The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	0	46299	4815114	portal,tail,capsid,head,plate	Salmonella_phage(80.0%)	62	NA	NA
AVS04956.1|534_2304_-	OLD family endonuclease	NA	NA	NA	NA	NA
AVS04957.1|2347_3286_-	Repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	40.2	1.8e-33
AVS04958.1|3373_3595_+	regulator	NA	NA	NA	NA	NA
AVS04959.1|3627_4137_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AVS09362.1|4144_4345_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	2.1e-32
AVS04960.1|4308_4650_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AVS04961.1|4717_4951_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	96.1	7.0e-32
AVS04962.1|4950_5178_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
AVS04963.1|5174_6032_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	1.9e-159
AVS04964.1|6028_8443_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.1	0.0e+00
AVS04965.1|8595_8784_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
AVS04966.1|8722_9028_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AVS04967.1|9220_9556_-	hypothetical protein	NA	NA	NA	NA	NA
AVS04968.1|9827_10070_+	hypothetical protein	NA	NA	NA	NA	NA
AVS04969.1|10066_10888_+	hypothetical protein	NA	NA	NA	NA	NA
AVS04970.1|10889_11645_+	hypothetical protein	NA	S5W9H2	Leptospira_phage	38.0	3.7e-05
AVS04971.1|11663_12695_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.5	1.7e-170
AVS04972.1|12694_14461_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AVS04973.1|14603_15437_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	90.3	2.4e-122
AVS04974.1|15453_16512_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
AVS04975.1|16515_17166_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	95.3	9.6e-111
AVS04976.1|17261_17726_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
AVS04977.1|17725_17929_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	91.0	6.8e-31
AVS04978.1|17932_18148_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AVS09363.1|18167_18641_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	2.2e-80
AVS04979.1|18642_19020_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	38.4	1.1e-15
AVS04980.1|19016_19445_+	hypothetical protein	NA	E5G6N2	Salmonella_phage	75.9	2.4e-46
AVS04981.1|19374_19578_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	1.0e-23
AVS04982.1|19540_19972_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	2.9e-71
AVS04983.1|19964_20411_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.8	6.9e-60
AVS04984.1|20388_21549_-	hypothetical protein	NA	NA	NA	NA	NA
AVS04985.1|21625_22204_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
AVS04986.1|22200_22560_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
AVS04987.1|22546_23455_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	2.0e-143
AVS04988.1|23447_24053_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
AVS04989.1|24049_25465_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.7	1.2e-153
AVS04990.1|25473_25869_+|tail	phage tail protein	tail	A0A0M4S6V4	Salmonella_phage	56.1	6.0e-15
AVS04991.1|25840_26278_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	67.6	3.8e-47
AVS09364.1|26279_26666_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVS04992.1|26696_27263_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AVS04993.1|27405_28578_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	4.6e-204
AVS04994.1|28587_29103_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
AVS04995.1|29157_29460_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AVS04996.1|29474_29594_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AVS04997.1|29586_32664_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.8	0.0e+00
AVS04998.1|32660_33146_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	3.7e-67
AVS04999.1|33142_34243_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	86.3	1.2e-177
AVS05000.1|34333_34552_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AVS05001.1|34787_36473_-	transporter	NA	NA	NA	NA	NA
AVS05002.1|36742_37120_+	hypothetical protein	NA	NA	NA	NA	NA
AVS05003.1|37149_37407_-	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
AVS05004.1|37566_37854_+	hypothetical protein	NA	NA	NA	NA	NA
AVS05005.1|37837_38560_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AVS05006.1|38620_39523_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
AVS05007.1|39610_40087_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
AVS05008.1|40292_40454_+	putrescine/spermidine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS05009.1|40437_41550_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AVS05010.1|41644_42778_+	putrescine transport ATP-binding protein PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
AVS05011.1|42787_43741_+	putrescine ABC transporter permease	NA	NA	NA	NA	NA
AVS05012.1|43737_44583_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AVS05013.1|44642_45131_+	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AVS05014.1|45171_46299_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
>prophage 2
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	49659	52397	4815114		Planktothrix_phage(50.0%)	4	NA	NA
AVS05019.1|49659_50388_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
AVS05020.1|50605_51121_-	lipoprotein	NA	NA	NA	NA	NA
AVS05021.1|51246_51570_+	hypothetical protein	NA	NA	NA	NA	NA
AVS05022.1|51566_52397_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 3
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	55984	57703	4815114		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
AVS05025.1|55984_57703_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.9	2.3e-31
>prophage 4
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	67000	90685	4815114	protease,tRNA	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
AVS05033.1|67000_68947_+	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
AVS05034.1|69019_69244_-	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AVS05035.1|69566_69887_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.3	5.9e-13
AVS05036.1|69917_72194_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AVS05037.1|72878_73097_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AVS05038.1|73381_74086_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVS05039.1|74127_75849_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
AVS05040.1|75849_77616_-	ATP-binding/permease CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
AVS05041.1|77738_78704_-	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
AVS05042.1|79248_79743_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AVS05043.1|79877_83867_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AVS05044.1|84025_84637_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AVS05045.1|84647_85991_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AVS05046.1|86081_87374_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AVS05047.1|87612_90057_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
AVS05048.1|90067_90685_+	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 5
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	96993	100208	4815114		Tetraselmis_virus(100.0%)	2	NA	NA
AVS05055.1|96993_97734_-	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
AVS05056.1|97925_100208_-	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 6
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	104306	105395	4815114		Streptococcus_phage(100.0%)	1	NA	NA
AVS05060.1|104306_105395_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 7
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	110481	115022	4815114		Bacillus_phage(100.0%)	2	NA	NA
AVS05065.1|110481_110766_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
AVS05066.1|113273_115022_+	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 8
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	129727	140697	4815114	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
AVS09366.1|129727_130276_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
AVS05078.1|130302_130950_+	hypothetical protein	NA	NA	NA	NA	NA
AVS05079.1|131171_132362_-	aspartate aminotransferase	NA	NA	NA	NA	NA
AVS05080.1|132546_133635_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
AVS05081.1|134237_135638_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
AVS05082.1|135806_137009_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AVS05083.1|137274_139887_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
AVS05084.1|139929_140697_-	aliphatic sulfonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 9
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	156617	158525	4815114		Tupanvirus(100.0%)	1	NA	NA
AVS05099.1|156617_158525_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
>prophage 10
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	171124	173179	4815114		Bacillus_phage(100.0%)	1	NA	NA
AVS05110.1|171124_173179_+	helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 11
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	177412	178072	4815114		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVS05118.1|177412_178072_-	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 12
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	197718	210033	4815114		Morganella_phage(20.0%)	13	NA	NA
AVS05135.1|197718_197931_+	cold-shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
AVS09371.1|197941_198130_+	cold-shock protein	NA	NA	NA	NA	NA
AVS05136.1|198104_198335_+	cold-shock protein	NA	NA	NA	NA	NA
AVS05137.1|198324_198498_+	protein GnsA	NA	NA	NA	NA	NA
AVS05138.1|198546_199620_-	electron transporter YccM	NA	NA	NA	NA	NA
AVS05139.1|199691_202436_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	2.7e-37
AVS05140.1|202518_203547_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
AVS05141.1|203519_204212_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
AVS05142.1|204341_205514_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
AVS05143.1|205513_208060_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	9.0e-72
AVS05144.1|208056_208656_+	molecular chaperone TorD	NA	NA	NA	NA	NA
AVS05145.1|208807_209113_-	chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
AVS05146.1|209112_210033_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 13
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	214338	216613	4815114		Enterobacteria_phage(100.0%)	3	NA	NA
AVS05152.1|214338_214512_+	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
AVS05153.1|214769_216098_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
AVS05154.1|216118_216613_-	FMN reductase	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
>prophage 14
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	231251	232316	4815114		Cronobacter_phage(100.0%)	1	NA	NA
AVS05169.1|231251_232316_+	phosphate starvation protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
>prophage 15
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	239135	241697	4815114	transposase	Bacillus_phage(50.0%)	2	NA	NA
AVS05174.1|239135_240494_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	1.9e-20
AVS05175.1|240534_241697_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 16
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	246930	247764	4815114		Pelagibacter_phage(100.0%)	1	NA	NA
AVS05182.1|246930_247764_-	curli production assembly/transport component CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 17
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	251899	252433	4815114		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
AVS05191.1|251899_252433_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 18
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	261741	262662	4815114		Morganella_phage(100.0%)	1	NA	NA
AVS05199.1|261741_262662_-	lipid A biosynthesis lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 19
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	267322	267568	4815114		Salmonella_phage(100.0%)	1	NA	NA
AVS05206.1|267322_267568_-	DNA-damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 20
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	283451	284393	4815114		Brevibacillus_phage(100.0%)	1	NA	NA
AVS05226.1|283451_284393_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 21
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	296750	297932	4815114		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AVS05238.1|296750_297485_+	beta-ketoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
AVS05239.1|297695_297932_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 22
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	301204	302847	4815114		Pseudomonas_phage(50.0%)	2	NA	NA
AVS05243.1|301204_301846_+	thymidylate kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
AVS05244.1|301842_302847_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	31.8	6.4e-05
>prophage 23
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	315153	315411	4815114		Erwinia_phage(100.0%)	1	NA	NA
AVS05256.1|315153_315411_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 24
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	322699	326440	4815114		Planktothrix_phage(50.0%)	4	NA	NA
AVS05261.1|322699_323401_+	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
AVS05262.1|323400_324645_+	lipoprotein-releasing system transmembrane subunit LolE	NA	NA	NA	NA	NA
AVS05263.1|324673_325585_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AVS05264.1|325600_326440_+	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.7e-23
>prophage 25
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	329697	331675	4815114		Mycoplasma_phage(100.0%)	2	NA	NA
AVS05269.1|329697_330555_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AVS05270.1|330538_331675_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 26
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	336696	386580	4815114	portal,tail,capsid,terminase,head,holin,plate,protease,tRNA,integrase	Shigella_phage(53.7%)	65	341886:341900	355132:355146
AVS05275.1|336696_338067_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
AVS09377.1|338070_338712_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AVS05276.1|338747_339854_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AVS05277.1|339907_340369_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AVS05278.1|340378_341032_-	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AVS05279.1|341203_342454_+	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	98.1	1.1e-22
341886:341900	attL	TGCACAAAGGCAACA	NA	NA	NA	NA
AVS05280.1|342879_346521_+	DNA-binding protein	NA	NA	NA	NA	NA
AVS05281.1|346695_347823_-|integrase	integrase	integrase	O21925	Phage_21	61.3	1.7e-123
AVS05282.1|347803_348049_-	excisionase	NA	NA	NA	NA	NA
AVS05283.1|348146_348371_+	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	64.6	1.1e-13
AVS05284.1|348279_348624_+	hypothetical protein	NA	U5P0J5	Shigella_phage	97.4	1.1e-60
AVS05285.1|348542_348977_+	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
AVS05286.1|348948_349170_-	hypothetical protein	NA	NA	NA	NA	NA
AVS05287.1|349389_350064_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
AVS05288.1|350154_350355_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
AVS05289.1|350398_350950_+	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
AVS05290.1|351125_351305_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	66.7	3.0e-14
AVS05291.1|351294_352236_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	98.7	1.6e-143
AVS05292.1|352232_352727_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.6	4.3e-87
AVS05293.1|352693_353053_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	99.1	1.0e-53
AVS05294.1|353049_353439_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	99.2	3.5e-68
AVS05295.1|353458_354268_+	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
AVS05296.1|354275_355265_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.7	4.3e-195
355132:355146	attR	TGTTGCCTTTGTGCA	NA	NA	NA	NA
AVS05297.1|355282_355627_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	3.3e-54
AVS05298.1|355619_356846_-	hypothetical protein	NA	NA	NA	NA	NA
AVS05299.1|356842_357991_-	nucleoid-associated protein	NA	A0A291AUQ0	Sinorhizobium_phage	25.3	7.3e-13
AVS05300.1|358253_358448_+	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	98.4	5.1e-28
AVS05301.1|358597_359650_+	DNA adenine methylase	NA	A5LH81	Enterobacteria_phage	97.4	3.5e-203
AVS05302.1|359727_360063_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
AVS05303.1|360066_360543_+	lysozyme	NA	U5P0A9	Shigella_phage	98.7	6.4e-88
AVS05304.1|360526_360919_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	86.2	7.2e-53
AVS09378.1|361381_361714_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
AVS05305.1|361764_362115_+	HNH endonuclease	NA	Q8HA82	Salmonella_phage	94.0	5.8e-62
AVS05306.1|362231_362735_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	2.3e-88
AVS05307.1|362731_364465_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.4	0.0e+00
AVS05308.1|364476_364659_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
AVS05309.1|364658_365900_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
AVS05310.1|365841_366528_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.6	2.5e-125
AVS05311.1|366542_367748_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.3	7.7e-223
AVS05312.1|367797_367998_+	hypothetical protein	NA	S5FNU1	Shigella_phage	95.5	1.4e-25
AVS05313.1|368000_368324_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
AVS05314.1|368320_368731_+|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	91.9	4.8e-68
AVS05315.1|368705_369212_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
AVS05316.1|369208_369769_+	hypothetical protein	NA	S5FM61	Shigella_phage	98.4	1.2e-104
AVS05317.1|369777_369948_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
AVS05318.1|369931_371428_+|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	99.0	4.5e-273
AVS05319.1|371427_371784_+|tail	phage tail protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
AVS05320.1|371783_372053_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
AVS05321.1|372019_372208_+	hypothetical protein	NA	NA	NA	NA	NA
AVS05322.1|372194_374030_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.5	2.0e-307
AVS05323.1|374048_375419_+	DNA circularization protein	NA	S5FUX4	Shigella_phage	96.9	1.4e-249
AVS05324.1|375415_376495_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	2.0e-206
AVS05325.1|376494_377043_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.4	3.3e-96
AVS05326.1|377039_377468_+|tail	phage tail protein	tail	U5P0R9	Shigella_phage	100.0	2.3e-81
AVS05327.1|377454_378513_+|plate	phage baseplate protein	plate	S5FM68	Shigella_phage	98.6	2.8e-200
AVS05328.1|378503_379088_+	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	99.0	2.7e-112
AVS05329.1|379091_379748_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	67.4	8.8e-72
AVS05330.1|379756_380152_+|tail	phage tail protein	tail	A0A0M4S6V4	Salmonella_phage	45.7	3.5e-15
AVS09379.1|380123_380561_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	67.6	1.1e-46
AVS05331.1|380941_381169_+	DNA invertase	NA	A0A1S6L009	Salmonella_phage	81.2	1.9e-13
AVS05332.1|381202_383092_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AVS05333.1|383934_384099_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
AVS05334.1|384201_384525_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
AVS05335.1|385223_385628_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AVS05336.1|385848_386580_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 27
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	403837	405525	4815114		Morganella_phage(50.0%)	2	NA	NA
AVS05357.1|403837_404257_+	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
AVS05358.1|404256_405525_+	protein UmuC	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 28
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	432194	434946	4815114		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVS05380.1|432194_433874_-	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
AVS05381.1|433998_434946_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 29
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	438082	442090	4815114		Pseudomonas_phage(50.0%)	5	NA	NA
AVS05385.1|438082_439165_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
AVS05386.1|439164_439998_+	protein-(glutamine-N5) methyltransferase, release factor-specific	NA	NA	NA	NA	NA
AVS05387.1|439994_440387_+	protein sirB2	NA	NA	NA	NA	NA
AVS05388.1|440390_441200_+	protein sirB1	NA	NA	NA	NA	NA
AVS05389.1|441235_442090_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 30
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	457450	467991	4815114		Escherichia_phage(25.0%)	10	NA	NA
AVS05404.1|457450_458989_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
AVS05405.1|458985_459696_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
AVS05406.1|459695_460373_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
AVS05407.1|461628_462471_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
AVS05408.1|462520_462979_-	hypothetical protein	NA	NA	NA	NA	NA
AVS05409.1|463091_463997_+	patatin family protein	NA	NA	NA	NA	NA
AVS05410.1|464088_465102_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
AVS05411.1|465303_466212_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
AVS05412.1|466355_466769_-	DNA-binding protein H-NS	NA	NA	NA	NA	NA
AVS05413.1|467373_467991_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 31
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	477401	479416	4815114		Planktothrix_phage(50.0%)	2	NA	NA
AVS05418.1|477401_478415_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
AVS05419.1|478411_479416_+	oligopeptide transport ATP-binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 32
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	491074	494032	4815114		Acinetobacter_phage(100.0%)	2	NA	NA
AVS09385.1|491074_492433_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	3.3e-36
AVS05434.1|492436_494032_-	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
>prophage 33
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	501001	506293	4815114	protease	Chrysochromulina_ericina_virus(33.33%)	5	NA	NA
AVS05441.1|501001_501760_-	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
AVS05442.1|501979_503029_+|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
AVS05443.1|503064_503316_-	hypothetical protein	NA	NA	NA	NA	NA
AVS05444.1|503360_503573_+	hypothetical protein	NA	NA	NA	NA	NA
AVS05445.1|503695_506293_+	DNA topoisomerase 1	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 34
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	511217	511808	4815114		Staphylococcus_phage(100.0%)	1	NA	NA
AVS05451.1|511217_511808_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 35
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	519624	525281	4815114		Lactococcus_phage(50.0%)	5	NA	NA
AVS05462.1|519624_521559_-	exoribonuclease 2	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
AVS05463.1|521626_522754_-	hypothetical protein	NA	NA	NA	NA	NA
AVS05464.1|522897_523686_-	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AVS05465.1|524053_524407_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
AVS05466.1|524474_525281_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 36
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	538196	539462	4815114		Klosneuvirus(100.0%)	1	NA	NA
AVS05480.1|538196_539462_+	4-aminobutyrate aminotransferase PuuE	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.0e-24
>prophage 37
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	553466	554549	4815114		Planktothrix_phage(100.0%)	1	NA	NA
AVS05495.1|553466_554549_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 38
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	571168	571684	4815114		Streptococcus_phage(100.0%)	1	NA	NA
AVS05512.1|571168_571684_-	methylated-DNA--protein-cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 39
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	578010	604924	4815114	integrase,tRNA,transposase,tail	Escherichia_phage(57.14%)	35	578836:578850	607199:607213
AVS09388.1|578010_579243_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
578836:578850	attL	CAGAAAAAAGCGCGC	NA	NA	NA	NA
AVS05519.1|579497_580481_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AVS05520.1|580755_580929_+	hypothetical protein	NA	NA	NA	NA	NA
AVS05521.1|580958_582332_+	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AVS05522.1|582460_583396_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AVS05523.1|583447_584683_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
AVS05524.1|584684_584900_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AVS09390.1|584978_585188_-	DUF1187 domain-containing protein	NA	A0A0U2QL97	Escherichia_phage	96.8	3.0e-26
AVS09389.1|585180_585375_-	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
AVS05525.1|585431_586241_-	DNA recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
AVS05526.1|586233_588834_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.9e-248
AVS05527.1|588935_589211_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
AVS09391.1|589285_589456_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AVS05528.1|589455_589677_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
AVS05529.1|589805_590084_+	hypothetical protein	NA	NA	NA	NA	NA
AVS05530.1|590118_590607_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
AVS05531.1|590603_590759_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AVS05532.1|590769_590949_-	hypothetical protein	NA	NA	NA	NA	NA
AVS05533.1|590936_591155_-	hypothetical protein	NA	NA	NA	NA	NA
AVS05534.1|591191_591611_-	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
AVS05535.1|591690_591945_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
AVS05536.1|591941_592364_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
AVS05537.1|592441_593230_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
AVS05538.1|593236_593983_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	78.5	4.9e-111
AVS05539.1|593954_594767_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.9	7.5e-121
AVS05540.1|595124_596287_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
AVS05541.1|596420_597878_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
AVS05542.1|598828_599074_+|tail	phage tail protein	tail	A0A222YXY8	Escherichia_phage	97.3	2.5e-32
AVS05543.1|599102_599630_-|tail	tail fiber assembly protein	tail	A0A077SK10	Escherichia_phage	97.1	4.7e-92
AVS05544.1|599633_600596_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	91.1	4.0e-174
AVS09392.1|600700_600895_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.3	2.3e-28
AVS05545.1|601115_601706_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	2.8e-24
AVS05546.1|602022_602256_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	87.0	4.1e-32
AVS05547.1|603215_603650_-	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
AVS05548.1|603790_604924_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
607199:607213	attR	GCGCGCTTTTTTCTG	NA	NA	NA	NA
>prophage 40
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	609884	610874	4815114		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVS05553.1|609884_610874_-	lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
>prophage 41
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	641394	645297	4815114		Klosneuvirus(100.0%)	1	NA	NA
AVS05577.1|641394_645297_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 42
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	649235	650184	4815114		Escherichia_phage(50.0%)	2	NA	NA
AVS05581.1|649235_649766_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
AVS05582.1|650010_650184_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 43
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	661990	672164	4815114	protease,transposase	Escherichia_phage(20.0%)	10	NA	NA
AVS05595.1|661990_663199_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.0	1.7e-206
AVS05596.1|663238_664453_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
AVS05597.1|664505_665042_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVS05598.1|665114_667076_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.3	3.5e-23
AVS05599.1|667167_667398_-	DUF2554 domain-containing protein	NA	NA	NA	NA	NA
AVS05600.1|667619_667796_+	mRNA interferase HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
AVS09395.1|667841_668258_+	antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
AVS05601.1|668336_669743_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVS05602.1|669987_671133_+	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS05603.1|671150_672164_+	polyamine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 44
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	679296	681399	4815114		Salmonella_phage(100.0%)	1	NA	NA
AVS05614.1|679296_681399_-	TonB-dependent siderophore receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	5.3e-134
>prophage 45
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	686305	688414	4815114		Ralstonia_phage(100.0%)	1	NA	NA
AVS05620.1|686305_688414_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	5.6e-27
>prophage 46
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	700074	701619	4815114		Escherichia_phage(100.0%)	1	NA	NA
AVS05630.1|700074_701619_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 47
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	708503	708794	4815114		Enterobacteria_phage(100.0%)	1	NA	NA
AVS05633.1|708503_708794_-	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 48
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	714985	715270	4815114		Escherichia_phage(100.0%)	1	NA	NA
AVS05639.1|714985_715270_-	transcriptional regulator	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 49
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	719698	721604	4815114		Planktothrix_phage(100.0%)	2	NA	NA
AVS05644.1|719698_720625_-	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-14
AVS05645.1|720617_721604_-	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
>prophage 50
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	728345	729728	4815114		Bacillus_virus(100.0%)	1	NA	NA
AVS05650.1|728345_729728_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 51
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	734994	741930	4815114		Powai_lake_megavirus(50.0%)	3	NA	NA
AVS05654.1|734994_737790_-	peptidase M16	NA	A0A167R9K4	Powai_lake_megavirus	24.0	3.4e-19
AVS05655.1|737834_740207_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AVS05656.1|740244_741930_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.3	2.2e-10
>prophage 52
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	750759	846712	4815114	portal,tail,capsid,terminase,head,holin,transposase	Enterobacteria_phage(31.67%)	114	NA	NA
AVS05662.1|750759_752032_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
AVS05663.1|754076_754301_-	hypothetical protein	NA	NA	NA	NA	NA
AVS05664.1|754311_755634_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AVS05665.1|755633_755900_-	transcriptional regulator	NA	NA	NA	NA	NA
AVS05666.1|756705_757698_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
AVS05667.1|757709_758732_+	autoinducer 2 ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS05668.1|759646_759937_+	autoinducer 2-degrading protein LsrG	NA	NA	NA	NA	NA
AVS05669.1|759993_760752_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
AVS05670.1|760755_761670_-	hypothetical protein	NA	NA	NA	NA	NA
AVS09399.1|761619_761820_+	hypothetical protein	NA	NA	NA	NA	NA
AVS05671.1|761876_763328_-	altronate oxidoreductase	NA	NA	NA	NA	NA
AVS05672.1|763472_763604_-	diguanylate cyclase	NA	NA	NA	NA	NA
AVS09400.1|763554_764502_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.3e-18
AVS05673.1|765111_765471_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
AVS05674.1|765470_766397_-	glutaminase 2	NA	NA	NA	NA	NA
AVS05675.1|766460_767849_-	succinate semialdehyde dehydrogenase [NAD(P)+] Sad	NA	NA	NA	NA	NA
AVS05676.1|767949_768831_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS05677.1|768908_770024_+	putative protein YneK	NA	NA	NA	NA	NA
AVS05678.1|770173_771364_+	sugar efflux transporter	NA	NA	NA	NA	NA
AVS05679.1|771388_772054_-	stress protection protein MarC	NA	NA	NA	NA	NA
AVS05680.1|772265_772700_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVS05681.1|772719_773103_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
AVS05682.1|773134_773353_+	multiple antibiotic resistance regulatory periplasmic protein MarB	NA	NA	NA	NA	NA
AVS05683.1|773383_774283_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
AVS05684.1|774477_775665_+	transporter	NA	NA	NA	NA	NA
AVS05685.1|775791_775887_+	hypothetical protein	NA	NA	NA	NA	NA
AVS05686.1|776105_776996_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
AVS05687.1|777250_777643_-	TIGR00156 family protein	NA	NA	NA	NA	NA
AVS05688.1|777918_778437_+	hypothetical protein	NA	NA	NA	NA	NA
AVS05689.1|778480_780526_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
AVS05690.1|780662_781409_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVS05691.1|781497_782184_+	transcriptional regulator	NA	NA	NA	NA	NA
AVS05692.1|782360_782564_+	protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
AVS05693.1|782598_784059_-	D-mannonate oxidoreductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	7.3e-42
AVS05694.1|784147_785431_-	MFS transporter	NA	NA	NA	NA	NA
AVS05695.1|786217_786451_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
AVS05696.1|786767_787358_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AVS05697.1|787455_788031_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	2.0e-104
AVS05698.1|788030_791054_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	2.1e-67
AVS05699.1|791118_791718_-	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.3e-109
AVS05700.1|791784_795183_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	87.8	0.0e+00
AVS05701.1|795243_795915_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	3.1e-104
AVS05702.1|795812_796556_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
AVS05703.1|796561_797260_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	5.6e-133
AVS05704.1|797259_797589_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
AVS05705.1|797585_800165_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	95.1	0.0e+00
AVS05706.1|800157_800592_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	5.8e-64
AVS05707.1|800573_800996_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.1	2.4e-70
AVS09401.1|801011_801752_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
AVS05708.1|801759_802155_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	7.2e-69
AVS05709.1|802151_802730_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	96.9	1.1e-78
AVS05710.1|802741_803095_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	7.6e-62
AVS05711.1|803106_803502_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	90.9	1.3e-54
AVS05712.1|803543_804569_-|capsid	major capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	98.2	3.6e-189
AVS05713.1|804624_804957_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
AVS05714.1|804966_806286_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	5.6e-235
AVS05715.1|806266_807868_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.3e-310
AVS05716.1|807864_808071_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AVS05717.1|808067_809993_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
AVS05718.1|809967_810513_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
AVS05719.1|810652_810796_-	DNA-packaging protein	NA	NA	NA	NA	NA
AVS05720.1|810901_811135_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
AVS05721.1|811192_811603_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AVS05722.1|811754_811928_-	protein GnsB	NA	NA	NA	NA	NA
AVS05723.1|812099_812255_-	hypothetical protein	NA	NA	NA	NA	NA
AVS05724.1|812401_812590_-	cold-shock protein	NA	NA	NA	NA	NA
AVS05725.1|812600_812813_-	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AVS05726.1|813174_813672_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
AVS05727.1|813668_814202_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	1.1e-99
AVS05728.1|814257_814572_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	97.1	1.6e-50
AVS05729.1|814576_814792_-|holin	holin	holin	A5LH82	Enterobacteria_phage	95.8	1.3e-32
AVS05730.1|814982_815705_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVS05731.1|815909_816098_-	hypothetical protein	NA	NA	NA	NA	NA
AVS05732.1|816325_817487_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
AVS05733.1|818515_819040_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
AVS05734.1|819195_819573_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
AVS05735.1|819590_820640_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	2.2e-112
AVS05736.1|820641_820920_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	9.7e-12
AVS05737.1|820986_821238_-	hypothetical protein	NA	NA	NA	NA	NA
AVS05738.1|821454_821610_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AVS05739.1|821681_821969_-	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AVS05740.1|821968_822208_-	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AVS05741.1|822232_822538_+	hypothetical protein	NA	NA	NA	NA	NA
AVS05742.1|822740_823073_+	protein FlxA	NA	NA	NA	NA	NA
AVS05743.1|823342_823465_-	plasmid mobilization protein	NA	NA	NA	NA	NA
AVS05744.1|823509_824850_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AVS05745.1|825027_825210_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
AVS05746.1|825184_825364_-	hypothetical protein	NA	NA	NA	NA	NA
AVS05747.1|826514_826871_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	71.4	6.3e-40
AVS05748.1|826867_827290_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
AVS05749.1|827330_828350_-	hypothetical protein	NA	U5P0A0	Shigella_phage	59.6	2.6e-54
AVS05750.1|828276_828798_-	hypothetical protein	NA	NA	NA	NA	NA
AVS05751.1|828781_829009_-	transcriptional regulator	NA	NA	NA	NA	NA
AVS05752.1|829090_829498_+	transcriptional regulator	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
AVS05753.1|829666_829822_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
AVS05754.1|829781_829952_+	hypothetical protein	NA	NA	NA	NA	NA
AVS05755.1|829981_830200_+	hypothetical protein	NA	NA	NA	NA	NA
AVS05756.1|830767_830956_+	division inhibition protein DicB	NA	NA	NA	NA	NA
AVS05757.1|830952_831144_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVS05758.1|831237_833709_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
AVS05759.1|833781_834033_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AVS05760.1|834052_835348_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	8.7e-156
AVS05761.1|835367_835478_-	transporter	NA	NA	NA	NA	NA
AVS05762.1|836713_836902_-	hypothetical protein	NA	NA	NA	NA	NA
AVS05763.1|836938_837265_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AVS05764.1|837399_837741_+	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AVS05765.1|837775_838336_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AVS09402.1|838338_839049_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AVS05766.1|839156_839462_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AVS05767.1|839660_842087_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	4.5e-214
AVS09403.1|842147_844571_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
AVS05768.1|844581_845199_+	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AVS05769.1|845200_846055_+	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AVS05770.1|846097_846712_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 53
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	875852	877664	4815114		Vaccinia_virus(100.0%)	1	NA	NA
AVS05798.1|875852_877664_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 54
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	897540	898815	4815114	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AVS05820.1|897540_898815_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 55
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	905726	907225	4815114		Salmonella_phage(50.0%)	2	NA	NA
AVS09407.1|905726_906248_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
AVS05828.1|906328_907225_-	oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 56
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	916027	924908	4815114		Streptomyces_phage(20.0%)	10	NA	NA
AVS05836.1|916027_916843_+	murein DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
AVS05837.1|916970_917552_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
AVS05838.1|917786_918956_-	MFS transporter	NA	NA	NA	NA	NA
AVS05839.1|919121_919211_-	YnhF family membrane protein	NA	NA	NA	NA	NA
AVS05840.1|919297_919522_+	hypothetical protein	NA	NA	NA	NA	NA
AVS05841.1|919509_920535_+	PurR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
AVS05842.1|920531_921464_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS05843.1|921576_922788_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AVS05844.1|923078_924227_+	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
AVS05845.1|924266_924908_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 57
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	930412	932679	4815114		Edwardsiella_phage(50.0%)	3	NA	NA
AVS05850.1|930412_931225_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
AVS05851.1|931228_932014_-	protein PhsC	NA	NA	NA	NA	NA
AVS05852.1|932010_932679_-	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 58
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	940968	946052	4815114		environmental_halophage(33.33%)	5	NA	NA
AVS05861.1|940968_942189_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
AVS05862.1|942185_943457_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AVS05863.1|943431_944178_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	31.4	8.4e-10
AVS05864.1|944187_945675_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AVS05865.1|945683_946052_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 59
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	965473	985013	4815114	tRNA	Tupanvirus(22.22%)	20	NA	NA
AVS05882.1|965473_967120_+	cyclohexanecarboxylate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.0e-32
AVS05883.1|967176_969555_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
AVS05884.1|969608_969776_-	hypothetical protein	NA	NA	NA	NA	NA
AVS05885.1|969887_970721_+	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AVS05886.1|970877_971924_+	phospho-2-dehydro-3-deoxyheptonate aldolase Trp-sensitive	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
AVS05887.1|972055_972247_+	hypothetical protein	NA	NA	NA	NA	NA
AVS05888.1|972250_973687_-	YdiU family protein	NA	NA	NA	NA	NA
AVS05889.1|973749_974463_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AVS05890.1|974709_975174_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
AVS05891.1|975251_976001_-	vitamin B12 import ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
AVS05892.1|976000_976552_-	glutathione peroxidase	NA	NA	NA	NA	NA
AVS05893.1|976614_977595_-	vitamin B12 import system permease BtuC	NA	NA	NA	NA	NA
AVS05894.1|977695_977995_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AVS05895.1|977999_980387_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AVS05896.1|980401_981385_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
AVS09408.1|981668_981713_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AVS05897.1|981835_982192_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVS05898.1|982244_982442_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVS05899.1|982538_983081_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
AVS05900.1|983084_985013_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 60
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	996309	998571	4815114		Tupanvirus(100.0%)	1	NA	NA
AVS05914.1|996309_998571_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
>prophage 61
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1004900	1005728	4815114		Bacillus_virus(100.0%)	1	NA	NA
AVS05923.1|1004900_1005728_+	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.7e-72
>prophage 62
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1013204	1014425	4815114		Klosneuvirus(100.0%)	1	NA	NA
AVS05931.1|1013204_1014425_-	succinylornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.1	4.2e-27
>prophage 63
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1021189	1021843	4815114		Planktothrix_phage(100.0%)	1	NA	NA
AVS05939.1|1021189_1021843_+	sulfate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	1.2e-12
>prophage 64
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1027440	1029402	4815114		Streptococcus_phage(100.0%)	1	NA	NA
AVS05946.1|1027440_1029402_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 65
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1034328	1044352	4815114	transposase	Tupanvirus(25.0%)	5	NA	NA
AVS05953.1|1034328_1034970_+	bifunctional pyrazinamidase/nicotinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
AVS05954.1|1036491_1039989_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.8	2.7e-98
AVS05955.1|1040880_1042050_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.8	6.5e-41
AVS09409.1|1042655_1043057_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVS05956.1|1043079_1044352_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
>prophage 66
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1047506	1048487	4815114		Staphylococcus_phage(100.0%)	1	NA	NA
AVS05959.1|1047506_1048487_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	7.9e-08
>prophage 67
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1057297	1058152	4815114		Indivirus(100.0%)	1	NA	NA
AVS05968.1|1057297_1058152_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 68
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1061470	1066047	4815114		Bacillus_phage(100.0%)	3	NA	NA
AVS05971.1|1061470_1062754_+	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
AVS05972.1|1062900_1064376_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AVS05973.1|1064556_1066047_+	diguanylate cylase	NA	A0A127AWB9	Bacillus_phage	30.6	4.9e-09
>prophage 69
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1081925	1090031	4815114	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
AVS05993.1|1081925_1083611_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	2.0e-35
AVS05994.1|1083815_1084397_-	hypothetical protein	NA	NA	NA	NA	NA
AVS05995.1|1084436_1085132_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AVS05996.1|1085189_1087100_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
AVS05997.1|1087231_1087576_+	hypothetical protein	NA	NA	NA	NA	NA
AVS05998.1|1087937_1088297_+	DUF1889 domain-containing protein	NA	NA	NA	NA	NA
AVS05999.1|1088416_1088596_-	YoaH family protein	NA	NA	NA	NA	NA
AVS06000.1|1088669_1090031_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
>prophage 70
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1093893	1095450	4815114		Moraxella_phage(100.0%)	1	NA	NA
AVS06004.1|1093893_1095450_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 71
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1101090	1101300	4815114		Morganella_phage(100.0%)	1	NA	NA
AVS06013.1|1101090_1101300_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 72
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1106630	1108679	4815114	protease,tail	Moraxella_phage(100.0%)	1	NA	NA
AVS06022.1|1106630_1108679_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.8e-86
>prophage 73
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1116175	1120645	4815114		Escherichia_phage(33.33%)	7	NA	NA
AVS06028.1|1116175_1116832_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	8.0e-57
AVS06029.1|1117227_1117569_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AVS06030.1|1117581_1118454_-	hypothetical protein	NA	NA	NA	NA	NA
AVS06031.1|1118457_1118832_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AVS06032.1|1118970_1119201_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
AVS06033.1|1119302_1119959_+	C-N hydrolase family protein YobB	NA	NA	NA	NA	NA
AVS06034.1|1119982_1120645_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 74
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1128701	1130177	4815114		Cyanophage(100.0%)	1	NA	NA
AVS06042.1|1128701_1130177_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	3.7e-78
>prophage 75
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1134175	1141239	4815114		Bacillus_virus(50.0%)	9	NA	NA
AVS06046.1|1134175_1135498_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
AVS09415.1|1135513_1136446_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AVS06047.1|1136524_1137280_+	Mn2+/Zn2+ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
AVS06048.1|1137276_1138062_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AVS06049.1|1138208_1139219_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AVS06050.1|1139227_1139839_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AVS09416.1|1139977_1140043_-	hypothetical protein	NA	NA	NA	NA	NA
AVS06051.1|1140113_1140716_+	hypothetical protein	NA	NA	NA	NA	NA
AVS06052.1|1140717_1141239_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 76
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1145257	1147308	4815114		Escherichia_coli_phage(50.0%)	3	NA	NA
AVS06057.1|1145257_1146076_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
AVS06058.1|1146128_1146524_+	hypothetical protein	NA	NA	NA	NA	NA
AVS06059.1|1146564_1147308_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
>prophage 77
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1153924	1155658	4815114	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVS06064.1|1153924_1155658_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 78
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1160910	1166554	4815114		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
AVS06070.1|1160910_1161300_-	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
AVS06071.1|1161314_1162364_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	7.9e-06
AVS06072.1|1162366_1163227_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AVS06073.1|1163245_1164847_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	6.4e-15
AVS06074.1|1164892_1166554_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 79
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1176641	1178156	4815114		Staphylococcus_phage(100.0%)	1	NA	NA
AVS06085.1|1176641_1178156_-	arabinose import ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 80
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1190148	1190901	4815114		Bacillus_virus(100.0%)	1	NA	NA
AVS06100.1|1190148_1190901_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 81
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1203122	1203791	4815114		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVS06114.1|1203122_1203791_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	7.3e-82
>prophage 82
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1217807	1230242	4815114		Bacillus_phage(28.57%)	13	NA	NA
AVS06133.1|1217807_1219502_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.7e-18
AVS06134.1|1219422_1219611_-	hypothetical protein	NA	NA	NA	NA	NA
AVS06135.1|1219739_1219922_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AVS06136.1|1220000_1220918_-	hypothetical protein	NA	NA	NA	NA	NA
AVS06137.1|1221090_1222011_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AVS06138.1|1221999_1222470_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
AVS06139.1|1222450_1223869_-	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	55.7	3.0e-101
AVS06140.1|1223935_1224631_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
AVS06141.1|1224670_1225036_-	permease	NA	NA	NA	NA	NA
AVS06142.1|1225602_1226661_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	49.3	1.1e-92
AVS06143.1|1227253_1228105_+	Molecular chaperone Hsp31 and glyoxalase 3	NA	NA	NA	NA	NA
AVS06144.1|1228212_1229571_-	HAMP domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	6.6e-05
AVS09418.1|1229570_1230242_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 83
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1233786	1238636	4815114	integrase	Escherichia_phage(50.0%)	6	1235964:1236023	1245158:1245237
AVS06149.1|1233786_1234317_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
AVS06150.1|1234339_1234582_+	hypothetical protein	NA	NA	NA	NA	NA
AVS09419.1|1235069_1235867_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1235964:1236023	attL	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTC	NA	NA	NA	NA
AVS06151.1|1236205_1236736_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	42.7	6.8e-30
AVS06152.1|1236829_1237468_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	42.3	1.1e-29
AVS06153.1|1238438_1238636_-	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	100.0	5.1e-07
1245158:1245237	attR	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGGAGCCA	NA	NA	NA	NA
>prophage 84
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1247807	1250515	4815114	integrase,transposase	Stenotrophomonas_phage(33.33%)	3	1239256:1239270	1252632:1252646
1239256:1239270	attL	GATGATGGGCATCGC	NA	NA	NA	NA
AVS06160.1|1247807_1248338_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	42.7	1.4e-30
AVS06161.1|1248431_1249070_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	42.3	1.1e-29
AVS06162.1|1249242_1250515_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
1252632:1252646	attR	GATGATGGGCATCGC	NA	NA	NA	NA
>prophage 85
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1258132	1259299	4815114		Stx2-converting_phage(100.0%)	1	NA	NA
AVS06172.1|1258132_1259299_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	1.7e-227
>prophage 86
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1266480	1267380	4815114		Cellulophaga_phage(100.0%)	1	NA	NA
AVS06179.1|1266480_1267380_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 87
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1274732	1277554	4815114		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
AVS06187.1|1274732_1275899_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	2.2e-110
AVS06188.1|1276147_1277554_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
>prophage 88
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1284372	1293028	4815114		Enterobacteria_phage(42.86%)	8	NA	NA
AVS06194.1|1284372_1285464_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	64.4	1.9e-140
AVS06195.1|1286712_1287267_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.3	1.7e-47
AVS06196.1|1287275_1288151_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
AVS06197.1|1288208_1289108_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	9.7e-29
AVS06198.1|1289107_1290193_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.0e-100
AVS06199.1|1290265_1290529_+	hypothetical protein	NA	NA	NA	NA	NA
AVS06200.1|1290565_1291459_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.0	7.9e-47
AVS06201.1|1291633_1293028_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	6.3e-19
>prophage 89
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1299125	1306095	4815114		Bacillus_phage(25.0%)	6	NA	NA
AVS06206.1|1299125_1300496_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.2e-32
AVS06207.1|1300864_1302301_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	7.4e-47
AVS06208.1|1302303_1303527_-	colanic acid biosynthesis glycosyltransferase WcaI	NA	NA	NA	NA	NA
AVS06209.1|1303523_1304003_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AVS06210.1|1304005_1304971_-	GDP-fucose synthetase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
AVS06211.1|1304973_1306095_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 90
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1310339	1320815	4815114		uncultured_marine_virus(20.0%)	8	NA	NA
AVS06217.1|1310339_1311179_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
AVS06218.1|1311356_1313519_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
AVS06219.1|1313521_1313965_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AVS06220.1|1313970_1315110_-	lipoprotein	NA	NA	NA	NA	NA
AVS06221.1|1315768_1317352_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
AVS06222.1|1317625_1319479_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AVS06223.1|1319500_1320082_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
AVS06224.1|1320173_1320815_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 91
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1325532	1326885	4815114		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVS06227.1|1325532_1326885_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	1.9e-07
>prophage 92
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1340734	1347568	4815114		Bacillus_phage(40.0%)	8	NA	NA
AVS06236.1|1340734_1342138_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
AVS06237.1|1342134_1342857_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
AVS06238.1|1343047_1343380_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AVS06239.1|1343526_1344888_+	U32 family peptidase	NA	Q6DW11	Phage_TP	99.5	1.6e-216
AVS06240.1|1345021_1345231_-	hypothetical protein	NA	NA	NA	NA	NA
AVS06241.1|1345218_1345536_-	hypothetical protein	NA	NA	NA	NA	NA
AVS06242.1|1345941_1346841_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
AVS06243.1|1346914_1347568_-	HAD family hydrolase	NA	A0A1D8KNV9	Synechococcus_phage	24.8	9.0e-08
>prophage 93
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1360532	1364089	4815114		Serratia_phage(50.0%)	4	NA	NA
AVS06252.1|1360532_1361537_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	5.8e-14
AVS06253.1|1361533_1362499_+	sugar kinase	NA	NA	NA	NA	NA
AVS06254.1|1362472_1363219_-	transcriptional regulator	NA	NA	NA	NA	NA
AVS06255.1|1363270_1364089_-	hypothetical protein	NA	I3VYU7	Thermoanaerobacterium_phage	34.0	6.6e-16
>prophage 94
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1374737	1376771	4815114	tRNA	Indivirus(100.0%)	1	NA	NA
AVS06267.1|1374737_1376771_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 95
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1388402	1397844	4815114		Enterobacteria_phage(85.71%)	10	NA	NA
AVS06272.1|1388402_1389539_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
AVS06273.1|1389535_1391536_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
AVS06274.1|1391660_1392122_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
AVS06275.1|1392162_1392633_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AVS06276.1|1392679_1393399_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVS06277.1|1393395_1395081_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AVS06278.1|1395302_1396034_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AVS06279.1|1396093_1396201_+	hypothetical protein	NA	NA	NA	NA	NA
AVS06280.1|1396181_1396913_-	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AVS06281.1|1396917_1397844_-	ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.3e-23
>prophage 96
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1424198	1427984	4815114	tRNA	Cellulophaga_phage(50.0%)	5	NA	NA
AVS06303.1|1424198_1424867_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
AVS06304.1|1424850_1424964_-|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AVS06305.1|1425020_1425197_+	hypothetical protein	NA	NA	NA	NA	NA
AVS06306.1|1425124_1425961_+	S-formylglutathione hydrolase YeiG	NA	NA	NA	NA	NA
AVS06307.1|1425992_1427984_-	colicin I receptor	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 97
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1432054	1432912	4815114		Catovirus(100.0%)	1	NA	NA
AVS06312.1|1432054_1432912_+	endonuclease IV with intrinsic 3''-5'' exonuclease activity	NA	A0A1V0SBL9	Catovirus	34.0	4.0e-24
>prophage 98
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1447459	1451760	4815114		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
AVS06326.1|1447459_1448926_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	8.7e-43
AVS06327.1|1449043_1450030_+	GTP-binding protein	NA	NA	NA	NA	NA
AVS06328.1|1450068_1450782_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AVS06329.1|1451193_1451760_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 99
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1457514	1465162	4815114		Vibrio_phage(50.0%)	8	NA	NA
AVS06334.1|1457514_1459104_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
AVS06335.1|1459107_1459452_-	hypothetical protein	NA	NA	NA	NA	NA
AVS06336.1|1459784_1460975_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	23.7	3.8e-20
AVS06337.1|1461002_1461698_-	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
AVS06338.1|1461698_1461821_+	aldose epimerase	NA	NA	NA	NA	NA
AVS06339.1|1461846_1463607_+	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	41.8	2.4e-100
AVS06340.1|1463731_1464016_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
AVS06341.1|1464154_1465162_-	nucleoid-associated protein	NA	A0A1V0E8C0	Vibrio_phage	48.6	4.1e-84
>prophage 100
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1469362	1470636	4815114	transposase	Shigella_phage(100.0%)	1	NA	NA
AVS06344.1|1469362_1470636_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
>prophage 101
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1478372	1478996	4815114		Bacillus_virus(100.0%)	1	NA	NA
AVS06354.1|1478372_1478996_-	cytochrome c biogenesis ATP-binding export protein CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.0e-12
>prophage 102
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1488446	1494251	4815114		Bacillus_phage(25.0%)	5	NA	NA
AVS06365.1|1488446_1490090_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
AVS06366.1|1490165_1490816_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
AVS06367.1|1490815_1491880_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	2.4e-18
AVS06368.1|1491953_1493009_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AVS06369.1|1493120_1494251_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.2	1.1e-117
>prophage 103
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1498528	1503371	4815114		Hokovirus(50.0%)	2	NA	NA
AVS06374.1|1498528_1501378_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
AVS06375.1|1501544_1503371_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
>prophage 104
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1518294	1520922	4815114		Bacillus_virus(100.0%)	1	NA	NA
AVS06385.1|1518294_1520922_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 105
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1526366	1532513	4815114		Pseudomonas_phage(50.0%)	6	NA	NA
AVS06388.1|1526366_1528652_+	ribonucleoside-diphosphate reductase 1 subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
AVS09429.1|1528885_1530016_+	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
AVS06389.1|1530015_1530270_+	ferredoxin	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
AVS06390.1|1530323_1530974_-	protein InaA	NA	NA	NA	NA	NA
AVS06391.1|1531188_1531395_+	hypothetical protein	NA	NA	NA	NA	NA
AVS06392.1|1531436_1532513_-	glycerophosphoryl diester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.0e-08
>prophage 106
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1538405	1542916	4815114		Sodalis_phage(50.0%)	5	NA	NA
AVS06397.1|1538405_1539305_+	hypothetical protein	NA	Q2A0A7	Sodalis_phage	54.8	2.5e-69
AVS06398.1|1539317_1539503_+	hypothetical protein	NA	NA	NA	NA	NA
AVS06399.1|1539543_1540347_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
AVS06400.1|1540364_1541654_-	MFS transporter	NA	NA	NA	NA	NA
AVS09430.1|1541710_1542916_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.0	2.1e-26
>prophage 107
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1546519	1551523	4815114		Tupanvirus(50.0%)	4	NA	NA
AVS06404.1|1546519_1547122_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
AVS06405.1|1547429_1548569_+	UDP-4-amino-4-deoxy-L-arabinose-oxoglutarate aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.5e-29
AVS06406.1|1548572_1549541_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
AVS06407.1|1549540_1551523_+	bifunctional UDP-glucuronic acid oxidase/UDP-4-amino-4-deoxy-L-arabinose formyltransferase	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 108
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1585938	1589166	4815114		Salmonella_phage(50.0%)	3	NA	NA
AVS06439.1|1585938_1586538_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
AVS06440.1|1586596_1588429_-	transporter	NA	NA	NA	NA	NA
AVS06441.1|1588515_1589166_-	sugar phosphatase YfbT	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.4	3.1e-08
>prophage 109
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1599725	1601586	4815114	transposase	Sodalis_phage(50.0%)	2	NA	NA
AVS06453.1|1599725_1600616_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	43.9	8.9e-67
AVS06454.1|1600812_1601586_-	histidine transport ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 110
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1605797	1607315	4815114		Mollivirus(100.0%)	1	NA	NA
AVS06460.1|1605797_1607315_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 111
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1613791	1614928	4815114		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVS06468.1|1613791_1614928_-	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.9e-23
>prophage 112
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1623464	1624550	4815114		Pandoravirus(100.0%)	1	NA	NA
AVS06478.1|1623464_1624550_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
>prophage 113
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1643775	1654336	4815114	transposase	Enterobacteria_phage(28.57%)	15	NA	NA
AVS06498.1|1643775_1644708_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
AVS06499.1|1645019_1646177_+	DUF4102 domain-containing protein	NA	A5VW56	Enterobacteria_phage	99.5	1.8e-221
AVS06500.1|1646272_1647379_+	hypothetical protein	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	30.8	8.0e-41
AVS06501.1|1647409_1649011_-	hypothetical protein	NA	S4TU85	Salmonella_phage	34.7	7.3e-19
AVS06502.1|1649063_1650238_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.5e-170
AVS06503.1|1650296_1651459_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AVS06504.1|1651533_1652046_+	hypothetical protein	NA	H6WZG2	Escherichia_phage	79.8	3.4e-79
AVS06505.1|1652047_1652239_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	4.7e-26
AVS06506.1|1652241_1652985_+	DUF551 domain-containing protein	NA	A0A1B0V865	Salmonella_phage	51.5	1.8e-60
AVS06507.1|1652987_1653173_+	hypothetical protein	NA	K7PJY8	Enterobacterial_phage	100.0	4.6e-26
AVS06508.1|1653169_1653397_+	hypothetical protein	NA	K7PKY3	Enterobacterial_phage	100.0	2.5e-34
AVS06509.1|1653583_1653838_+	hypothetical protein	NA	A0A220IH78	Escherichia_phage	82.1	7.2e-06
AVS09432.1|1653744_1653978_-	hypothetical protein	NA	NA	NA	NA	NA
AVS06510.1|1653910_1654078_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
AVS06511.1|1654135_1654336_+	excisionase	NA	K7P7V0	Enterobacteria_phage	98.5	1.2e-32
>prophage 114
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1662199	1669776	4815114		Bacillus_phage(50.0%)	4	NA	NA
AVS06518.1|1662199_1665793_+	two-component system sensor histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	1.1e-09
AVS06519.1|1665848_1666994_-	acetyl-CoA--oxalate CoA-transferase	NA	NA	NA	NA	NA
AVS06520.1|1667067_1668012_-	transporter YfdV	NA	NA	NA	NA	NA
AVS06521.1|1668081_1669776_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
>prophage 115
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1673470	1674391	4815114		Morganella_phage(100.0%)	1	NA	NA
AVS06526.1|1673470_1674391_+	lipid A biosynthesis palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 116
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1678208	1678943	4815114		Clostridioides_phage(100.0%)	1	NA	NA
AVS06529.1|1678208_1678943_+	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 117
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1704637	1717291	4815114		Streptococcus_phage(40.0%)	12	NA	NA
AVS06553.1|1704637_1706653_-	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.7e-150
AVS06554.1|1706723_1707710_-	cell division protein ZipA	NA	NA	NA	NA	NA
AVS06555.1|1707939_1708701_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
AVS06556.1|1708885_1709857_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
AVS06557.1|1710240_1710498_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AVS06558.1|1710542_1712270_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	31.1	1.3e-16
AVS06559.1|1712310_1712820_+	glucose-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AVS06560.1|1712862_1713714_-	pyridoxine kinase	NA	NA	NA	NA	NA
AVS06561.1|1713818_1714193_+	hypothetical protein	NA	NA	NA	NA	NA
AVS06562.1|1714225_1714960_+	WGR domain-containing protein	NA	NA	NA	NA	NA
AVS06563.1|1715148_1716060_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.3	3.8e-57
AVS06564.1|1716193_1717291_-	sulfate/thiosulfate import ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
>prophage 118
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1720308	1721100	4815114		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AVS06569.1|1720308_1721100_-	NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 119
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1724578	1729698	4815114		Mycobacterium_phage(33.33%)	6	NA	NA
AVS06573.1|1724578_1725883_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
AVS06574.1|1726122_1727022_-	deferrochelatase/peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
AVS06575.1|1727117_1727693_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AVS06576.1|1727753_1728203_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AVS06577.1|1728189_1728615_-	acetyltransferase YpeA	NA	NA	NA	NA	NA
AVS06578.1|1728828_1729698_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 120
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1748451	1749402	4815114		Cyanophage(100.0%)	1	NA	NA
AVS06597.1|1748451_1749402_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 121
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1766690	1767404	4815114		Synechococcus_phage(100.0%)	1	NA	NA
AVS06610.1|1766690_1767404_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 122
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1788655	1792657	4815114		Enterobacteria_phage(33.33%)	5	NA	NA
AVS06630.1|1788655_1789945_-	uracil/xanthine transporter	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
AVS06631.1|1790030_1790657_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AVS06632.1|1790777_1790963_+	hypothetical protein	NA	NA	NA	NA	NA
AVS06633.1|1790981_1792019_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.4e-71
AVS06634.1|1792018_1792657_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	1.8e-29
>prophage 123
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1798904	1805387	4815114		Escherichia_phage(66.67%)	8	NA	NA
AVS06638.1|1798904_1799057_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
AVS06639.1|1799074_1799266_+	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AVS06640.1|1799327_1799474_+	succinate dehydrogenase	NA	NA	NA	NA	NA
AVS06641.1|1799576_1800095_+	hypothetical protein	NA	G9L6F1	Escherichia_phage	99.4	5.0e-62
AVS06642.1|1800110_1800650_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
AVS06643.1|1800742_1802320_-	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AVS06644.1|1802388_1803855_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
AVS06645.1|1804016_1805387_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	6.8e-42
>prophage 124
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1814217	1814649	4815114		Powai_lake_megavirus(100.0%)	1	NA	NA
AVS06654.1|1814217_1814649_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 125
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1824859	1831316	4815114		Mycoplasma_phage(20.0%)	8	NA	NA
AVS06659.1|1824859_1826143_-	peptidase B	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
AVS06660.1|1826320_1826521_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AVS06661.1|1826532_1826868_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AVS06662.1|1826869_1828720_-	molecular chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
AVS06663.1|1828736_1829252_-	co-chaperone protein HscB	NA	NA	NA	NA	NA
AVS06664.1|1829347_1829671_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
AVS06665.1|1829687_1830074_-	iron-sulfur cluster scaffold-like protein	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
AVS06666.1|1830101_1831316_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 126
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1846452	1847964	4815114		Staphylococcus_phage(100.0%)	1	NA	NA
AVS06682.1|1846452_1847964_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	1.9e-13
>prophage 127
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1853856	1865146	4815114		Bacillus_phage(50.0%)	7	NA	NA
AVS06686.1|1853856_1855110_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
AVS06687.1|1855437_1856628_+	flavohemoprotein	NA	NA	NA	NA	NA
AVS06688.1|1856672_1857011_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
AVS06689.1|1857071_1858406_-	transcriptional regulator	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
AVS06690.1|1858395_1859109_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AVS06691.1|1859273_1860701_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	2.3e-16
AVS06692.1|1861258_1865146_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	5.9e-131
>prophage 128
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1869265	1869526	4815114		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVS06698.1|1869265_1869526_+	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 129
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1872985	1876727	4815114		Tetraselmis_virus(50.0%)	4	NA	NA
AVS06705.1|1872985_1873666_-	ribonuclease 3	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
AVS06706.1|1873609_1873888_+	hypothetical protein	NA	NA	NA	NA	NA
AVS06707.1|1873937_1874912_-	S26 family signal peptidase	NA	NA	NA	NA	NA
AVS06708.1|1874927_1876727_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 130
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1882498	1888757	4815114		Cafeteria_roenbergensis_virus(25.0%)	8	NA	NA
AVS06715.1|1882498_1883833_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
AVS06716.1|1884041_1884923_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS06717.1|1885025_1885613_+	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AVS06718.1|1885668_1886052_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
AVS06719.1|1886356_1887046_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
AVS06720.1|1887093_1888131_-	methyltransferase	NA	NA	NA	NA	NA
AVS06721.1|1888120_1888324_-	hypothetical protein	NA	NA	NA	NA	NA
AVS06722.1|1888337_1888757_+	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 131
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1894050	1895349	4815114		Burkholderia_virus(100.0%)	1	NA	NA
AVS06726.1|1894050_1895349_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 132
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1901215	1903789	4815114		Enterobacteria_phage(100.0%)	1	NA	NA
AVS06728.1|1901215_1903789_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 133
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1909695	1910766	4815114		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AVS06736.1|1909695_1910766_-	phospho-2-dehydro-3-deoxyheptonate aldolase Tyr-sensitive	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 134
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1924511	1924994	4815114		Staphylococcus_phage(100.0%)	1	NA	NA
AVS06753.1|1924511_1924994_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 135
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1930650	1930869	4815114		Salmonella_phage(100.0%)	1	NA	NA
AVS06755.1|1930650_1930869_-	DNA invertase	NA	A0A1S6L009	Salmonella_phage	70.0	4.1e-10
>prophage 136
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1934367	1936410	4815114	integrase	Klebsiella_phage(50.0%)	2	1926582:1926597	1942168:1942183
1926582:1926597	attL	GCATCAAATACCAACG	NA	NA	NA	NA
AVS06759.1|1934367_1935684_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.6	3.9e-34
AVS06760.1|1935813_1936410_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	86.9	3.6e-96
1942168:1942183	attR	CGTTGGTATTTGATGC	NA	NA	NA	NA
>prophage 137
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1944232	1960703	4815114	transposase	Moraxella_phage(33.33%)	9	NA	NA
AVS09444.1|1944232_1945885_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.4	2.2e-39
AVS06768.1|1945894_1946422_+	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
AVS06769.1|1946437_1955677_+	filamentous hemagglutinin	NA	A0A0R6PJK4	Moraxella_phage	39.6	8.7e-56
AVS06770.1|1955676_1956012_+	hypothetical protein	NA	NA	NA	NA	NA
AVS09445.1|1957593_1957704_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AVS06771.1|1957717_1958740_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	9.2e-201
AVS06772.1|1958736_1959519_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
AVS06773.1|1959930_1960281_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.8e-40
AVS06774.1|1960277_1960703_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	1.7e-47
>prophage 138
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1964248	1967463	4815114		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
AVS06777.1|1964248_1965802_-	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	21.5	1.4e-06
AVS06778.1|1965798_1967463_-	DNA methyltransferase	NA	A0A1V0SLK8	Klosneuvirus	30.6	4.7e-29
>prophage 139
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1980435	2020821	4815114	portal,tail,capsid,terminase,head,transposase,protease	uncultured_Caudovirales_phage(50.0%)	47	NA	NA
AVS06791.1|1980435_1981598_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AVS06792.1|1982020_1982239_+	hypothetical protein	NA	NA	NA	NA	NA
AVS06793.1|1982461_1982932_-	peptidase	NA	NA	NA	NA	NA
AVS06794.1|1982918_1984688_-	hypothetical protein	NA	NA	NA	NA	NA
AVS06795.1|1984687_1985986_-	hypothetical protein	NA	NA	NA	NA	NA
AVS06796.1|1985985_1987056_-	patatin	NA	A0A1B2LRS3	Wolbachia_phage	31.6	1.7e-19
AVS06797.1|1987987_1988413_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	78.4	3.0e-36
AVS06798.1|1988616_1989588_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AVS06799.1|1989738_1989921_-	hypothetical protein	NA	NA	NA	NA	NA
AVS06800.1|1990251_1991124_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
AVS06801.1|1991495_1994342_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
AVS06802.1|1994452_1996846_+	dGTPase	NA	NA	NA	NA	NA
AVS06803.1|1996842_1997748_+	chemotaxis protein	NA	NA	NA	NA	NA
AVS06804.1|1997744_1998815_+	phospholipase	NA	NA	NA	NA	NA
AVS06805.1|1998949_1999156_+	hypothetical protein	NA	NA	NA	NA	NA
AVS06806.1|1999231_1999456_+	hypothetical protein	NA	NA	NA	NA	NA
AVS09449.1|1999642_1999882_+	hypothetical protein	NA	A0A1B2IAG5	Erwinia_phage	47.5	2.0e-13
AVS06807.1|1999900_2000383_+	hypothetical protein	NA	NA	NA	NA	NA
AVS06808.1|2000613_2000721_+	cytoplasmic protein	NA	NA	NA	NA	NA
AVS06809.1|2000741_2001560_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	5.5e-47
AVS06810.1|2001892_2002324_-	hypothetical protein	NA	NA	NA	NA	NA
AVS06811.1|2002986_2003451_+	restriction endonuclease	NA	A9J566	Pseudomonas_phage	32.1	2.9e-13
AVS09450.1|2003496_2003943_+	hypothetical protein	NA	NA	NA	NA	NA
AVS06812.1|2004011_2004614_+	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	33.3	4.5e-22
AVS06813.1|2004663_2005032_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AVS06814.1|2005121_2005499_+	toxin	NA	NA	NA	NA	NA
AVS06815.1|2005495_2005984_+	hypothetical protein	NA	NA	NA	NA	NA
AVS06816.1|2005995_2006193_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AVS09451.1|2006277_2007123_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AVS06817.1|2007448_2008870_+	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
AVS06818.1|2008866_2009667_+	hypothetical protein	NA	NA	NA	NA	NA
AVS09452.1|2009808_2009997_+	DNA-binding protein	NA	NA	NA	NA	NA
AVS06819.1|2010007_2010211_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	2.1e-16
AVS06820.1|2010219_2010882_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AVS06821.1|2010874_2011195_+	hypothetical protein	NA	NA	NA	NA	NA
AVS06822.1|2011201_2011501_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AVS06823.1|2011497_2013621_+	DNA primase	NA	A0A1W6JPG0	Morganella_phage	50.2	1.5e-173
AVS06824.1|2013832_2014255_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AVS06825.1|2014272_2014521_+	hypothetical protein	NA	NA	NA	NA	NA
AVS06826.1|2014795_2015965_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	76.5	3.5e-164
AVS06827.1|2016019_2016580_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.9	2.6e-88
AVS06828.1|2016581_2017796_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	87.6	9.9e-210
AVS06829.1|2017788_2018091_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	61.1	1.4e-27
AVS06830.1|2018090_2018531_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	76.0	9.1e-65
AVS09453.1|2018523_2018700_+	hypothetical protein	NA	NA	NA	NA	NA
AVS06831.1|2018819_2019176_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	82.9	2.3e-50
AVS06832.1|2019159_2020821_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.6	1.5e-277
>prophage 140
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2029367	2033419	4815114		Klosneuvirus(50.0%)	4	NA	NA
AVS06838.1|2029367_2030648_+	4-aminobutyrate aminotransferase GabT	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
AVS06839.1|2030885_2032286_+	GABA permease	NA	NA	NA	NA	NA
AVS06840.1|2032306_2032969_+	transcriptional regulator	NA	NA	NA	NA	NA
AVS06841.1|2032969_2033419_-	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 141
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2037355	2042650	4815114		Oenococcus_phage(20.0%)	5	NA	NA
AVS06849.1|2037355_2037601_+	NrdH-redoxin	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
AVS06850.1|2037597_2038008_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
AVS06851.1|2037980_2040125_+	ribonucleotide-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
AVS06852.1|2040134_2041094_+	ribonucleoside-diphosphate reductase 2 subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
AVS06853.1|2041447_2042650_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 142
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2055600	2060986	4815114	tRNA	Vibrio_phage(25.0%)	5	NA	NA
AVS06866.1|2055600_2055786_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AVS06867.1|2056020_2058651_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
AVS06868.1|2058778_2059279_-	regulatory protein RecX	NA	NA	NA	NA	NA
AVS06869.1|2059347_2060409_-	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
AVS06870.1|2060488_2060986_-	nicotinamide-nucleotide amidohydrolase PncC	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 143
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2066452	2067418	4815114		Tetraselmis_virus(100.0%)	1	NA	NA
AVS06878.1|2066452_2067418_+	arabinose 5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 144
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2074893	2075904	4815114		Enterobacteria_phage(100.0%)	1	NA	NA
AVS09455.1|2074893_2075904_-	transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.4	7.1e-28
>prophage 145
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2093732	2106915	4815114		Escherichia_phage(50.0%)	12	NA	NA
AVS06901.1|2093732_2096294_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
AVS06902.1|2096399_2097056_+	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
AVS06903.1|2097106_2097874_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AVS06904.1|2098069_2098978_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AVS06905.1|2098974_2100237_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
AVS06906.1|2100233_2100872_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AVS06907.1|2100876_2101653_+	hypothetical protein	NA	NA	NA	NA	NA
AVS06908.1|2101741_2103106_+	permease	NA	NA	NA	NA	NA
AVS06909.1|2103199_2104192_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AVS06910.1|2104254_2105394_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AVS06911.1|2105533_2106160_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AVS06912.1|2106153_2106915_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 146
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2110027	2112060	4815114		Tupanvirus(50.0%)	2	NA	NA
AVS06918.1|2110027_2110633_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
AVS06919.1|2110632_2112060_-	sulfate adenylyltransferase	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 147
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2128200	2128986	4815114		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AVS06934.1|2128200_2128986_-	oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 148
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2134296	2139216	4815114		Vibrio_phage(33.33%)	5	NA	NA
AVS06937.1|2134296_2134968_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
AVS06938.1|2135106_2135247_+	hypothetical protein	NA	NA	NA	NA	NA
AVS06939.1|2135260_2136133_+	TPM domain protein phosphatase	NA	NA	NA	NA	NA
AVS06940.1|2136192_2137491_-	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
AVS06941.1|2137578_2139216_-	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.2	2.3e-153
>prophage 149
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2143248	2147363	4815114		Erysipelothrix_phage(50.0%)	2	NA	NA
AVS06946.1|2143248_2144550_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.4	3.3e-38
AVS06947.1|2144606_2147363_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 150
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2154898	2155747	4815114		Vibrio_phage(100.0%)	1	NA	NA
AVS06955.1|2154898_2155747_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.7e-41
>prophage 151
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2160605	2161361	4815114		Bacillus_phage(100.0%)	1	NA	NA
AVS06959.1|2160605_2161361_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	6.5e-10
>prophage 152
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2172888	2188436	4815114	tRNA	Bacillus_phage(33.33%)	9	NA	NA
AVS06971.1|2172888_2174094_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	3.0e-73
AVS06972.1|2174093_2174537_+	sulfur acceptor protein CsdE	NA	NA	NA	NA	NA
AVS06973.1|2174587_2175394_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
AVS06974.1|2175632_2176730_-	murein transglycosylase A	NA	NA	NA	NA	NA
AVS06975.1|2177308_2178562_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
AVS06976.1|2178793_2180125_+	N-acetylglutamate synthase	NA	NA	NA	NA	NA
AVS06977.1|2180186_2182013_-	RecBCD enzyme subunit RecD	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
AVS06978.1|2182012_2185555_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.9	1.5e-08
AVS06979.1|2185547_2188436_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	2.6e-67
>prophage 153
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2193912	2200685	4815114		Geobacillus_virus(33.33%)	6	NA	NA
AVS06985.1|2193912_2194707_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
AVS06986.1|2194713_2195589_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AVS06987.1|2195739_2197986_-	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
AVS06988.1|2197998_2198529_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AVS06989.1|2199213_2199903_+	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
AVS06990.1|2199971_2200685_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 154
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2210315	2212810	4815114		Aichi_virus(50.0%)	2	NA	NA
AVS06999.1|2210315_2211734_-	arabinose-proton symporter	NA	O13311	Aichi_virus	26.9	1.8e-24
AVS07000.1|2212048_2212810_-	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 155
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2218764	2220037	4815114	transposase	Shigella_phage(100.0%)	1	NA	NA
AVS07005.1|2218764_2220037_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	8.0e-170
>prophage 156
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2228046	2229209	4815114	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
AVS07018.1|2228046_2229209_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
>prophage 157
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2238935	2239691	4815114		Clostridium_phage(100.0%)	1	NA	NA
AVS07031.1|2238935_2239691_-	hypothetical protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 158
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2246497	2254873	4815114	tRNA	Enterobacteria_phage(20.0%)	8	NA	NA
AVS07037.1|2246497_2247946_+	uric acid transporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
AVS07038.1|2247947_2248073_+	hypothetical protein	NA	NA	NA	NA	NA
AVS07039.1|2248195_2248744_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AVS07040.1|2248786_2250304_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	7.7e-87
AVS07041.1|2250313_2251412_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
AVS07042.1|2251502_2253236_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	5.4e-60
AVS07043.1|2253241_2253952_-	thiol:disulfide interchange protein DsbC	NA	NA	NA	NA	NA
AVS07044.1|2253976_2254873_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 159
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2258791	2263270	4815114		Pandoravirus(50.0%)	2	NA	NA
AVS07051.1|2258791_2260231_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.4	3.0e-32
AVS07052.1|2260396_2263270_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.8e-263
>prophage 160
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2271405	2272638	4815114		Catovirus(100.0%)	1	NA	NA
AVS07062.1|2271405_2272638_-	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 161
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2300933	2302088	4815114		Staphylococcus_phage(100.0%)	1	NA	NA
AVS07090.1|2300933_2302088_+	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 162
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2355709	2356882	4815114		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
AVS07144.1|2355709_2356882_+	aminotransferase class V-fold PLP-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	5.5e-40
>prophage 163
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2379093	2379978	4815114		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AVS07168.1|2379093_2379978_+	SDR family NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	4.8e-65
>prophage 164
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2386054	2395405	4815114		Staphylococcus_phage(33.33%)	7	NA	NA
AVS07176.1|2386054_2386882_+	2,5-diketo-D-gluconic acid reductase A	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
AVS07177.1|2387081_2388008_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AVS07178.1|2388058_2388316_+	hypothetical protein	NA	NA	NA	NA	NA
AVS07179.1|2388358_2390578_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
AVS07180.1|2390688_2392101_-	cell division protein FtsP	NA	NA	NA	NA	NA
AVS07181.1|2392175_2392913_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AVS07182.1|2393146_2395405_-	DNA topoisomerase 4 subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
>prophage 165
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2398715	2399108	4815114		Stx_converting_phage(100.0%)	1	NA	NA
AVS07188.1|2398715_2399108_-	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 166
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2402935	2413898	4815114		Bacillus_virus(20.0%)	13	NA	NA
AVS07194.1|2402935_2404828_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
AVS07195.1|2404856_2405438_-	esterase YqiA	NA	NA	NA	NA	NA
AVS07196.1|2405437_2406265_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
AVS07197.1|2406289_2406712_-	dehydrogenase	NA	NA	NA	NA	NA
AVS07198.1|2406712_2407342_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
AVS07199.1|2407546_2409028_+	outer membrane protein TolC	NA	NA	NA	NA	NA
AVS07200.1|2409027_2409288_+	hypothetical protein	NA	NA	NA	NA	NA
AVS07201.1|2409175_2409847_+	DUF1190 domain-containing protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
AVS07202.1|2409852_2411013_+	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
AVS07203.1|2411050_2411839_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
AVS07204.1|2411981_2412755_+	zinc transporter ZupT	NA	NA	NA	NA	NA
AVS07205.1|2412812_2412983_-	DUF4051 domain-containing protein	NA	NA	NA	NA	NA
AVS07206.1|2413244_2413898_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 167
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2423415	2424849	4815114		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVS07216.1|2423415_2424849_-	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 168
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2429986	2456157	4815114	portal,tail,capsid,terminase,head,protease,tRNA	uncultured_Caudovirales_phage(61.54%)	31	NA	NA
AVS07220.1|2429986_2431225_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
AVS07221.1|2431405_2432227_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AVS07222.1|2432317_2432686_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
AVS07223.1|2432790_2433408_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AVS07224.1|2433420_2434353_-	transcriptional activator TtdR	NA	NA	NA	NA	NA
AVS07225.1|2434559_2435471_+	L+-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
AVS07226.1|2435467_2436073_+	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
AVS07227.1|2436120_2437584_+	L-tartrate/succinate antiporter	NA	NA	NA	NA	NA
AVS07228.1|2437626_2438640_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
AVS07229.1|2438648_2438879_-	hypothetical protein	NA	NA	NA	NA	NA
AVS07230.1|2438877_2439093_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVS07231.1|2439203_2440949_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
AVS07232.1|2440962_2441085_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AVS07233.1|2441143_2442985_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
AVS07234.1|2443063_2443570_-	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AVS07235.1|2445053_2445347_-	hypothetical protein	NA	NA	NA	NA	NA
AVS07236.1|2445343_2447005_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.6	1.5e-277
AVS07237.1|2446988_2447345_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	82.9	2.3e-50
AVS09467.1|2447464_2447641_-	hypothetical protein	NA	NA	NA	NA	NA
AVS07238.1|2447633_2448074_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	76.0	9.1e-65
AVS07239.1|2448073_2448376_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	61.1	1.4e-27
AVS07240.1|2448368_2449583_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	87.6	9.9e-210
AVS07241.1|2449584_2450145_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.9	2.6e-88
AVS07242.1|2450199_2451369_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	76.5	3.5e-164
AVS07243.1|2451643_2451892_-	hypothetical protein	NA	NA	NA	NA	NA
AVS07244.1|2451909_2452332_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AVS07245.1|2452543_2454667_-	DNA primase	NA	A0A1W6JPG0	Morganella_phage	50.2	1.5e-173
AVS07246.1|2454663_2454963_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AVS07247.1|2454969_2455290_-	hypothetical protein	NA	NA	NA	NA	NA
AVS07248.1|2455282_2455945_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AVS07249.1|2455953_2456157_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	2.1e-16
>prophage 169
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2460824	2468994	4815114	tRNA	Salmonella_phage(33.33%)	7	NA	NA
AVS07254.1|2460824_2462345_-	aerotaxis receptor	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
AVS07255.1|2462620_2462827_+	hypothetical protein	NA	NA	NA	NA	NA
AVS07256.1|2462762_2464142_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.0e-33
AVS07257.1|2464183_2464516_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
AVS07258.1|2464622_2464805_+	hypothetical protein	NA	NA	NA	NA	NA
AVS07259.1|2464734_2465718_+	transcriptional regulator	NA	NA	NA	NA	NA
AVS07260.1|2465901_2468994_+	evolved beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	2.5e-156
>prophage 170
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2481849	2482815	4815114		Escherichia_phage(100.0%)	1	NA	NA
AVS07272.1|2481849_2482815_+	hypothetical protein	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 171
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2503393	2505688	4815114		Tetraselmis_virus(100.0%)	1	NA	NA
AVS07295.1|2503393_2505688_-	PFL-like enzyme TdcE	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 172
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2513892	2515038	4815114		Streptococcus_phage(100.0%)	1	NA	NA
AVS07301.1|2513892_2515038_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 173
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2539600	2547394	4815114		Streptococcus_phage(25.0%)	10	NA	NA
AVS07324.1|2539600_2540461_-	rRNA (cytidine-2'-O-)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
AVS07325.1|2540525_2542562_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
AVS07326.1|2542519_2542915_+	YraN family protein	NA	NA	NA	NA	NA
AVS07327.1|2542934_2543525_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
AVS07328.1|2543534_2544110_+	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AVS07329.1|2544223_2545264_-	permease	NA	NA	NA	NA	NA
AVS07330.1|2545336_2545972_-	hypothetical protein	NA	NA	NA	NA	NA
AVS07331.1|2546099_2546618_+	glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
AVS07332.1|2546597_2547041_-	hypothetical protein	NA	NA	NA	NA	NA
AVS07333.1|2547091_2547394_+	GIY-YIG nuclease family protein	NA	F2NZ06	Diadromus_pulchellus_ascovirus	53.8	7.8e-15
>prophage 174
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2553096	2554986	4815114		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVS07340.1|2553096_2554986_-	DEAD/DEAH box family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 175
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2560467	2567106	4815114		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
AVS07347.1|2560467_2563140_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
AVS07348.1|2563164_2564652_-	transcription termination protein NusA	NA	NA	NA	NA	NA
AVS09472.1|2564679_2565132_-	ribosome maturation factor	NA	NA	NA	NA	NA
AVS07349.1|2565762_2567106_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 176
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2571188	2574061	4815114	protease	Pandoravirus(50.0%)	2	NA	NA
AVS07353.1|2571188_2572037_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
AVS07354.1|2572126_2574061_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 177
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2580835	2581807	4815114		Indivirus(100.0%)	1	NA	NA
AVS07363.1|2580835_2581807_+	octaprenyl-diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 178
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2586381	2601176	4815114		Staphylococcus_phage(25.0%)	17	NA	NA
AVS07368.1|2586381_2587191_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
AVS07369.1|2587400_2588378_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
AVS07370.1|2588391_2589378_+	arabinose 5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
AVS07371.1|2589398_2589965_+	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
AVS07372.1|2589961_2590537_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AVS07373.1|2590505_2591063_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AVS07374.1|2591069_2591795_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
AVS07375.1|2591842_2593276_+	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AVS07376.1|2593298_2593586_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
AVS07377.1|2593703_2594195_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AVS07378.1|2594240_2595095_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
AVS07379.1|2595091_2595364_+	phosphocarrier protein NPr	NA	NA	NA	NA	NA
AVS07380.1|2595577_2596210_+	protein YrbL	NA	NA	NA	NA	NA
AVS07381.1|2596206_2596935_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AVS07382.1|2596931_2597585_-	glutamine amidotransferase	NA	NA	NA	NA	NA
AVS07383.1|2597814_2600151_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
AVS09475.1|2600246_2601176_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 179
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2613753	2618501	4815114		Salmonella_phage(50.0%)	5	NA	NA
AVS07393.1|2613753_2614881_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
AVS07394.1|2614940_2615405_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
AVS07395.1|2615401_2616277_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
AVS07396.1|2616273_2616963_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
AVS07397.1|2617010_2618501_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 180
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2622205	2622703	4815114		Pseudomonas_phage(100.0%)	1	NA	NA
AVS07401.1|2622205_2622703_-	stringent starvation protein B	NA	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 181
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2626669	2629194	4815114	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AVS07407.1|2626669_2628037_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	8.7e-21
AVS07408.1|2628126_2629194_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 182
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2645970	2647014	4815114		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVS07423.1|2645970_2647014_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 183
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2657579	2658455	4815114		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVS07435.1|2657579_2658455_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	28.9	2.9e-22
>prophage 184
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2664959	2669113	4815114		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AVS07443.1|2664959_2665985_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
AVS07444.1|2666052_2667234_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVS07445.1|2667243_2668347_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVS07446.1|2668354_2669113_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
>prophage 185
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2679608	2681080	4815114	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
AVS07454.1|2679608_2680118_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
AVS07455.1|2680132_2681080_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 186
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2702295	2704248	4815114		Vibrio_phage(100.0%)	1	NA	NA
AVS07493.1|2702295_2704248_+	type II secretion system protein GspD	NA	R9TEZ5	Vibrio_phage	30.9	7.0e-32
>prophage 187
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2713078	2721637	4815114		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
AVS07506.1|2713078_2715772_-	lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	35.7	1.5e-40
AVS07507.1|2716063_2717248_-	translation elongation factor EF-Tu 1	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
AVS07508.1|2717318_2719433_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
AVS07509.1|2719529_2720000_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
AVS07510.1|2720096_2720471_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
AVS07511.1|2720596_2720884_-	sulfurtransferase TusB	NA	NA	NA	NA	NA
AVS07512.1|2720891_2721251_-	sulfurtransferase TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
AVS07513.1|2721250_2721637_-	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
>prophage 188
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2727207	2736748	4815114		Tupanvirus(25.0%)	10	NA	NA
AVS07522.1|2727207_2729121_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
AVS07523.1|2729120_2730143_+	hydrolase	NA	NA	NA	NA	NA
AVS07524.1|2730136_2730355_+	hypothetical protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
AVS07525.1|2730408_2731278_+	phosphoribulokinase	NA	NA	NA	NA	NA
AVS07526.1|2731332_2731737_-	OsmC family protein	NA	NA	NA	NA	NA
AVS07527.1|2731816_2732032_+	hypothetical protein	NA	NA	NA	NA	NA
AVS07528.1|2732038_2732671_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AVS07529.1|2732709_2734812_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
AVS07530.1|2734878_2736099_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AVS07531.1|2736184_2736748_-	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 189
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2760996	2761833	4815114		Vibrio_phage(100.0%)	1	NA	NA
AVS07556.1|2760996_2761833_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 190
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2778737	2782504	4815114		Bacillus_phage(66.67%)	3	NA	NA
AVS07571.1|2778737_2780360_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
AVS07572.1|2780435_2781788_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
AVS07573.1|2781784_2782504_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 191
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2789086	2789965	4815114	transposase	Sodalis_phage(100.0%)	1	NA	NA
AVS07579.1|2789086_2789965_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	52.8	2.5e-69
>prophage 192
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2795999	2798393	4815114		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AVS07585.1|2795999_2798393_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 193
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2802772	2803999	4815114		Ralstonia_phage(100.0%)	1	NA	NA
AVS07587.1|2802772_2803999_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	4.0e-134
>prophage 194
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2810053	2812501	4815114		Dickeya_phage(100.0%)	1	NA	NA
AVS07594.1|2810053_2812501_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 195
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2832870	2834681	4815114		Enterococcus_phage(50.0%)	2	NA	NA
AVS07610.1|2832870_2833614_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	2.9e-10
AVS07611.1|2833610_2834681_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 196
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2838222	2839705	4815114		Planktothrix_phage(50.0%)	2	NA	NA
AVS07615.1|2838222_2838936_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
AVS07616.1|2838937_2839705_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 197
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2845439	2848258	4815114		Salicola_phage(50.0%)	3	NA	NA
AVS07622.1|2845439_2846294_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	2.7e-44
AVS07623.1|2846538_2847597_-	ABC transporter permease	NA	NA	NA	NA	NA
AVS07624.1|2847589_2848258_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 198
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2851264	2855396	4815114		Dickeya_phage(50.0%)	4	NA	NA
AVS07629.1|2851264_2851891_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
AVS07630.1|2851964_2854163_+	cadmium-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	38.4	8.5e-119
AVS07631.1|2854264_2854510_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
AVS07632.1|2854730_2855396_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
>prophage 199
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2863289	2868941	4815114		Bacillus_virus(50.0%)	3	NA	NA
AVS07641.1|2863289_2864096_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-17
AVS07642.1|2864101_2864503_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
AVS07643.1|2864705_2868941_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	9.6e-26
>prophage 200
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2872316	2875052	4815114		Staphylococcus_phage(100.0%)	1	NA	NA
AVS07648.1|2872316_2875052_-	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
>prophage 201
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2888654	2890697	4815114		Indivirus(100.0%)	1	NA	NA
AVS07660.1|2888654_2890697_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 202
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2894042	2896177	4815114		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
AVS07665.1|2894042_2894396_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
AVS07666.1|2894449_2895739_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
AVS07667.1|2895751_2896177_+	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
>prophage 203
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2899570	2900218	4815114		Bacillus_virus(100.0%)	1	NA	NA
AVS09484.1|2899570_2900218_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 204
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2946179	2948164	4815114		Bacillus_virus(50.0%)	2	NA	NA
AVS07707.1|2946179_2947184_-	dipeptide transport ATP-binding protein DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
AVS07708.1|2947180_2948164_-	dipeptide transport ATP-binding protein DppD	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 205
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2958208	2960542	4815114		Escherichia_phage(100.0%)	1	NA	NA
AVS07719.1|2958208_2960542_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	2.7e-70
>prophage 206
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2964196	2966196	4815114	transposase	Morganella_phage(50.0%)	3	NA	NA
AVS07724.1|2964196_2964409_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
AVS07725.1|2964595_2964748_-	protein HokA	NA	NA	NA	NA	NA
AVS07726.1|2964827_2966196_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
>prophage 207
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2970034	2971030	4815114		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AVS07730.1|2970034_2971030_+	O-acetyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 208
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2976348	2977890	4815114		Staphylococcus_phage(100.0%)	1	NA	NA
AVS07736.1|2976348_2977890_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 209
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2994745	3004895	4815114	tRNA	uncultured_Caudovirales_phage(66.67%)	6	NA	NA
AVS07751.1|2994745_2996590_-|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	26.7	5.6e-15
AVS07752.1|2996586_2997978_-|tRNA	L-selenocysteinyl-tRNA(Sec) synthase	tRNA	NA	NA	NA	NA
AVS07753.1|2998075_2998684_-	glutathione S-transferase	NA	NA	NA	NA	NA
AVS07754.1|2998912_3003046_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.1e-25
AVS07755.1|3003066_3003909_+	lyase	NA	NA	NA	NA	NA
AVS07756.1|3003956_3004895_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	46.7	1.7e-23
>prophage 210
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3026816	3038806	4815114	transposase	Rhizobium_phage(14.29%)	10	NA	NA
AVS07776.1|3026816_3027068_-	glutaredoxin	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
AVS07777.1|3027209_3027641_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AVS07778.1|3027885_3029430_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVS07779.1|3029439_3030723_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
AVS07780.1|3030726_3031686_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AVS07781.1|3031672_3032707_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
AVS07782.1|3032945_3033971_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
AVS07783.1|3033980_3035177_-	2-amino-3-ketobutyrate CoA ligase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
AVS07784.1|3035633_3036795_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AVS07785.1|3037873_3038806_+	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
>prophage 211
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3053711	3058274	4815114		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
AVS07800.1|3053711_3054191_+	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
AVS07801.1|3054229_3055039_-	formamidopyrimidine-DNA glycosylase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
AVS07802.1|3055136_3055304_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AVS07803.1|3055324_3055561_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AVS07804.1|3055777_3056446_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AVS07805.1|3056617_3057838_+	bifunctional phosphopantothenoylcysteine decarboxylase CoaC/phosphopantothenate--cysteine ligase CoaB	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
AVS09488.1|3057818_3058274_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	Q2NP83	Xanthomonas_phage	59.5	1.2e-48
>prophage 212
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3061647	3068397	4815114		Morganella_phage(25.0%)	6	NA	NA
AVS07811.1|3061647_3062472_+	DNA-damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	78.9	1.0e-96
AVS07812.1|3062762_3063380_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
AVS07813.1|3063376_3065059_-	DNA ligase B	NA	F8SJM3	Pseudomonas_phage	22.3	1.5e-22
AVS07814.1|3065316_3065940_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
AVS07815.1|3065994_3066270_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AVS07816.1|3066288_3068397_+	bifunctional (p)ppGpp synthetase II/ guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 213
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3072833	3074225	4815114		environmental_Halophage(100.0%)	1	NA	NA
AVS07820.1|3072833_3074225_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 214
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3080504	3081722	4815114	integrase	Enterobacteria_phage(100.0%)	1	3072586:3072602	3096620:3096636
3072586:3072602	attL	ATACTCGTCATACTTCA	NA	NA	NA	NA
AVS07824.1|3080504_3081722_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	69.7	5.0e-161
AVS07824.1|3080504_3081722_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	69.7	5.0e-161
3096620:3096636	attR	TGAAGTATGACGAGTAT	NA	NA	NA	NA
>prophage 215
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3084764	3085885	4815114	transposase	Leptospira_phage(100.0%)	1	NA	NA
AVS07826.1|3084764_3085885_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	2.3e-51
>prophage 216
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3088890	3098163	4815114		Escherichia_phage(33.33%)	4	NA	NA
AVS07828.1|3088890_3090579_-	site-specific DNA-methyltransferase	NA	H6W8D6	Escherichia_phage	60.3	1.4e-153
AVS07829.1|3092518_3095413_-	ATP-dependent helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	53.8	3.4e-285
AVS07830.1|3095399_3095600_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AVS07831.1|3097923_3098163_-	hypothetical protein	NA	A0A1V0E8E5	Vibrio_phage	44.4	5.2e-06
>prophage 217
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3101463	3103603	4815114	transposase	Shigella_phage(50.0%)	2	NA	NA
AVS07836.1|3101463_3102737_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
AVS07837.1|3102820_3103603_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.9	7.1e-44
>prophage 218
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3112127	3113462	4815114		Moraxella_phage(100.0%)	1	NA	NA
AVS09491.1|3112127_3113462_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	1.1e-65
>prophage 219
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3120766	3129786	4815114		Ostreococcus_lucimarinus_virus(25.0%)	13	NA	NA
AVS07856.1|3120766_3122455_-	acetolactate synthase large subunit	NA	G9E4W7	Ostreococcus_lucimarinus_virus	28.0	5.9e-19
AVS07857.1|3122560_3122659_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AVS07858.1|3122931_3123090_+	hypothetical protein	NA	NA	NA	NA	NA
AVS07859.1|3123112_3123226_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
AVS07860.1|3123222_3123312_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AVS07861.1|3123369_3123552_+	hypothetical protein	NA	NA	NA	NA	NA
AVS07862.1|3123591_3124776_+	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
AVS07863.1|3124783_3125281_-	radical SAM protein	NA	NA	NA	NA	NA
AVS07864.1|3125277_3125640_-	hypothetical protein	NA	NA	NA	NA	NA
AVS07865.1|3125629_3125977_-	hypothetical protein	NA	NA	NA	NA	NA
AVS07866.1|3126084_3126534_+	hypothetical protein	NA	NA	NA	NA	NA
AVS07867.1|3126580_3128074_-	DUF4976 domain-containing protein	NA	A0A2K9L1A5	Tupanvirus	25.6	2.3e-30
AVS07868.1|3128070_3129786_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 220
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3136138	3137092	4815114		Synechococcus_phage(50.0%)	2	NA	NA
AVS07873.1|3136138_3136567_-	heat-shock protein IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
AVS07874.1|3136678_3137092_-	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 221
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3141519	3142668	4815114		Oenococcus_phage(100.0%)	1	NA	NA
AVS07878.1|3141519_3142668_-	D-galactonate dehydratase 2	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 222
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3147374	3154743	4815114		Bacillus_virus(33.33%)	8	NA	NA
AVS07884.1|3147374_3149789_-	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
AVS07885.1|3149817_3150891_-	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
AVS07886.1|3150890_3151991_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
AVS07887.1|3151995_3153399_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AVS07888.1|3153692_3153893_-	hypothetical protein	NA	NA	NA	NA	NA
AVS07889.1|3154005_3154146_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
AVS07890.1|3154162_3154522_+	ribonuclease P protein component	NA	NA	NA	NA	NA
AVS07891.1|3154485_3154743_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 223
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3164941	3166279	4815114		Moraxella_phage(100.0%)	1	NA	NA
AVS07900.1|3164941_3166279_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 224
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3177264	3184872	4815114		Bacillus_phage(25.0%)	6	NA	NA
AVS07912.1|3177264_3178038_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
AVS07913.1|3178220_3179111_-	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AVS07914.1|3179110_3180070_-	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AVS07915.1|3180156_3181197_-	phosphate-binding protein	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
AVS07916.1|3181510_3183340_-	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
AVS07917.1|3183501_3184872_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	2.4e-34
>prophage 225
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3196826	3197819	4815114		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AVS07931.1|3196826_3197819_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.9e-50
>prophage 226
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3200987	3206840	4815114		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
AVS07934.1|3200987_3202856_+	low affinity potassium transport system protein kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
AVS09495.1|3203022_3203442_+	D-ribose pyranase	NA	NA	NA	NA	NA
AVS07935.1|3203449_3204955_+	ribose import ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
AVS07936.1|3204959_3205925_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
AVS07937.1|3205949_3206840_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 227
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3220232	3221879	4815114		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVS07945.1|3220232_3221879_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	1.6e-66
>prophage 228
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3230311	3235723	4815114		Bacillus_phage(33.33%)	5	NA	NA
AVS07954.1|3230311_3232333_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
AVS07955.1|3232379_3233864_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
AVS07956.1|3233869_3233992_-	addiction module toxin RelE	NA	NA	NA	NA	NA
AVS07957.1|3233997_3235263_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
AVS07958.1|3235393_3235723_+	thiol reductase thioredoxin	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 229
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3239765	3245909	4815114		Enterobacteria_phage(40.0%)	6	NA	NA
AVS07964.1|3239765_3240896_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
AVS07965.1|3240892_3242155_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
AVS07966.1|3242154_3243222_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	3.0e-101
AVS07967.1|3243240_3244122_+	glucose-1-phosphate thymidylyltransferase 2	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
AVS07968.1|3244099_3244774_+	dTDP-fucosamine acetyltransferase	NA	NA	NA	NA	NA
AVS07969.1|3244778_3245909_+	dTDP-4-amino-4,6-dideoxygalactose aminotransferase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 230
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3253993	3255649	4815114		Tetraselmis_virus(100.0%)	1	NA	NA
AVS07976.1|3253993_3255649_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.5	3.0e-44
>prophage 231
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3265958	3269817	4815114		Bacillus_phage(100.0%)	3	NA	NA
AVS07987.1|3265958_3266855_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
AVS07988.1|3266854_3267571_+	flavin mononucleotide phosphatase YigB	NA	NA	NA	NA	NA
AVS07989.1|3267654_3269817_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 232
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3275535	3277365	4815114		Catovirus(100.0%)	1	NA	NA
AVS09498.1|3275535_3277365_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 233
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3289897	3293184	4815114		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
AVS08010.1|3289897_3291538_+	ubiquinone biosynthesis protein UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
AVS08011.1|3291616_3291886_+	Sec-independent protein translocase protein TatA	NA	NA	NA	NA	NA
AVS08012.1|3291889_3292405_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AVS08013.1|3292407_3293184_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 234
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3302065	3302680	4815114		Streptococcus_phage(100.0%)	1	NA	NA
AVS08021.1|3302065_3302680_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 235
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3316537	3319324	4815114		uncultured_virus(100.0%)	1	NA	NA
AVS08032.1|3316537_3319324_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	2.2e-71
>prophage 236
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3323347	3325818	4815114		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
AVS09499.1|3323347_3324757_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
AVS08037.1|3324768_3325818_-	two-component system sensor histidine kinase NtrB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 237
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3333662	3407334	4815114	portal,tail,capsid,terminase,head,holin,transposase,plate,tRNA,integrase,lysis	Escherichia_phage(42.55%)	82	3376673:3376719	3407497:3407543
AVS08043.1|3333662_3334935_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
AVS08044.1|3335176_3336580_-	MFS transporter	NA	NA	NA	NA	NA
AVS08045.1|3336619_3338005_-	MFS transporter	NA	NA	NA	NA	NA
AVS08046.1|3338050_3339916_-	alpha-glucosidase	NA	NA	NA	NA	NA
AVS08047.1|3341212_3342454_-	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
AVS08048.1|3342469_3343348_-	sulfofructosephosphate aldolase	NA	NA	NA	NA	NA
AVS08049.1|3343371_3344268_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
AVS08050.1|3344435_3345332_+	sugar kinase	NA	NA	NA	NA	NA
AVS08051.1|3345365_3346151_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
AVS08052.1|3346249_3346849_+	phosphatase	NA	NA	NA	NA	NA
AVS08053.1|3346842_3347715_+	virulence factor BrkB family protein	NA	NA	NA	NA	NA
AVS08054.1|3347711_3348149_+|tRNA	D-aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AVS08055.1|3348145_3349135_+	acetyltransferase	NA	NA	NA	NA	NA
AVS09501.1|3349993_3350206_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AVS08056.1|3350447_3350666_+	hypothetical protein	NA	NA	NA	NA	NA
AVS08057.1|3350995_3351925_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
AVS08058.1|3351921_3352557_-	formate dehydrogenase cytochrome b556(fdo) subunit	NA	NA	NA	NA	NA
AVS08059.1|3352553_3353456_-	formate dehydrogenase-O iron-sulfur subunit	NA	NA	NA	NA	NA
AVS08060.1|3353468_3356519_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
AVS08061.1|3356522_3356777_+	hypothetical protein	NA	NA	NA	NA	NA
AVS08062.1|3356712_3357546_+	sulfurtransferase FdhD	NA	NA	NA	NA	NA
AVS08063.1|3357698_3358754_+	hypothetical protein	NA	NA	NA	NA	NA
AVS08064.1|3358803_3360552_-	HTH domain-containing protein	NA	NA	NA	NA	NA
AVS08065.1|3360551_3361622_-	peptidase	NA	NA	NA	NA	NA
AVS08066.1|3361611_3363063_-	fructose-like PTS system EIIBC component	NA	NA	NA	NA	NA
AVS08067.1|3363073_3363520_-	fructose-like phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AVS08068.1|3363820_3364135_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
AVS08069.1|3364144_3364969_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
AVS08070.1|3365051_3366311_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
AVS08071.1|3366307_3367777_-	rhamnulokinase	NA	NA	NA	NA	NA
AVS08072.1|3368064_3368901_+	transcriptional activator RhaS	NA	NA	NA	NA	NA
AVS08073.1|3368884_3369823_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
AVS08074.1|3369819_3370854_-	rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
AVS08075.1|3371138_3371759_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
AVS08076.1|3371933_3372041_+	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AVS08077.1|3372018_3373002_+	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AVS08078.1|3373150_3373825_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AVS08079.1|3373930_3375304_-	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.2	3.8e-16
AVS08080.1|3375300_3375999_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AVS09502.1|3376148_3376649_+	periplasmic protein CpxP	NA	NA	NA	NA	NA
3376673:3376719	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
AVS08081.1|3376834_3377815_-|integrase	integrase	integrase	U5N0A8	Enterobacteria_phage	99.7	2.3e-185
AVS08082.1|3377884_3378178_-	XRE family transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	99.0	8.8e-48
AVS08083.1|3378330_3378603_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
AVS08084.1|3378772_3379273_+	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AVS08085.1|3379336_3379561_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AVS08086.1|3379560_3379860_+	hypothetical protein	NA	S4TUD1	Salmonella_phage	100.0	8.4e-46
AVS08087.1|3379862_3380087_+	hypothetical protein	NA	A0A0F7LDI3	Escherichia_phage	97.3	6.5e-35
AVS08088.1|3380083_3380359_+	hypothetical protein	NA	S4TP00	Salmonella_phage	98.9	8.6e-45
AVS08089.1|3380348_3382646_+	replication endonuclease	NA	Q858T4	Yersinia_virus	98.0	0.0e+00
AVS09503.1|3382732_3383755_+	DNA (cytosine-5-)-methyltransferase	NA	A0A0R6PG08	Moraxella_phage	59.0	5.5e-113
AVS08090.1|3383784_3384465_-	hypothetical protein	NA	A0A0R6PER3	Moraxella_phage	31.7	9.9e-18
AVS08091.1|3384466_3385609_-	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	42.9	1.6e-73
AVS08092.1|3385982_3387017_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	4.2e-201
AVS08093.1|3387016_3388789_-	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
AVS08094.1|3388962_3389817_+|capsid	capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
AVS08095.1|3389875_3390949_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.7	1.9e-201
AVS08096.1|3390952_3391696_+|terminase	terminase	terminase	Q94MH8	Enterobacteria_phage	99.2	3.5e-125
AVS08097.1|3391795_3392305_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
AVS08098.1|3392304_3392508_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
AVS08099.1|3392511_3392793_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AVS08100.1|3392792_3393290_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AVS08101.1|3393304_3393730_+	protein lysA	NA	U5N096	Enterobacteria_phage	97.9	8.6e-60
AVS08102.1|3393717_3394143_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	97.2	2.1e-66
AVS08103.1|3394114_3394288_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
AVS08104.1|3394250_3394718_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	1.1e-81
AVS08105.1|3394710_3395163_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	1.1e-76
AVS08106.1|3395229_3395865_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	3.4e-113
AVS08107.1|3395861_3396209_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	1.9e-57
AVS08108.1|3396213_3397122_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	3.4e-162
AVS08109.1|3397114_3397726_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	2.9e-117
AVS08110.1|3398935_3399421_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	36.4	9.6e-15
AVS08111.1|3399392_3399527_-	hypothetical protein	NA	NA	NA	NA	NA
AVS08112.1|3399754_3399943_-	hypothetical protein	NA	NA	NA	NA	NA
AVS08113.1|3400278_3401469_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
AVS08114.1|3401481_3402000_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AVS08115.1|3402056_3402332_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AVS09504.1|3402364_3402484_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AVS08116.1|3402476_3404924_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	95.7	0.0e+00
AVS08117.1|3404938_3405418_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
AVS08118.1|3405417_3406581_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
AVS08119.1|3406626_3406881_+	transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AVS08120.1|3406932_3407334_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	60.0	1.1e-40
3407497:3407543	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
>prophage 238
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3418396	3422899	4815114		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
AVS08133.1|3418396_3419242_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
AVS08134.1|3419666_3419912_+	cell division protein ZapB	NA	NA	NA	NA	NA
AVS08135.1|3419996_3420482_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AVS08136.1|3420574_3421501_-	prenyltransferase	NA	NA	NA	NA	NA
AVS08137.1|3421567_3422899_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 239
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3440197	3447443	4815114		Synechococcus_phage(33.33%)	4	NA	NA
AVS08152.1|3440197_3440860_-	fructose-6-phosphate aldolase 2	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
AVS08153.1|3440871_3443373_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
AVS08154.1|3444774_3445095_+	fructose-like phosphotransferase enzyme IIB component 2	NA	NA	NA	NA	NA
AVS08155.1|3445145_3447443_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 240
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3464789	3466634	4815114		Acinetobacter_phage(100.0%)	1	NA	NA
AVS08171.1|3464789_3466634_+	vitamin B12 transporter BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 241
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3475140	3478193	4815114		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AVS08175.1|3475140_3476091_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
AVS08176.1|3476073_3476268_+	hypothetical protein	NA	NA	NA	NA	NA
AVS08177.1|3476277_3476433_-	hypothetical protein	NA	NA	NA	NA	NA
AVS08178.1|3477008_3478193_+	translation elongation factor EF-Tu 2	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 242
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3482309	3490638	4815114		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
AVS08185.1|3482309_3486338_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
AVS08186.1|3486414_3490638_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 243
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3499855	3501619	4815114		Klosneuvirus(50.0%)	3	NA	NA
AVS08197.1|3499855_3500527_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	29.2	2.8e-20
AVS08198.1|3500569_3501160_+	DUF416 domain-containing protein	NA	NA	NA	NA	NA
AVS08199.1|3501346_3501619_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 244
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3507008	3508598	4815114		Prochlorococcus_phage(100.0%)	1	NA	NA
AVS08205.1|3507008_3508598_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.9e-68
>prophage 245
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3524991	3528675	4815114		Dickeya_phage(100.0%)	1	NA	NA
AVS08214.1|3524991_3528675_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 246
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3547947	3549063	4815114		Mycoplasma_phage(100.0%)	1	NA	NA
AVS08233.1|3547947_3549063_+	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 247
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3558278	3558887	4815114		Lactococcus_phage(100.0%)	1	NA	NA
AVS08242.1|3558278_3558887_+	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 248
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3565477	3568025	4815114		Escherichia_phage(50.0%)	2	NA	NA
AVS08250.1|3565477_3566893_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
AVS08251.1|3566945_3568025_+	alanine racemase biosynthetic	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 249
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3572212	3575825	4815114		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
AVS08257.1|3572212_3575035_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
AVS08258.1|3574985_3575168_+	hypothetical protein	NA	NA	NA	NA	NA
AVS08259.1|3575288_3575825_+	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 250
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3579642	3580992	4815114		Moraxella_phage(100.0%)	1	NA	NA
AVS08268.1|3579642_3580992_+	guanine/hypoxanthine permease GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 251
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3586577	3588536	4815114		Staphylococcus_phage(100.0%)	1	NA	NA
AVS08273.1|3586577_3588536_-	acetyl-coenzyme A synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 252
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3598271	3600419	4815114		Escherichia_phage(100.0%)	1	NA	NA
AVS08284.1|3598271_3600419_-	formate dehydrogenase N subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 253
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3605664	3612033	4815114		Tetraselmis_virus(50.0%)	5	NA	NA
AVS08289.1|3605664_3607650_-	hypothetical protein	NA	A0A2P0VMX1	Tetraselmis_virus	44.8	1.9e-149
AVS08290.1|3607922_3608852_-	allose kinase	NA	NA	NA	NA	NA
AVS08291.1|3608835_3609531_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
AVS08292.1|3609541_3610522_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
AVS08293.1|3610500_3612033_-	D-allose import ATP-binding protein AlsA	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	4.8e-20
>prophage 254
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3618267	3619817	4815114		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
AVS08302.1|3618267_3618948_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	24.5	4.3e-05
AVS08303.1|3619058_3619817_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	4.7e-16
>prophage 255
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3625421	3626210	4815114		Cedratvirus(100.0%)	1	NA	NA
AVS08310.1|3625421_3626210_-	phosphonates import ATP-binding protein PhnC	NA	A0A285PWH2	Cedratvirus	30.1	6.5e-13
>prophage 256
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3631434	3632937	4815114		Burkholderia_virus(100.0%)	1	NA	NA
AVS08314.1|3631434_3632937_+	proline/betaine transporter	NA	Q6JIH2	Burkholderia_virus	31.2	1.8e-56
>prophage 257
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3654133	3717184	4815114	integrase,tRNA,transposase	Enterobacteria_phage(23.08%)	56	3663485:3663503	3717361:3717379
AVS08332.1|3654133_3655651_-|tRNA	lysine--tRNA ligase heat inducible	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
AVS08333.1|3655887_3657345_-	dipeptide and tripeptide permease C	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
AVS08334.1|3657403_3659551_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
AVS08335.1|3659630_3660965_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
AVS08336.1|3661329_3662868_-	transcriptional regulator CadC	NA	NA	NA	NA	NA
AVS08337.1|3663154_3663373_+	hypothetical protein	NA	NA	NA	NA	NA
3663485:3663503	attL	TGGTGCCCGGACTCGGAAT	NA	NA	NA	NA
AVS08338.1|3663750_3664077_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AVS08339.1|3664073_3664337_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AVS08340.1|3664408_3665275_-	restriction endonuclease subunit M	NA	NA	NA	NA	NA
AVS08341.1|3665371_3665569_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AVS08342.1|3665586_3666075_-	hypothetical protein	NA	NA	NA	NA	NA
AVS08343.1|3666071_3666449_-	toxin	NA	NA	NA	NA	NA
AVS08344.1|3666495_3666870_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AVS08345.1|3666949_3667171_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
AVS09514.1|3667233_3667680_-	hypothetical protein	NA	NA	NA	NA	NA
AVS08346.1|3667725_3668205_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
AVS08347.1|3668286_3669105_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	40.1	2.5e-47
AVS08348.1|3669194_3669428_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AVS08349.1|3669433_3670111_-	hypothetical protein	NA	NA	NA	NA	NA
AVS08350.1|3670258_3670939_-	WYL domain-containing protein	NA	NA	NA	NA	NA
AVS08351.1|3671141_3672026_-	GTPase	NA	NA	NA	NA	NA
AVS08352.1|3672210_3673341_+	hypothetical protein	NA	NA	NA	NA	NA
AVS08353.1|3674902_3675634_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AVS09515.1|3676422_3676590_+	hypothetical protein	NA	NA	NA	NA	NA
AVS08354.1|3676658_3676892_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AVS08355.1|3676929_3677160_+	hypothetical protein	NA	NA	NA	NA	NA
AVS08356.1|3677159_3677660_+	hypothetical protein	NA	NA	NA	NA	NA
AVS08357.1|3677748_3678372_+	DNA-binding protein	NA	NA	NA	NA	NA
AVS08358.1|3678550_3679764_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.8	3.4e-101
AVS08359.1|3681483_3682806_-	hypothetical protein	NA	NA	NA	NA	NA
AVS08360.1|3685136_3688082_+	hypothetical protein	NA	NA	NA	NA	NA
AVS08361.1|3689796_3690231_-	hypothetical protein	NA	NA	NA	NA	NA
AVS08362.1|3690271_3690478_-	hypothetical protein	NA	NA	NA	NA	NA
AVS08363.1|3691442_3692045_+	hypothetical protein	NA	NA	NA	NA	NA
AVS08364.1|3692054_3693038_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
AVS08365.1|3693757_3694381_+	DNA-binding protein	NA	NA	NA	NA	NA
AVS08366.1|3694708_3695185_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AVS08367.1|3695288_3696502_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.3	2.7e-167
AVS08368.1|3697071_3697278_-	hypothetical protein	NA	NA	NA	NA	NA
AVS08369.1|3697400_3697838_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
AVS08370.1|3697834_3698185_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
AVS08371.1|3698215_3699829_+|transposase	IS66 family transposase ISEc43	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
AVS08372.1|3700037_3700277_+	hypothetical protein	NA	NA	NA	NA	NA
AVS08373.1|3700366_3700753_+	hypothetical protein	NA	NA	NA	NA	NA
AVS08374.1|3700810_3701845_-	hydroxyacid dehydrogenase	NA	Q9JMN3	Wolbachia_phage	42.2	6.7e-66
AVS08375.1|3701880_3702720_-	ATP F0F1 synthase synthase	NA	NA	NA	NA	NA
AVS08376.1|3702722_3703280_-	hypothetical protein	NA	NA	NA	NA	NA
AVS08377.1|3703276_3706513_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
AVS08378.1|3706512_3707799_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AVS08379.1|3707798_3709778_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	25.6	8.4e-33
AVS08380.1|3709845_3710343_-	addiction module antitoxin	NA	NA	NA	NA	NA
AVS08381.1|3711329_3711497_-|integrase	integrase	integrase	NA	NA	NA	NA
AVS09516.1|3711734_3712481_+	porin family protein	NA	NA	NA	NA	NA
AVS08382.1|3712655_3714158_+	DUF1705 domain-containing protein	NA	NA	NA	NA	NA
AVS08383.1|3714517_3715591_-	hypothetical protein	NA	NA	NA	NA	NA
AVS08384.1|3715993_3717184_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	53.1	5.8e-122
3717361:3717379	attR	TGGTGCCCGGACTCGGAAT	NA	NA	NA	NA
>prophage 258
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3725497	3727481	4815114		Cronobacter_phage(50.0%)	2	NA	NA
AVS08391.1|3725497_3725791_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
AVS08392.1|3725834_3727481_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 259
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3731994	3732528	4815114		Morganella_phage(100.0%)	1	NA	NA
AVS08400.1|3731994_3732528_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 260
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3737448	3738426	4815114		Tupanvirus(100.0%)	1	NA	NA
AVS08406.1|3737448_3738426_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 261
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3746409	3746955	4815114		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVS08413.1|3746409_3746955_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 262
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3750870	3763901	4815114	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
AVS08417.1|3750870_3752208_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
AVS08418.1|3752217_3754065_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
AVS08419.1|3754057_3755008_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AVS08420.1|3755093_3755402_+	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AVS08421.1|3755477_3756758_+	GTPase HflX	NA	NA	NA	NA	NA
AVS08422.1|3756843_3758103_+|protease	protease modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
AVS08423.1|3758105_3759110_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
AVS08424.1|3759191_3759389_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
AVS08425.1|3759492_3760791_+	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
AVS08426.1|3760995_3761421_+	transcriptional regulator	NA	NA	NA	NA	NA
AVS08427.1|3761459_3763901_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
>prophage 263
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3767833	3768997	4815114		Ralstonia_phage(100.0%)	1	NA	NA
AVS08434.1|3767833_3768997_+	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.1e-80
>prophage 264
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3809021	3815509	4815114		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
AVS08477.1|3809021_3809552_-	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
AVS08478.1|3809861_3810818_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS08479.1|3810957_3812460_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
AVS08480.1|3812470_3813496_+	ABC transporter permease	NA	NA	NA	NA	NA
AVS08481.1|3813482_3814478_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
AVS08482.1|3814510_3815509_-	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 265
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3819824	3822585	4815114		Vibrio_phage(100.0%)	2	NA	NA
AVS08487.1|3819824_3820289_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
AVS08488.1|3820446_3822585_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
>prophage 266
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3826223	3832320	4815114		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
AVS08491.1|3826223_3827171_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
AVS09519.1|3827355_3827409_+	MgtA leader peptide	NA	NA	NA	NA	NA
AVS08492.1|3827549_3830246_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
AVS08493.1|3830451_3830838_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AVS08494.1|3830910_3831372_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AVS08495.1|3831384_3832320_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 267
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3840722	3851105	4815114	tRNA	Klosneuvirus(25.0%)	7	NA	NA
AVS08506.1|3840722_3843578_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
AVS08507.1|3843577_3844021_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AVS08508.1|3844374_3845886_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AVS08509.1|3846152_3847253_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AVS08510.1|3847252_3848335_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AVS08511.1|3848453_3849956_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	1.4e-83
AVS08512.1|3850085_3851105_-	alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	2.2e-45
>prophage 268
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3855849	3864206	4815114	transposase	Shigella_phage(40.0%)	6	NA	NA
AVS08514.1|3855849_3857012_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	1.2e-50
AVS08515.1|3857450_3857597_+	hypothetical protein	NA	Q76S41	Shigella_phage	97.8	1.2e-16
AVS08516.1|3857672_3858900_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
AVS08517.1|3859097_3860654_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	2.9e-105
AVS08518.1|3860959_3861793_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AVS08519.1|3862151_3864206_+	ATP-binding protein	NA	K4I1H4	Acidithiobacillus_phage	31.0	1.4e-27
>prophage 269
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3867242	3868223	4815114		Escherichia_phage(100.0%)	1	NA	NA
AVS08523.1|3867242_3868223_-	sialate O-acetylesterase	NA	H6WZJ9	Escherichia_phage	55.4	1.6e-101
>prophage 270
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3871586	3873263	4815114		Escherichia_phage(100.0%)	2	NA	NA
AVS08529.1|3871586_3872189_+	type 1 fimbriae regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
AVS08530.1|3872666_3873263_+	type 1 fimbriae regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 271
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3882389	3883850	4815114		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVS08540.1|3882389_3883850_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	2.8e-49
>prophage 272
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3890417	3890972	4815114		Clostridioides_phage(100.0%)	1	NA	NA
AVS08549.1|3890417_3890972_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.0	6.0e-37
>prophage 273
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3898473	3899430	4815114		Sodalis_phage(100.0%)	1	NA	NA
AVS08558.1|3898473_3899430_+	hypothetical protein	NA	Q2A0A7	Sodalis_phage	51.7	1.0e-60
>prophage 274
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3917823	3919479	4815114		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVS08575.1|3917823_3919479_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.4	2.1e-13
>prophage 275
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3930092	3931372	4815114		Shigella_phage(50.0%)	2	NA	NA
AVS08582.1|3930092_3930830_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
AVS08583.1|3930832_3931372_-	primosomal protein 1	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 276
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3939303	3942179	4815114		Streptococcus_phage(50.0%)	3	NA	NA
AVS08593.1|3939303_3940893_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
AVS08594.1|3941285_3941891_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
AVS08595.1|3941999_3942179_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
>prophage 277
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3948218	3949541	4815114		Geobacillus_virus(100.0%)	1	NA	NA
AVS08602.1|3948218_3949541_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 278
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3956284	3961639	4815114		Enterococcus_phage(33.33%)	4	NA	NA
AVS08610.1|3956284_3957517_+	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
AVS08611.1|3957823_3959491_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
AVS09524.1|3959464_3959593_+	methionine aminopeptidase	NA	NA	NA	NA	NA
AVS09525.1|3959701_3961639_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 279
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3964922	3965612	4815114		Bacillus_phage(100.0%)	1	NA	NA
AVS08616.1|3964922_3965612_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
>prophage 280
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3978802	3989997	4815114	transposase	Cyanophage(20.0%)	10	NA	NA
AVS08627.1|3978802_3979756_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
AVS08628.1|3979870_3980458_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
AVS08629.1|3980492_3981059_-	succinate-acetate/proton symporter SatP	NA	NA	NA	NA	NA
AVS08630.1|3981207_3981921_-	hypothetical protein	NA	NA	NA	NA	NA
AVS08631.1|3981946_3982351_-	hypothetical protein	NA	NA	NA	NA	NA
AVS08632.1|3982727_3984644_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
AVS08633.1|3984732_3985863_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
AVS08634.1|3986125_3987238_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AVS08635.1|3987315_3987525_-	type I toxin-antitoxin system hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
AVS08636.1|3988830_3989997_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
>prophage 281
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3997028	3999845	4815114	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVS08643.1|3997028_3999845_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 282
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4004288	4005437	4815114		Halovirus(100.0%)	1	NA	NA
AVS08649.1|4004288_4005437_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.3e-49
>prophage 283
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4011031	4016692	4815114		Staphylococcus_phage(50.0%)	4	NA	NA
AVS08655.1|4011031_4012585_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	3.5e-34
AVS08656.1|4012658_4013876_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
AVS08657.1|4014004_4015147_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVS08658.1|4015177_4016692_-	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 284
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4021971	4027321	4815114	transposase	Shigella_phage(33.33%)	5	NA	NA
AVS08664.1|4021971_4023245_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
AVS08665.1|4023344_4023875_+	glutathione-regulated potassium-efflux system ancillary protein KefF	NA	NA	NA	NA	NA
AVS08666.1|4023867_4025730_+	glutathione-regulated potassium-efflux system protein KefC	NA	NA	NA	NA	NA
AVS08667.1|4025921_4026401_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
AVS08668.1|4026478_4027321_-	diadenosine tetraphosphatase	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 285
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4036457	4041880	4815114		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AVS08677.1|4036457_4039364_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
AVS08678.1|4039528_4041880_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
>prophage 286
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4048328	4049027	4815114		Planktothrix_phage(100.0%)	1	NA	NA
AVS08683.1|4048328_4049027_-	thiamine import ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	3.6e-23
>prophage 287
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4061730	4063455	4815114		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVS08695.1|4061730_4063455_+	acetolactate synthase isozyme 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.4e-36
>prophage 288
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4089660	4090704	4815114		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVS08722.1|4089660_4090704_+	guanosine monophosphate reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	4.8e-104
>prophage 289
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4094949	4095501	4815114		Sphingobium_phage(100.0%)	1	NA	NA
AVS08728.1|4094949_4095501_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 290
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4106630	4108055	4815114		Erysipelothrix_phage(100.0%)	1	NA	NA
AVS09529.1|4106630_4108055_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 291
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4115800	4122423	4815114		Mamastrovirus(33.33%)	5	NA	NA
AVS08744.1|4115800_4117351_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.1e-18
AVS08745.1|4117552_4119943_-	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
AVS08746.1|4120148_4120685_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
AVS08747.1|4120725_4121388_-	carbonic anhydrase	NA	NA	NA	NA	NA
AVS08748.1|4121496_4122423_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 292
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4125685	4126582	4815114	transposase	Sodalis_phage(100.0%)	1	NA	NA
AVS08754.1|4125685_4126582_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	50.2	2.8e-60
>prophage 293
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4138230	4145036	4815114	tRNA	unidentified_phage(50.0%)	6	NA	NA
AVS08765.1|4138230_4139649_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
AVS08766.1|4139687_4140614_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AVS08767.1|4140650_4141106_-	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AVS08768.1|4141283_4141988_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AVS08769.1|4142002_4142533_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AVS08770.1|4142606_4145036_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	2.3e-40
>prophage 294
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4150168	4150966	4815114		Planktothrix_phage(100.0%)	1	NA	NA
AVS08773.1|4150168_4150966_+	iron(3+)-hydroxamate import ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 295
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4156877	4157222	4815114		Lake_Baikal_phage(100.0%)	1	NA	NA
AVS08778.1|4156877_4157222_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 296
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4161151	4162576	4815114	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVS08783.1|4161151_4162576_+|protease	periplasmic serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 297
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4174317	4175076	4815114		Flavobacterium_phage(100.0%)	1	NA	NA
AVS08796.1|4174317_4175076_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 298
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4183904	4188020	4815114		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
AVS08805.1|4183904_4184501_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	6.7e-26
AVS08806.1|4184537_4188020_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	8.2e-209
>prophage 299
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4201024	4202056	4815114		Planktothrix_phage(100.0%)	1	NA	NA
AVS08821.1|4201024_4202056_-	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 300
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4208576	4216428	4815114		Indivirus(25.0%)	8	NA	NA
AVS08823.1|4208576_4209380_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	5.4e-39
AVS08824.1|4209376_4210291_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS08825.1|4210531_4211332_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AVS08826.1|4212226_4213585_-	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AVS08827.1|4213656_4214412_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AVS08828.1|4214445_4215168_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVS08829.1|4215164_4215632_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AVS09531.1|4215696_4216428_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	1.7e-39
>prophage 301
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4225748	4229667	4815114		Caulobacter_phage(50.0%)	6	NA	NA
AVS08836.1|4225748_4226327_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
AVS08837.1|4226532_4227300_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AVS08838.1|4227270_4228011_-	transpeptidase	NA	NA	NA	NA	NA
AVS08839.1|4228166_4228445_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
AVS08840.1|4228447_4228708_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
AVS09534.1|4228917_4229667_+	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
>prophage 302
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4239551	4249076	4815114		Streptococcus_phage(40.0%)	13	NA	NA
AVS08849.1|4239551_4240607_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
AVS08850.1|4240894_4241998_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AVS08851.1|4242009_4243263_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
AVS08852.1|4243834_4244176_-	toxin	NA	NA	NA	NA	NA
AVS08853.1|4244196_4244514_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AVS08854.1|4244532_4244754_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
AVS08855.1|4244762_4245239_-	hypothetical protein	NA	NA	NA	NA	NA
AVS08856.1|4245254_4245713_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
AVS08857.1|4246126_4246594_-	hypothetical protein	NA	NA	NA	NA	NA
AVS08858.1|4246616_4247060_-	hypothetical protein	NA	NA	NA	NA	NA
AVS08859.1|4247059_4247296_-	hypothetical protein	NA	NA	NA	NA	NA
AVS08860.1|4247336_4248038_-	WYL domain-containing protein	NA	NA	NA	NA	NA
AVS08861.1|4248254_4249076_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	1.8e-45
>prophage 303
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4254640	4255687	4815114		Bacillus_virus(100.0%)	1	NA	NA
AVS08865.1|4254640_4255687_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	4.4e-33
>prophage 304
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4264436	4264739	4815114		Stx2-converting_phage(100.0%)	1	NA	NA
AVS08869.1|4264436_4264739_-	hypothetical protein	NA	B6DZU5	Stx2-converting_phage	97.9	5.3e-48
>prophage 305
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4267896	4269222	4815114		Erysipelothrix_phage(100.0%)	1	NA	NA
AVS08874.1|4267896_4269222_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
>prophage 306
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4274797	4280717	4815114	holin	Catovirus(50.0%)	5	NA	NA
AVS08882.1|4274797_4276468_-|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
AVS08883.1|4276481_4277954_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVS08884.1|4277967_4278555_-	transcriptional regulator	NA	NA	NA	NA	NA
AVS09539.1|4278471_4278687_+	hypothetical protein	NA	NA	NA	NA	NA
AVS08885.1|4278683_4280717_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 307
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4290583	4292470	4815114		Staphylococcus_phage(100.0%)	1	NA	NA
AVS08895.1|4290583_4292470_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	4.1e-53
>prophage 308
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4295667	4296567	4815114		Lactobacillus_phage(100.0%)	1	NA	NA
AVS08898.1|4295667_4296567_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 309
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4301107	4305387	4815114		Herpes_simplex_virus(50.0%)	2	NA	NA
AVS08903.1|4301107_4304182_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	100.0	0.0e+00
AVS08904.1|4304304_4305387_-	lactose operon repressor	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
>prophage 310
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4310797	4312758	4815114		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
AVS08910.1|4310797_4311748_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
AVS08911.1|4311744_4312758_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 311
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4316237	4317347	4815114		Prochlorococcus_phage(100.0%)	1	NA	NA
AVS08915.1|4316237_4317347_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 312
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4322645	4323413	4815114		Planktothrix_phage(100.0%)	1	NA	NA
AVS08922.1|4322645_4323413_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-25
>prophage 313
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4326929	4328203	4815114	transposase	Shigella_phage(100.0%)	1	NA	NA
AVS08927.1|4326929_4328203_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
>prophage 314
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4331699	4332857	4815114		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVS08929.1|4331699_4332857_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 315
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4340272	4341388	4815114		Bacillus_phage(100.0%)	1	NA	NA
AVS08941.1|4340272_4341388_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 316
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4345677	4355753	4815114		Bacillus_phage(60.0%)	6	NA	NA
AVS09543.1|4345677_4346589_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
AVS09544.1|4347868_4349053_-	MFS transporter AraJ	NA	NA	NA	NA	NA
AVS08950.1|4349178_4352322_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
AVS08951.1|4352318_4353521_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
AVS08952.1|4353710_4354400_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
AVS08953.1|4354457_4355753_+	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	3.8e-26
>prophage 317
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4362705	4371686	4815114	tRNA	uncultured_Mediterranean_phage(60.0%)	11	NA	NA
AVS08959.1|4362705_4363833_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
AVS08960.1|4363855_4364188_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
AVS08961.1|4364215_4366063_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
AVS08962.1|4366073_4367045_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
AVS08963.1|4367173_4367521_+	HNH endonuclease	NA	NA	NA	NA	NA
AVS08964.1|4367697_4368582_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
AVS08965.1|4368714_4368918_-	hypothetical protein	NA	NA	NA	NA	NA
AVS08966.1|4368880_4369420_-	hypothetical protein	NA	NA	NA	NA	NA
AVS08967.1|4369570_4370020_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AVS08968.1|4370023_4371127_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase	NA	A0A1V0SE20	Indivirus	35.8	2.8e-54
AVS08969.1|4371215_4371686_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 318
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4393247	4398294	4815114	protease	Agrobacterium_phage(25.0%)	4	NA	NA
AVS08993.1|4393247_4393871_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
AVS08994.1|4393996_4395271_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
AVS08995.1|4395458_4397813_+|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
AVS08996.1|4398021_4398294_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 319
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4401422	4402118	4815114		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVS09000.1|4401422_4402118_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	5.5e-88
>prophage 320
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4405441	4408988	4815114		Bacillus_phage(100.0%)	2	NA	NA
AVS09004.1|4405441_4407214_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-49
AVS09005.1|4407206_4408988_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
>prophage 321
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4417824	4420974	4815114		Leptospira_phage(100.0%)	1	NA	NA
AVS09016.1|4417824_4420974_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 322
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4427982	4436544	4815114		Klosneuvirus(25.0%)	8	NA	NA
AVS09025.1|4427982_4428534_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
AVS09026.1|4428662_4430594_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
AVS09027.1|4430646_4430976_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AVS09028.1|4430975_4431581_+	recombination protein RecR	NA	NA	NA	NA	NA
AVS09029.1|4431690_4433565_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	8.0e-118
AVS09030.1|4433745_4434390_+	adenylate kinase	NA	NA	NA	NA	NA
AVS09031.1|4434625_4435588_+	ferrochelatase	NA	NA	NA	NA	NA
AVS09032.1|4435584_4436544_-	acetylesterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	3.8e-15
>prophage 323
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4444788	4447950	4815114		Escherichia_phage(50.0%)	2	NA	NA
AVS09041.1|4444788_4445130_+	transcriptional regulator	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
AVS09042.1|4445445_4447950_-	copper-exporting P-type ATPase A	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
>prophage 324
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4452489	4453167	4815114		Bacillus_virus(100.0%)	1	NA	NA
AVS09048.1|4452489_4453167_+	iron export ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
>prophage 325
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4456303	4465549	4815114		Planktothrix_phage(33.33%)	5	NA	NA
AVS09053.1|4456303_4456990_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
AVS09054.1|4456986_4459401_+	ABC transporter permease	NA	NA	NA	NA	NA
AVS09055.1|4459831_4464112_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.2	2.2e-22
AVS09056.1|4464151_4464520_+	hypothetical protein	NA	NA	NA	NA	NA
AVS09057.1|4465210_4465549_+	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	100.0	1.3e-07
>prophage 326
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4471264	4473046	4815114		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVS09062.1|4471264_4473046_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
>prophage 327
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4479236	4480382	4815114		Streptococcus_phage(100.0%)	1	NA	NA
AVS09068.1|4479236_4480382_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
>prophage 328
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4491959	4495090	4815114	tRNA	Moumouvirus(50.0%)	4	NA	NA
AVS09080.1|4491959_4493345_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
AVS09081.1|4493380_4493902_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AVS09082.1|4494009_4494222_-	ribosome-associated protein	NA	NA	NA	NA	NA
AVS09083.1|4494223_4495090_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
>prophage 329
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4517984	4522744	4815114		Ralstonia_phage(50.0%)	3	NA	NA
AVS09097.1|4517984_4519886_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.5	3.3e-26
AVS09098.1|4520622_4522071_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
AVS09099.1|4522060_4522744_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 330
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4526014	4529158	4815114		Leptospira_phage(100.0%)	1	NA	NA
AVS09104.1|4526014_4529158_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
>prophage 331
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4541444	4547487	4815114		Tupanvirus(50.0%)	3	NA	NA
AVS09117.1|4541444_4545326_+	enterobactin synthase component F	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
AVS09118.1|4545541_4546675_+	ferric enterobactin transporter FepE	NA	NA	NA	NA	NA
AVS09119.1|4546671_4547487_-	ferric enterobactin transport ATP-binding protein FepC	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 332
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4562033	4563856	4815114		uncultured_marine_virus(50.0%)	2	NA	NA
AVS09134.1|4562033_4562663_-	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	3.8e-56
AVS09135.1|4562635_4563856_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.0	5.5e-59
>prophage 333
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4567039	4569154	4815114		Bacillus_virus(50.0%)	2	NA	NA
AVS09139.1|4567039_4568605_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
AVS09140.1|4568725_4569154_-	universal stress protein G	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 334
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4584579	4585226	4815114		Morganella_phage(50.0%)	2	NA	NA
AVS09157.1|4584579_4584789_+	cold-shock protein CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
AVS09158.1|4584842_4585226_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 335
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4590039	4592478	4815114		Stx2-converting_phage(50.0%)	2	NA	NA
AVS09167.1|4590039_4591251_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
AVS09168.1|4591389_4592478_-	septal ring lytic transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 336
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4599488	4602071	4815114	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
AVS09177.1|4599488_4602071_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 337
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4609010	4612543	4815114		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
AVS09185.1|4609010_4610681_-	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.6	4.0e-76
AVS09186.1|4610764_4611700_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
AVS09187.1|4611817_4612543_-	glutamate/aspartate transport ATP-binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 338
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4618426	4619506	4815114		Pseudomonas_phage(100.0%)	1	NA	NA
AVS09194.1|4618426_4619506_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 339
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4623601	4625266	4815114		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVS09197.1|4623601_4625266_-	asparagine synthetase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 340
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4630032	4633911	4815114	tRNA	Vibrio_phage(50.0%)	2	NA	NA
AVS09203.1|4630032_4631979_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
AVS09204.1|4632246_4633911_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 341
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4638191	4638956	4815114		Mycobacterium_phage(100.0%)	1	NA	NA
AVS09211.1|4638191_4638956_-	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 342
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4647209	4659930	4815114		Bacillus_phage(25.0%)	8	NA	NA
AVS09218.1|4647209_4647887_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
AVS09219.1|4647883_4650568_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
AVS09220.1|4650560_4651133_-	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AVS09221.1|4651141_4653190_-	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	2.4e-27
AVS09222.1|4653212_4654886_-	potassium-transporting ATPase A chain	NA	NA	NA	NA	NA
AVS09223.1|4654885_4654975_-	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AVS09224.1|4655287_4655494_+	DUF2517 domain-containing protein	NA	NA	NA	NA	NA
AVS09225.1|4655736_4659930_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	4.2e-26
>prophage 343
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4665171	4668221	4815114		Hokovirus(50.0%)	2	NA	NA
AVS09229.1|4665171_4666590_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	3.1e-61
AVS09230.1|4666739_4668221_-	dipeptide permease D	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 344
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4671599	4672391	4815114		Kaumoebavirus(100.0%)	1	NA	NA
AVS09235.1|4671599_4672391_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	31.5	2.2e-08
>prophage 345
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4708410	4711930	4815114		Vibrio_phage(33.33%)	4	NA	NA
AVS09266.1|4708410_4709130_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
AVS09267.1|4709126_4710068_-	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
AVS09268.1|4710181_4710562_-	hypothetical protein	NA	NA	NA	NA	NA
AVS09269.1|4710877_4711930_+	phospho-2-dehydro-3-deoxyheptonate aldolase Phe-sensitive	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 346
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4716283	4722857	4815114		Tupanvirus(33.33%)	8	NA	NA
AVS09274.1|4716283_4717300_-	UDP-glucose 4-epimerase	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
AVS09275.1|4717560_4719033_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
AVS09276.1|4719100_4719889_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AVS09277.1|4720017_4720167_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
AVS09554.1|4720102_4720312_+	hypothetical protein	NA	NA	NA	NA	NA
AVS09278.1|4720333_4721107_+	molybdate-binding periplasmic protein	NA	NA	NA	NA	NA
AVS09279.1|4721106_4721796_+	molybdenum ABC transporter permease	NA	NA	NA	NA	NA
AVS09280.1|4721798_4722857_+	molybdenum import ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
>prophage 347
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4733212	4734502	4815114		Klosneuvirus(100.0%)	1	NA	NA
AVS09290.1|4733212_4734502_-	adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 348
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4740983	4741892	4815114		Streptococcus_phage(100.0%)	1	NA	NA
AVS09296.1|4740983_4741892_-	hypothetical protein	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 349
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4752489	4767445	4815114		Anomala_cuprea_entomopoxvirus(14.29%)	13	NA	NA
AVS09310.1|4752489_4754226_-	multidrug ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
AVS09311.1|4754218_4755217_-	secretion protein HlyD	NA	NA	NA	NA	NA
AVS09555.1|4755216_4755888_-	transcriptional regulator	NA	NA	NA	NA	NA
AVS09312.1|4756116_4757481_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
AVS09313.1|4757712_4758195_-	swarming motility protein YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
AVS09314.1|4758314_4760465_+	ATP-dependent helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
AVS09315.1|4760492_4761455_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AVS09316.1|4761595_4762681_+	dehydrogenase	NA	NA	NA	NA	NA
AVS09317.1|4762909_4763170_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVS09318.1|4763434_4763701_-	DksA/TraR family C4-type zinc finger protein	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
AVS09319.1|4763774_4764452_-	PKHD-type hydroxylase	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
AVS09320.1|4764493_4766776_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
AVS09321.1|4767040_4767445_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	2.6e-05
>prophage 350
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4770985	4776210	4815114		Planktothrix_phage(33.33%)	7	NA	NA
AVS09324.1|4770985_4771708_-	glutamine transport ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
AVS09325.1|4771704_4772364_-	glutamine ABC transporter permease	NA	NA	NA	NA	NA
AVS09326.1|4772502_4773249_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS09327.1|4773175_4773367_-	hypothetical protein	NA	NA	NA	NA	NA
AVS09328.1|4773652_4774156_-	DNA starvation/stationary phase protection protein	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
AVS09329.1|4774454_4775342_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AVS09330.1|4775694_4776210_+	outer membrane protein X	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 351
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4781207	4789549	4815114		Tupanvirus(33.33%)	6	NA	NA
AVS09336.1|4781207_4782800_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
AVS09337.1|4783040_4784306_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
AVS09338.1|4784457_4785273_-	sugar phosphatase YbiV	NA	NA	NA	NA	NA
AVS09339.1|4785418_4787851_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
AVS09340.1|4787856_4788756_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
AVS09341.1|4788886_4789549_+	fructose-6-phosphate aldolase 1	NA	C7BV14	Synechococcus_phage	32.5	2.8e-25
>prophage 352
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4792764	4794636	4815114		Planktothrix_phage(100.0%)	1	NA	NA
AVS09345.1|4792764_4794636_+	glutathione import ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 353
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4800239	4803045	4815114	transposase	Escherichia_phage(100.0%)	2	NA	NA
AVS09349.1|4800239_4801076_+	gyliF	NA	A0A2L1IV26	Escherichia_phage	100.0	1.7e-06
AVS09350.1|4802347_4803045_-|transposase	IS1-like element IS1A family transposase	transposase	A0A077SLN4	Escherichia_phage	99.1	2.8e-132
>prophage 354
CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4807185	4808388	4815114		Stx2-converting_phage(100.0%)	1	NA	NA
AVS09556.1|4807185_4808388_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.4e-99
>prophage 1
CP028168	Escherichia coli strain CFSAN064036 plasmid pGMI17-004_1, complete sequence	119076	48755	83285	119076	transposase,integrase	Escherichia_phage(30.77%)	47	44208:44222	73187:73201
44208:44222	attL	TGCTCATGATTAAAA	NA	NA	NA	NA
AVS09643.1|48755_49694_-|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	53.4	3.6e-66
AVS09644.1|49758_50025_-	hypothetical protein	NA	NA	NA	NA	NA
AVS09645.1|50118_50553_-	post-segregation killing protein PndC	NA	NA	NA	NA	NA
AVS09646.1|50575_50821_-	hypothetical protein	NA	NA	NA	NA	NA
AVS09647.1|50842_51142_+	hypothetical protein	NA	NA	NA	NA	NA
AVS09648.1|51281_51782_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.3	2.4e-05
AVS09649.1|52243_52840_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.3	3.4e-14
AVS09650.1|52836_53556_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AVS09651.1|53552_53990_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AVS09652.1|54041_56000_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.4	7.3e-21
AVS09653.1|56058_56292_-	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.2	1.7e-06
AVS09654.1|56349_56877_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.6e-47
AVS09655.1|56873_57080_-	hypothetical protein	NA	NA	NA	NA	NA
AVS09656.1|57260_57575_-	hypothetical protein	NA	NA	NA	NA	NA
AVS09657.1|57645_57837_-	hypothetical protein	NA	NA	NA	NA	NA
AVS09658.1|57833_58256_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AVS09659.1|58302_58728_-	antirestriction protein	NA	NA	NA	NA	NA
AVS09660.1|58700_59273_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
AVS09661.1|59967_60402_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AVS09662.1|60415_60637_-	hypothetical protein	NA	NA	NA	NA	NA
AVS09663.1|60637_61321_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.1e-29
AVS09664.1|61396_61702_-	hypothetical protein	NA	NA	NA	NA	NA
AVS09735.1|61705_62608_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AVS09736.1|62645_62921_-	hypothetical protein	NA	NA	NA	NA	NA
AVS09665.1|63025_63205_+	impC protein	NA	NA	NA	NA	NA
AVS09666.1|63288_63681_-	plasmid stability protein	NA	NA	NA	NA	NA
AVS09667.1|63684_64659_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	45.1	3.1e-73
AVS09737.1|64897_65101_-	hypothetical protein	NA	NA	NA	NA	NA
AVS09668.1|65271_65904_-	hypothetical protein	NA	A0A0K1LMB9	Rhodobacter_phage	39.1	1.4e-29
AVS09669.1|66487_67273_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	96.5	4.0e-55
AVS09670.1|67274_67688_-	hypothetical protein	NA	NA	NA	NA	NA
AVS09671.1|68256_68517_+	hypothetical protein	NA	NA	NA	NA	NA
AVS09672.1|68513_69104_+	hypothetical protein	NA	NA	NA	NA	NA
AVS09673.1|69121_69469_-	hypothetical protein	NA	NA	NA	NA	NA
AVS09674.1|69587_69935_+	colicin transporter	NA	NA	NA	NA	NA
AVS09675.1|69952_71833_-	colicin	NA	NA	NA	NA	NA
AVS09676.1|72111_73458_-	hypothetical protein	NA	NA	NA	NA	NA
73187:73201	attR	TGCTCATGATTAAAA	NA	NA	NA	NA
AVS09677.1|73811_74414_+	proQ/FINO family protein	NA	NA	NA	NA	NA
AVS09738.1|74469_74964_+	hypothetical protein	NA	NA	NA	NA	NA
AVS09678.1|74963_75230_+	hypothetical protein	NA	NA	NA	NA	NA
AVS09679.1|75338_75572_-	hypothetical protein	NA	NA	NA	NA	NA
AVS09739.1|75706_76123_-	hypothetical protein	NA	NA	NA	NA	NA
AVS09680.1|78852_79557_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVS09681.1|79568_79994_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVS09682.1|80143_81004_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVS09683.1|81588_82293_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVS09684.1|82424_83285_+|transposase	transposase	transposase	NA	NA	NA	NA
