1|2559450_2559654_+	hypothetical protein	NA	NA	NA	NA	NA
AVR80108.1|2560128_2573916_+	hypothetical protein	NA	NA	NA	NA	NA
AVR80109.1|2574112_2575114_-	hypothetical protein	NA	NA	NA	NA	NA
AVR80110.1|2575400_2576723_+	peptidase M23	NA	A8ATH6	Listeria_phage	52.3	2.5e-25
AVR80111.1|2578587_2579380_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVR80112.1|2579648_2580332_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	61.8	3.9e-62
AVR80113.1|2580407_2580881_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	68.3	1.1e-50
AVR80114.1|2581393_2581888_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVR80115.1|2581938_2583387_+	hypothetical protein	NA	NA	NA	NA	NA
AVR80116.1|2584126_2585134_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AVR80117.1|2585391_2587791_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
AVR80118.1|2587937_2589047_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
AVR80119.1|2589048_2589663_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
AVR80120.1|2589663_2590350_+	pilus assembly protein PilO	NA	NA	NA	NA	NA
AVR80121.1|2590367_2590922_+	pilin assembly protein	NA	NA	NA	NA	NA
AVR80122.1|2590940_2593076_+	type IV pilus secretin PilQ	NA	R9TEZ5	Vibrio_phage	22.9	4.5e-16
AVR80123.1|2593242_2594089_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AVR80124.1|2594301_2594718_+	DNA modification methylase	NA	NA	NA	NA	NA
AVR80125.1|2595426_2596274_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AVR80126.1|2597215_2597764_+	shikimate kinase	NA	NA	NA	NA	NA
AVR80127.1|2597959_2599039_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
AVR80355.1|2599116_2599909_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
