The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	0	2767	5438150		Bacillus_thuringiensis_phage(100.0%)	2	NA	NA
AVS24488.1|1399_2074_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AVS24489.1|2146_2767_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	3.5e-62
>prophage 2
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	11105	12617	5438150		Staphylococcus_phage(100.0%)	1	NA	NA
AVS24498.1|11105_12617_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	3.5e-15
>prophage 3
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	35588	36506	5438150		Pandoravirus(100.0%)	1	NA	NA
AVS24524.1|35588_36506_+	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	28.8	7.9e-18
>prophage 4
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	43328	45796	5438150		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
AVS24531.1|43328_44378_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.0e-08
AVS29561.1|44386_45796_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
>prophage 5
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	49684	52477	5438150		uncultured_virus(100.0%)	1	NA	NA
AVS24536.1|49684_52477_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.5	6.4e-71
>prophage 6
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	66771	72650	5438150		Enterobacteria_phage(33.33%)	5	NA	NA
AVS24547.1|66771_67662_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	3.3e-05
AVS24548.1|67689_68655_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
AVS24549.1|68660_70166_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.3	4.0e-19
AVS24550.1|70176_70596_-	D-ribose pyranase	NA	NA	NA	NA	NA
AVS24551.1|70781_72650_-	low affinity potassium transport system protein kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	8.4e-67
>prophage 7
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	75815	76808	5438150		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AVS24554.1|75815_76808_-	asparagine synthetase A	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.0	4.6e-48
>prophage 8
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	89158	96718	5438150		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
AVS24568.1|89158_90529_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.6	2.8e-35
AVS24569.1|90712_92542_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	41.2	1.6e-123
AVS24570.1|92878_93919_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.1	3.4e-49
AVS24571.1|94047_95007_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
AVS24572.1|95006_95897_+	phosphate ABC transporter permease PtsA	NA	NA	NA	NA	NA
AVS24573.1|95944_96718_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.2	2.0e-14
>prophage 9
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	102494	103832	5438150		Moraxella_phage(100.0%)	1	NA	NA
AVS24579.1|102494_103832_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.6	1.1e-63
>prophage 10
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	111324	118854	5438150		Staphylococcus_phage(33.33%)	7	NA	NA
AVS24587.1|111324_111582_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	9.2e-17
AVS24588.1|111545_111905_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AVS24589.1|111920_112061_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AVS24590.1|112682_114086_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AVS24591.1|114090_115191_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
AVS24592.1|115337_116411_+	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
AVS24593.1|116439_118854_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.3	1.1e-114
>prophage 11
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	124621	125770	5438150		Oenococcus_phage(100.0%)	1	NA	NA
AVS24600.1|124621_125770_+	D-galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.7	4.7e-52
>prophage 12
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	129205	131125	5438150		Cyanophage(33.33%)	3	NA	NA
AVS24604.1|129205_129619_+	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
AVS24605.1|129735_130164_+	heat shock chaperone IbpB	NA	A0A2H4N7P1	Lake_Baikal_phage	41.1	2.6e-16
AVS24606.1|130300_131125_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.4	8.2e-91
>prophage 13
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	142134	147573	5438150		Salmonella_phage(50.0%)	6	NA	NA
AVS24617.1|142134_143319_-	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	25.5	3.7e-12
AVS24618.1|143494_144328_-	EamA family transporter	NA	NA	NA	NA	NA
AVS24619.1|144395_144842_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVS24620.1|144932_145022_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AVS24621.1|145684_145780_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AVS24622.1|145884_147573_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	1.7e-58
>prophage 14
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	159750	160863	5438150		Bacillus_virus(100.0%)	1	NA	NA
AVS24637.1|159750_160863_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.5	1.1e-26
>prophage 15
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	179298	180462	5438150		Salmonella_phage(100.0%)	1	NA	NA
AVS24655.1|179298_180462_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	26.9	4.5e-26
>prophage 16
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	197722	198772	5438150		Tupanvirus(100.0%)	1	NA	NA
AVS24673.1|197722_198772_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	43.9	3.4e-73
>prophage 17
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	212031	213423	5438150		environmental_Halophage(100.0%)	1	NA	NA
AVS24684.1|212031_213423_-	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	95.2	1.4e-66
>prophage 18
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	216557	217409	5438150		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVS24687.1|216557_217409_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.2	2.2e-14
>prophage 19
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	228390	243840	5438150	transposase	Bordetella_phage(16.67%)	14	NA	NA
AVS24699.1|228390_230511_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
AVS24700.1|230529_230805_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AVS24701.1|230859_231483_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	1.7e-19
AVS24702.1|231741_233418_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.8	1.5e-22
AVS24703.1|233423_234041_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
AVS24704.1|234315_235566_+	chloride channel protein	NA	NA	NA	NA	NA
AVS24705.1|235621_236680_-	XRE family transcriptional regulator	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.5	6.3e-19
AVS24706.1|236682_237429_-	isocitrate lyase/phosphoenolpyruvate mutase family protein	NA	NA	NA	NA	NA
AVS24707.1|237611_238475_-	YicC family protein	NA	NA	NA	NA	NA
AVS24708.1|239002_239983_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AVS29565.1|240021_240150_-	ABC transporter	NA	NA	NA	NA	NA
AVS24709.1|240174_241875_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVS24710.1|241964_242930_+	secretion protein HlyD	NA	NA	NA	NA	NA
AVS24711.1|242922_243840_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	1.3e-23
>prophage 20
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	247299	252041	5438150		Xanthomonas_phage(25.0%)	7	NA	NA
AVS29567.1|247299_247755_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	4.7e-48
AVS29568.1|247735_248950_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.5	8.5e-44
AVS24715.1|249122_249788_+	JAB domain-containing protein	NA	NA	NA	NA	NA
AVS24716.1|250004_250241_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AVS24717.1|250261_250429_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AVS24718.1|250564_251374_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.1	2.9e-24
AVS24719.1|251561_252041_-	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.3	2.8e-27
>prophage 21
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	264809	273959	5438150		Prochlorococcus_phage(20.0%)	9	NA	NA
AVS24730.1|264809_265742_-	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	2.2e-36
AVS24731.1|265955_267149_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.5	1.7e-36
AVS24732.1|267161_268187_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	3.6e-19
AVS24733.1|268355_269144_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AVS24734.1|269149_270097_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AVS24735.1|270100_271372_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	3.5e-08
AVS24736.1|271381_272926_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVS24737.1|273171_273603_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AVS24738.1|273707_273959_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	52.1	9.9e-16
>prophage 22
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	289796	291638	5438150	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVS24755.1|289796_291638_+|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	24.7	1.2e-12
>prophage 23
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	299611	301153	5438150		Staphylococcus_phage(100.0%)	1	NA	NA
AVS24763.1|299611_301153_-	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	2.5e-16
>prophage 24
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	306621	307617	5438150		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AVS24769.1|306621_307617_-	O-acetyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.3	3.6e-08
>prophage 25
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	311520	315025	5438150	transposase	Mannheimia_phage(33.33%)	4	NA	NA
AVS24774.1|311520_312567_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
AVS24775.1|312640_312793_+	small toxic polypeptide	NA	NA	NA	NA	NA
AVS24776.1|313094_314714_+	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	24.7	4.0e-25
AVS24777.1|314812_315025_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 26
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	318428	319400	5438150		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVS24782.1|318428_319400_-	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.9	2.9e-18
>prophage 27
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	324559	327299	5438150		Escherichia_phage(50.0%)	2	NA	NA
AVS24788.1|324559_326890_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.3	5.7e-65
AVS24789.1|326858_327299_-	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	32.9	1.7e-15
>prophage 28
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	333951	335314	5438150	transposase	Bacillus_phage(100.0%)	1	NA	NA
AVS24794.1|333951_335314_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 29
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	339638	345611	5438150		Planktothrix_phage(33.33%)	6	NA	NA
AVS24799.1|339638_340622_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	2.3e-15
AVS24800.1|340618_341632_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	7.4e-17
AVS24801.1|341650_341830_+	hypothetical protein	NA	NA	NA	NA	NA
AVS24802.1|342147_342687_+	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
AVS24803.1|342688_343480_+	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
AVS24804.1|343499_345611_+	cellulose synthase catalytic subunit (UDP-forming)	NA	M1I277	Paramecium_bursaria_Chlorella_virus	34.2	4.6e-37
>prophage 30
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	389340	391383	5438150		Indivirus(100.0%)	1	NA	NA
AVS24833.1|389340_391383_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.8	3.8e-44
>prophage 31
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	399924	400716	5438150		Bacillus_virus(100.0%)	1	NA	NA
AVS24842.1|399924_400716_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	24.0	2.9e-13
>prophage 32
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	406818	410925	5438150		Tupanvirus(66.67%)	3	NA	NA
AVS24849.1|406818_407958_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.3	9.4e-29
AVS24850.1|407959_408943_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.3	9.6e-38
AVS24851.1|408939_410925_+	bifunctional UDP-glucuronic acid oxidase/UDP-4-amino-4-deoxy-L-arabinose formyltransferase	NA	A0A2K9KZK0	Tupanvirus	25.7	5.7e-21
>prophage 33
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	417225	421362	5438150		Dickeya_phage(50.0%)	4	NA	NA
AVS24859.1|417225_417891_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.8	2.1e-57
AVS24860.1|418097_418343_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	86.1	4.7e-10
AVS24861.1|418446_420657_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	36.1	1.1e-113
AVS24862.1|420735_421362_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	60.2	2.1e-30
>prophage 34
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	424446	430247	5438150		Staphylococcus_phage(25.0%)	5	NA	NA
AVS24867.1|424446_425115_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	5.0e-14
AVS24868.1|425107_426163_+	cell division protein FtsX	NA	NA	NA	NA	NA
AVS24869.1|426432_427287_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
AVS24870.1|427339_428863_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.8	1.1e-13
AVS24871.1|428981_430247_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	1.0e-23
>prophage 35
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	437568	439801	5438150		Anomala_cuprea_entomopoxvirus(66.67%)	4	NA	NA
AVS24879.1|437568_438336_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	5.8e-14
AVS24880.1|438337_439051_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	1.7e-12
AVS24881.1|439214_439436_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
AVS24882.1|439432_439801_+	type II toxin-antitoxin system death-on-curing family toxin	NA	E4ZFM2	Streptococcus_phage	30.1	3.5e-09
>prophage 36
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	443227	445035	5438150		Planktothrix_phage(50.0%)	2	NA	NA
AVS24886.1|443227_444298_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
AVS24887.1|444294_445035_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	6.4e-10
>prophage 37
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	462780	465228	5438150		Dickeya_phage(100.0%)	1	NA	NA
AVS24903.1|462780_465228_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	2.7e-33
>prophage 38
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	469085	469844	5438150		Escherichia_phage(100.0%)	1	NA	NA
AVS24909.1|469085_469844_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	2.3e-23
>prophage 39
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	473189	475580	5438150		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AVS24912.1|473189_475580_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.1e-13
>prophage 40
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	488406	492178	5438150		Bacillus_phage(66.67%)	3	NA	NA
AVS24924.1|488406_489126_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
AVS24925.1|489122_490478_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.7	1.6e-11
AVS24926.1|490555_492178_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.3	1.0e-140
>prophage 41
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	507001	507829	5438150		Vibrio_phage(100.0%)	1	NA	NA
AVS24940.1|507001_507829_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.0	6.1e-70
>prophage 42
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	519230	528874	5438150		Acinetobacter_phage(25.0%)	11	NA	NA
AVS24952.1|519230_519794_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	58.4	8.1e-58
AVS24953.1|519884_521105_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AVS24954.1|521094_523173_-	hypothetical protein	NA	H9YQA8	environmental_Halophage	84.8	4.1e-62
AVS24955.1|523224_523857_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AVS29578.1|524015_524204_-	hypothetical protein	NA	NA	NA	NA	NA
AVS24956.1|524163_524568_+	OsmC family protein	NA	NA	NA	NA	NA
AVS24957.1|524622_525492_-	phosphoribulokinase	NA	NA	NA	NA	NA
AVS24958.1|525528_525747_-	hypothetical protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	37.3	4.0e-05
AVS24959.1|525743_526766_-	hydrolase	NA	NA	NA	NA	NA
AVS24960.1|526706_526907_+	hypothetical protein	NA	NA	NA	NA	NA
AVS24961.1|526969_528874_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	34.1	3.8e-75
>prophage 43
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	536719	540088	5438150		Streptococcus_phage(50.0%)	2	NA	NA
AVS24974.1|536719_538834_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.6	1.8e-57
AVS24975.1|538903_540088_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
>prophage 44
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	559991	629369	5438150	integrase,portal,tail,protease,head,capsid,terminase,tRNA	uncultured_Caudovirales_phage(61.11%)	75	577599:577616	593594:593611
AVS25012.1|559991_560939_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
AVS25013.1|560953_561463_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
AVS25014.1|561591_562716_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AVS25015.1|562687_563161_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AVS25016.1|563186_563729_+	hypothetical protein	NA	NA	NA	NA	NA
AVS25017.1|563733_564306_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
AVS25018.1|564309_565128_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AVS25019.1|565124_565382_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AVS29580.1|565357_565912_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AVS25020.1|571707_571929_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25021.1|572222_575333_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AVS25022.1|575345_576485_-	MexX family efflux pump subunit	NA	NA	NA	NA	NA
AVS25023.1|576863_577514_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
577599:577616	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AVS25024.1|577789_579016_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
AVS25025.1|579108_580050_+	hypothetical protein	NA	NA	NA	NA	NA
AVS25026.1|580231_580516_+	transcriptional regulator	NA	NA	NA	NA	NA
AVS25027.1|580526_581306_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
AVS25028.1|581429_581624_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AVS29581.1|581847_582027_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.9	2.6e-26
AVS25029.1|582019_582208_+	hypothetical protein	NA	NA	NA	NA	NA
AVS25030.1|582200_582515_+	hypothetical protein	NA	NA	NA	NA	NA
AVS25031.1|582511_582880_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
AVS25032.1|582876_583242_+	hypothetical protein	NA	NA	NA	NA	NA
AVS25033.1|583241_585377_+	DNA primase	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AVS25034.1|585719_586055_+	hypothetical protein	NA	NA	NA	NA	NA
AVS25035.1|586103_586616_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25036.1|586879_588046_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
AVS25037.1|588097_588658_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
AVS25038.1|588659_589901_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
AVS25039.1|589897_590233_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
AVS25040.1|590229_590529_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
AVS25041.1|590528_590972_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
AVS25042.1|591098_591290_+|terminase	terminase	terminase	NA	NA	NA	NA
AVS25043.1|591247_591604_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AVS25044.1|591587_593249_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
AVS25045.1|593251_593443_+	hypothetical protein	NA	NA	NA	NA	NA
AVS25046.1|593596_593893_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
593594:593611	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AVS25047.1|593917_594883_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AVS25048.1|595040_595235_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25049.1|595240_596122_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AVS25050.1|596133_597585_-	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AVS25051.1|597574_597817_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25052.1|597927_599277_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AVS25053.1|599287_599755_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AVS25054.1|599777_600230_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AVS25055.1|600453_601062_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AVS25056.1|601061_602063_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AVS25057.1|602291_602483_+	hypothetical protein	NA	NA	NA	NA	NA
AVS25058.1|602562_604503_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AVS25059.1|604624_604831_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25060.1|604808_605852_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AVS25061.1|605922_606915_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AVS25062.1|606914_607403_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AVS25063.1|607410_607992_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AVS25064.1|607994_609464_+	ribonuclease G	NA	NA	NA	NA	NA
AVS25065.1|609501_613299_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
AVS25066.1|613387_614833_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AVS25067.1|614868_615798_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AVS25068.1|615929_616133_+	protein AaeX	NA	NA	NA	NA	NA
AVS25069.1|616140_617073_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AVS25070.1|617078_619046_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AVS25071.1|619125_619401_+	hypothetical protein	NA	NA	NA	NA	NA
AVS25072.1|619451_619718_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVS25073.1|619816_620080_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVS25074.1|620455_620926_-	arginine repressor	NA	NA	NA	NA	NA
AVS25075.1|621340_622279_+	malate dehydrogenase	NA	NA	NA	NA	NA
AVS25076.1|622415_623474_-|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AVS25077.1|623561_624929_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
AVS25078.1|625102_625501_-	DUF1043 domain-containing protein	NA	NA	NA	NA	NA
AVS25079.1|625691_626819_+	cell division protein ZapE	NA	NA	NA	NA	NA
AVS25080.1|627084_627513_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AVS25081.1|627528_627921_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AVS25082.1|628030_628234_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25083.1|628232_628871_+	stringent starvation protein A	NA	NA	NA	NA	NA
AVS25084.1|628874_629369_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 45
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	636814	637747	5438150		Staphylococcus_phage(100.0%)	1	NA	NA
AVS25088.1|636814_637747_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.8	3.4e-16
>prophage 46
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	641691	654622	5438150		Hokovirus(16.67%)	16	NA	NA
AVS25092.1|641691_644031_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	9.3e-39
AVS25093.1|644264_644918_+	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AVS25094.1|644914_645640_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AVS25095.1|645703_645976_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AVS25096.1|645972_646827_-	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
AVS25097.1|646872_647361_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AVS25098.1|647431_647719_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25099.1|647741_649175_-	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AVS25100.1|649222_649948_-	lipopolysaccharide ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
AVS25101.1|649954_650500_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AVS25102.1|650468_651044_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AVS25103.1|651040_651607_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	81.3	5.3e-57
AVS25104.1|651621_652608_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	3.0e-39
AVS25105.1|652622_653600_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
AVS25106.1|653614_653818_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25107.1|653809_654622_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	28.8	1.6e-17
>prophage 47
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	658671	660113	5438150		Vibrio_phage(50.0%)	2	NA	NA
AVS25114.1|658671_658944_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	63.5	3.1e-15
AVS25115.1|659141_660113_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.0	1.0e-07
>prophage 48
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	666711	669588	5438150	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
AVS25124.1|666711_668646_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	4.1e-117
AVS25125.1|668739_669588_+	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	30.7	6.0e-20
>prophage 49
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	673852	680471	5438150		Dickeya_phage(50.0%)	4	NA	NA
AVS25131.1|673852_675196_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
AVS25132.1|675788_676241_+	ribosome maturation factor	NA	NA	NA	NA	NA
AVS25133.1|676268_677756_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AVS25134.1|677780_680471_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.4	5.1e-25
>prophage 50
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	685885	687817	5438150		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVS25142.1|685885_687817_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	2.1e-52
>prophage 51
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	693510	703208	5438150		Invertebrate_iridovirus(20.0%)	12	NA	NA
AVS29582.1|693510_693795_-	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	52.6	2.3e-13
AVS25149.1|693850_694294_+	hypothetical protein	NA	NA	NA	NA	NA
AVS25150.1|694255_694792_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	9.3e-11
AVS25151.1|694920_695568_+	hypothetical protein	NA	NA	NA	NA	NA
AVS25152.1|695643_696684_+	permease	NA	NA	NA	NA	NA
AVS25153.1|696805_697381_-	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AVS25154.1|697390_697981_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
AVS25155.1|698006_698393_-	YraN family protein	NA	NA	NA	NA	NA
AVS25156.1|698350_700468_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
AVS25157.1|700531_701395_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.5	2.1e-49
AVS25158.1|701398_702400_+	Fic family protein	NA	NA	NA	NA	NA
AVS25159.1|702434_703208_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.3	1.2e-22
>prophage 52
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	719314	720460	5438150		Streptococcus_phage(100.0%)	1	NA	NA
AVS25175.1|719314_720460_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.9	6.7e-51
>prophage 53
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	737483	738455	5438150		Escherichia_phage(100.0%)	1	NA	NA
AVS25195.1|737483_738455_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.4	2.0e-35
>prophage 54
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	748018	749506	5438150		Staphylococcus_phage(100.0%)	1	NA	NA
AVS25204.1|748018_749506_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	23.7	2.2e-09
>prophage 55
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	753777	755157	5438150		Klosneuvirus(100.0%)	1	NA	NA
AVS25210.1|753777_755157_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.5e-31
>prophage 56
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	773236	787590	5438150	tRNA	Acanthocystis_turfacea_Chlorella_virus(20.0%)	14	NA	NA
AVS25228.1|773236_774040_+	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	1.2e-14
AVS25229.1|774091_774397_-	acid-resistance protein	NA	NA	NA	NA	NA
AVS25230.1|774423_774999_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
AVS25231.1|775269_775911_+	hypothetical protein	NA	NA	NA	NA	NA
AVS25232.1|776001_779244_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	33.6	3.3e-34
AVS25233.1|779248_779863_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVS29583.1|780215_780530_+	HdeB family protein	NA	NA	NA	NA	NA
AVS25234.1|780598_780871_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25235.1|781606_782113_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AVS25236.1|782212_784048_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
AVS25237.1|784266_786012_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
AVS25238.1|786123_786339_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVS25239.1|786337_786568_+	hypothetical protein	NA	NA	NA	NA	NA
AVS25240.1|786576_787590_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 57
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	796883	798125	5438150	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
AVS25253.1|796883_798125_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	50.1	5.2e-89
>prophage 58
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	803236	810117	5438150		uncultured_Mediterranean_phage(25.0%)	8	NA	NA
AVS25256.1|803236_804670_+	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	2.0e-39
AVS25257.1|804888_805086_+	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
AVS25258.1|805121_805394_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25259.1|805771_806425_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.8e-45
AVS25260.1|806486_807257_-	zinc transporter ZupT	NA	NA	NA	NA	NA
AVS25261.1|807443_808235_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
AVS25262.1|808279_809440_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.9	1.4e-88
AVS25263.1|809445_810117_-	DUF1190 domain-containing protein	NA	A0A173GEW8	Erwinia_phage	48.3	9.7e-42
>prophage 59
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	814459	816355	5438150		Bacillus_virus(100.0%)	1	NA	NA
AVS25269.1|814459_816355_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.7	5.9e-92
>prophage 60
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	819666	829569	5438150		Stx_converting_phage(25.0%)	8	NA	NA
AVS25274.1|819666_820062_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	42.5	9.8e-18
AVS25275.1|820139_821009_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVS25276.1|821130_823389_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.1	1.8e-84
AVS25277.1|823580_824318_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
AVS25278.1|824401_825814_+	cell division protein FtsP	NA	NA	NA	NA	NA
AVS25279.1|825937_828121_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.0e-103
AVS25280.1|828178_828706_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVS25281.1|828741_829569_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	3.4e-60
>prophage 61
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	849278	850649	5438150		Lactococcus_phage(100.0%)	1	NA	NA
AVS29586.1|849278_850649_-	CBS domain-containing protein	NA	A0A1W6JIM2	Lactococcus_phage	37.3	6.6e-45
>prophage 62
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	855538	856906	5438150		Escherichia_phage(100.0%)	1	NA	NA
AVS25308.1|855538_856906_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.0	3.7e-120
>prophage 63
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	863186	863942	5438150		Lactobacillus_prophage(100.0%)	1	NA	NA
AVS25314.1|863186_863942_+	DUF2321 domain-containing protein	NA	Q6SEF3	Lactobacillus_prophage	34.7	6.9e-12
>prophage 64
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	885497	886865	5438150		Morganella_phage(100.0%)	1	NA	NA
AVS25339.1|885497_886865_-	glycosaminoglycan attachment protein	NA	A0A1W6JNS5	Morganella_phage	34.2	5.9e-62
>prophage 65
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	897259	898795	5438150		Vibrio_phage(100.0%)	4	NA	NA
AVS25349.1|897259_897511_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.2	4.0e-17
AVS25350.1|897614_897860_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVS25351.1|897938_898394_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
AVS25352.1|898534_898795_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	65.7	1.1e-17
>prophage 66
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	905494	906475	5438150		Caulobacter_phage(100.0%)	1	NA	NA
AVS25362.1|905494_906475_+	DNA primase	NA	A0A1V0EEV1	Caulobacter_phage	39.7	6.0e-48
>prophage 67
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	914021	915104	5438150		Geobacillus_virus(100.0%)	1	NA	NA
AVS25369.1|914021_915104_-	lytic murein transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	9.9e-12
>prophage 68
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	929978	931133	5438150		Staphylococcus_phage(100.0%)	1	NA	NA
AVS25389.1|929978_931133_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	1.4e-128
>prophage 69
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	944888	945683	5438150		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AVS25406.1|944888_945683_+	short chain dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.7	1.4e-07
>prophage 70
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	962936	964169	5438150		Catovirus(100.0%)	1	NA	NA
AVS25421.1|962936_964169_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.6	3.1e-102
>prophage 71
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	972112	974986	5438150		Prochlorococcus_phage(100.0%)	1	NA	NA
AVS25430.1|972112_974986_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.6	5.7e-264
>prophage 72
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	979561	980995	5438150		Pandoravirus(100.0%)	1	NA	NA
AVS25436.1|979561_980995_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	3.6e-33
>prophage 73
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	985691	993593	5438150	tRNA	Brevibacillus_phage(20.0%)	8	NA	NA
AVS25444.1|985691_986588_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	7.9e-31
AVS25445.1|986610_987324_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AVS25446.1|987329_989063_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.2	8.3e-61
AVS25447.1|989148_990246_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
AVS25448.1|990256_991774_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.2	1.5e-85
AVS25449.1|992008_992563_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AVS25450.1|992640_992829_+	hypothetical protein	NA	NA	NA	NA	NA
AVS25451.1|992879_993593_+	hypothetical protein	NA	I3PV79	Clostridium_phage	35.8	1.7e-12
>prophage 74
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	997561	998581	5438150		Klosneuvirus(100.0%)	1	NA	NA
AVS25455.1|997561_998581_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	31.8	3.8e-05
>prophage 75
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1001659	1005791	5438150		uncultured_Caudovirales_phage(75.0%)	4	NA	NA
AVS25461.1|1001659_1001989_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	54.0	2.9e-23
AVS25462.1|1002040_1003333_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.2	1.0e-164
AVS25463.1|1003342_1003765_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	66.4	4.5e-45
AVS25464.1|1004237_1005791_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.1	9.5e-157
>prophage 76
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1020265	1021945	5438150	integrase	Escherichia_phage(100.0%)	2	1014277:1014291	1024066:1024080
1014277:1014291	attL	TTCAGCGTGGTGCCG	NA	NA	NA	NA
AVS25477.1|1020265_1020874_-	tyrosine recombinase	NA	A0A2L1IV36	Escherichia_phage	51.0	1.5e-49
AVS25478.1|1021339_1021945_-|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	51.4	6.1e-51
1024066:1024080	attR	TTCAGCGTGGTGCCG	NA	NA	NA	NA
>prophage 77
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1042541	1046012	5438150		Trichoplusia_ni_ascovirus(33.33%)	3	NA	NA
AVS25498.1|1042541_1043303_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.0e-18
AVS25499.1|1043598_1045020_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.3	1.1e-23
AVS25500.1|1045016_1046012_-	transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.2	2.8e-13
>prophage 78
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1051775	1052903	5438150		Bacillus_phage(100.0%)	1	NA	NA
AVS25504.1|1051775_1052903_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	4.7e-12
>prophage 79
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1058617	1059628	5438150		Enterobacteria_phage(100.0%)	1	NA	NA
AVS25511.1|1058617_1059628_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	2.1e-27
>prophage 80
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1065606	1077524	5438150		Staphylococcus_phage(25.0%)	10	NA	NA
AVS25519.1|1065606_1067766_+	bifunctional 2-acylglycerophosphoethanolamine acyltransferase/acyl-ACP synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	25.1	6.4e-18
AVS25520.1|1067758_1068952_+	MFS transporter	NA	NA	NA	NA	NA
AVS25521.1|1069054_1070095_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AVS25522.1|1070315_1070534_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
AVS25523.1|1070657_1071371_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	4.5e-45
AVS25524.1|1071434_1072130_-	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
AVS25525.1|1072812_1073343_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AVS25526.1|1073355_1075602_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	23.3	5.6e-09
AVS25527.1|1075847_1076723_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AVS25528.1|1076729_1077524_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.8	2.4e-119
>prophage 81
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1083037	1094717	5438150		Hokovirus(25.0%)	6	NA	NA
AVS25534.1|1083037_1085923_+	pitrilysin	NA	A0A1V0SH69	Hokovirus	22.1	2.2e-45
AVS25535.1|1085919_1089456_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.1	2.2e-07
AVS25536.1|1089452_1091297_+	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.8	5.3e-21
AVS25537.1|1091354_1091675_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25538.1|1091904_1093236_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
AVS25539.1|1093463_1094717_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	1.5e-14
>prophage 82
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1127368	1128193	5438150		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AVS25579.1|1127368_1128193_+	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.3	4.3e-07
>prophage 83
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1133138	1135639	5438150	tRNA	Pandoravirus(50.0%)	3	NA	NA
AVS25584.1|1133138_1133960_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	31.7	1.6e-14
AVS25585.1|1134002_1134434_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AVS25586.1|1134433_1135639_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.5	4.4e-69
>prophage 84
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1147184	1147940	5438150		Bacillus_phage(100.0%)	1	NA	NA
AVS25597.1|1147184_1147940_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.6	1.7e-10
>prophage 85
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1154344	1155367	5438150		Bacillus_phage(100.0%)	1	NA	NA
AVS25602.1|1154344_1155367_+	methionine ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.0	1.3e-13
>prophage 86
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1165622	1166468	5438150		Vibrio_phage(100.0%)	1	NA	NA
AVS25612.1|1165622_1166468_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.4	1.9e-42
>prophage 87
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1173882	1179348	5438150		Streptococcus_phage(33.33%)	3	NA	NA
AVS25620.1|1173882_1175022_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.9	3.4e-47
AVS25621.1|1175179_1177930_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	28.9	6.4e-47
AVS25622.1|1178043_1179348_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	1.7e-34
>prophage 88
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1182890	1188227	5438150		Only_Syngen_Nebraska_virus(33.33%)	4	NA	NA
AVS25625.1|1182890_1184528_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	1.8e-153
AVS25626.1|1184609_1185908_+	enolase	NA	W6LP63	Streptococcus_phage	57.5	7.5e-131
AVS25627.1|1185971_1187081_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
AVS25628.1|1187555_1188227_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	32.1	2.5e-13
>prophage 89
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1196993	1199026	5438150		Hokovirus(50.0%)	2	NA	NA
AVS25635.1|1196993_1198421_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.9	1.4e-34
AVS25636.1|1198420_1199026_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.6	6.1e-27
>prophage 90
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1202096	1208515	5438150		uncultured_Mediterranean_phage(40.0%)	7	NA	NA
AVS25642.1|1202096_1202858_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	1.7e-58
AVS25643.1|1202851_1203478_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	6.3e-35
AVS25644.1|1203603_1204740_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
AVS25645.1|1204897_1205890_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	4.6e-32
AVS25646.1|1205942_1206320_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AVS25647.1|1206316_1207519_-	MFS transporter	NA	NA	NA	NA	NA
AVS25648.1|1207627_1208515_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.3	2.5e-05
>prophage 91
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1211984	1217148	5438150		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
AVS25654.1|1211984_1214546_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	1.3e-30
AVS25655.1|1214814_1215162_-	DUF1493 domain-containing protein	NA	NA	NA	NA	NA
AVS25656.1|1215146_1215596_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25657.1|1215607_1216090_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AVS25658.1|1216368_1217148_-	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.4	1.2e-11
>prophage 92
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1228892	1229714	5438150		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVS25670.1|1228892_1229714_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	2.1e-14
>prophage 93
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1240079	1241480	5438150		Pandoravirus(100.0%)	1	NA	NA
AVS25681.1|1240079_1241480_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.3	5.2e-45
>prophage 94
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1268421	1269387	5438150		Tetraselmis_virus(100.0%)	1	NA	NA
AVS25708.1|1268421_1269387_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.6	1.6e-37
>prophage 95
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1275172	1283377	5438150	tRNA	Bodo_saltans_virus(20.0%)	9	NA	NA
AVS25717.1|1275172_1275850_+	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	29.3	2.3e-06
AVS25718.1|1275846_1276710_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AVS29597.1|1276717_1277596_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS25719.1|1277735_1278233_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.0	8.3e-30
AVS25720.1|1278323_1279382_+	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	2.3e-114
AVS25721.1|1279449_1279950_+	recombination regulator RecX	NA	NA	NA	NA	NA
AVS25722.1|1280200_1282828_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	4.9e-81
AVS25723.1|1282899_1283082_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25724.1|1283191_1283377_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 96
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1298095	1303394	5438150		Bacillus_virus(25.0%)	5	NA	NA
AVS25739.1|1298095_1299298_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.8	1.2e-26
AVS25740.1|1299654_1300617_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.2	1.5e-131
AVS25741.1|1300627_1302769_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	46.4	2.5e-184
AVS25742.1|1302741_1303152_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
AVS25743.1|1303148_1303394_-	NrdH-redoxin	NA	A0A0M7REK7	Lactobacillus_phage	41.1	5.5e-11
>prophage 97
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1308575	1309478	5438150		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVS25750.1|1308575_1309478_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
>prophage 98
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1331636	1333157	5438150		Staphylococcus_phage(100.0%)	1	NA	NA
AVS25769.1|1331636_1333157_-	amino acid ABC transporter permease/ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	1.7e-17
>prophage 99
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1348522	1427262	5438150	integrase,plate,portal,lysis,tail,capsid,head,tRNA,coat	Salmonella_phage(73.47%)	85	1346816:1346862	1383382:1383428
1346816:1346862	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AVS25782.1|1348522_1349548_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
AVS25783.1|1349550_1350180_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
AVS25784.1|1350302_1350545_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
AVS25785.1|1350577_1351087_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
AVS25786.1|1351094_1351295_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
AVS25787.1|1351258_1351597_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
AVS25788.1|1351664_1351898_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
AVS25789.1|1351897_1352125_+	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
AVS25790.1|1352121_1352973_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
AVS25791.1|1352969_1355354_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
AVS25792.1|1355516_1355705_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
AVS25793.1|1355716_1355950_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
AVS25794.1|1356045_1356729_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25795.1|1356715_1357795_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25796.1|1357794_1358796_-	hypothetical protein	NA	NA	NA	NA	NA
AVS29603.1|1359317_1359587_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
AVS25797.1|1359643_1360687_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
AVS25798.1|1360686_1362450_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
AVS25799.1|1362590_1363424_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
AVS25800.1|1363440_1364493_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
AVS25801.1|1364496_1365150_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
AVS25802.1|1365245_1365710_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
AVS25803.1|1365709_1365913_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
AVS29604.1|1365916_1366132_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
AVS25804.1|1366112_1366622_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
AVS25805.1|1366626_1367010_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
AVS25806.1|1367006_1367435_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
AVS25807.1|1367364_1367568_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	3.0e-23
AVS25808.1|1367530_1367953_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
AVS25809.1|1367945_1368392_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
AVS25810.1|1368414_1369281_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25811.1|1369375_1369948_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
AVS25812.1|1369944_1370307_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
AVS25813.1|1370293_1371202_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
AVS29605.1|1371194_1371866_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
AVS25814.1|1371867_1373817_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
AVS25815.1|1373826_1374945_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
AVS25816.1|1374996_1376070_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
AVS25817.1|1376218_1377391_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
AVS25818.1|1377400_1377916_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
AVS25819.1|1377968_1378268_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
AVS25820.1|1378282_1378402_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AVS25821.1|1381020_1381506_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
AVS25822.1|1381502_1382597_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
AVS25823.1|1382663_1382882_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
AVS25824.1|1382909_1383287_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25825.1|1383890_1384373_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1383382:1383428	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AVS25826.1|1384483_1384960_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AVS25827.1|1384949_1385240_+	RnfH family protein	NA	NA	NA	NA	NA
AVS25828.1|1385306_1385648_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AVS25829.1|1385795_1387457_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AVS25830.1|1387543_1388422_-	NAD(+) kinase	NA	NA	NA	NA	NA
AVS25831.1|1388546_1389137_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AVS25832.1|1389256_1390543_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AVS25833.1|1390562_1391354_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AVS25834.1|1391517_1392882_+	signal recognition particle protein	NA	NA	NA	NA	NA
AVS25835.1|1393141_1393390_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AVS25836.1|1393408_1393957_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AVS25837.1|1393988_1394756_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AVS25838.1|1394795_1395143_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AVS25839.1|1395262_1395721_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AVS25840.1|1395777_1397148_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
AVS25841.1|1397156_1397639_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25842.1|1397652_1398876_-	diguanylate cyclase	NA	NA	NA	NA	NA
AVS25843.1|1398868_1399378_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AVS25844.1|1399720_1400791_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
AVS25845.1|1400800_1401922_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AVS25846.1|1401984_1402857_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AVS25847.1|1402853_1404014_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AVS29606.1|1404114_1404162_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25848.1|1404268_1404604_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AVS25849.1|1404874_1405612_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AVS25850.1|1405743_1406724_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AVS25851.1|1406720_1407452_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AVS25852.1|1407581_1410155_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
AVS25853.1|1416120_1417419_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
AVS25854.1|1417422_1417746_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25855.1|1417787_1419143_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AVS25856.1|1419263_1421924_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AVS25857.1|1421958_1422657_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AVS25858.1|1422726_1423152_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
AVS25859.1|1423355_1424441_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AVS25860.1|1424498_1425188_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
AVS25861.1|1425501_1425885_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
AVS25862.1|1425930_1427262_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
>prophage 100
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1433031	1455099	5438150	tRNA	Bacillus_phage(25.0%)	20	NA	NA
AVS25869.1|1433031_1434831_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	5.5e-23
AVS25870.1|1434846_1435821_+	signal peptidase I	NA	NA	NA	NA	NA
AVS25871.1|1436070_1436751_+	ribonuclease 3	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.6e-20
AVS25872.1|1436747_1437653_+	GTPase Era	NA	NA	NA	NA	NA
AVS25873.1|1437664_1438402_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AVS25874.1|1438413_1439145_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AVS25875.1|1439144_1439525_+	holo-ACP synthase	NA	NA	NA	NA	NA
AVS25876.1|1439537_1439798_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	6.5e-18
AVS25877.1|1439854_1440703_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AVS25878.1|1440916_1441552_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
AVS25879.1|1441581_1442124_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	2.6e-05
AVS25880.1|1442120_1443737_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
AVS25881.1|1443912_1447800_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	5.0e-130
AVS25882.1|1448390_1449812_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	1.1e-13
AVS25883.1|1449820_1450528_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AVS25884.1|1450514_1451852_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	35.0	1.0e-10
AVS25885.1|1451917_1452256_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
AVS25886.1|1452329_1453520_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AVS25887.1|1453560_1453827_+	hypothetical protein	NA	NA	NA	NA	NA
AVS25888.1|1453845_1455099_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	1.9e-99
>prophage 101
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1470346	1476667	5438150		Faustovirus(20.0%)	8	NA	NA
AVS25901.1|1470346_1471561_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.8	3.2e-35
AVS25902.1|1471587_1471974_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
AVS25903.1|1471991_1472315_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
AVS25904.1|1472389_1472905_+	co-chaperone HscB	NA	NA	NA	NA	NA
AVS25905.1|1472920_1474771_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.5	1.9e-103
AVS25906.1|1474772_1475108_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AVS25907.1|1475109_1475310_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AVS25908.1|1475380_1476667_+	peptidase B	NA	Q6GYZ8	Mycoplasma_phage	37.8	9.9e-35
>prophage 102
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1487179	1487611	5438150		Powai_lake_megavirus(100.0%)	1	NA	NA
AVS25914.1|1487179_1487611_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 103
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1497931	1544184	5438150	holin,tail,terminase,capsid	Salmonella_phage(45.83%)	60	NA	NA
AVS25925.1|1497931_1499323_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	6.3e-35
AVS25926.1|1499481_1500948_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
AVS25927.1|1501015_1502593_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AVS25928.1|1502785_1504036_+	DUF4102 domain-containing protein	NA	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
AVS25929.1|1504052_1504244_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25930.1|1504240_1504423_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25931.1|1504419_1505013_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
AVS25932.1|1505009_1505168_-	DUF1317 domain-containing protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
AVS25933.1|1505160_1505454_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
AVS25934.1|1505563_1505812_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
AVS25935.1|1505863_1506886_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
AVS25936.1|1506895_1507795_-	endonuclease	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
AVS25937.1|1507791_1508091_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
AVS25938.1|1508457_1509039_-	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
AVS25939.1|1509192_1509426_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
AVS25940.1|1509573_1509783_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
AVS25941.1|1509782_1510550_+	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.0	3.4e-139
AVS25942.1|1510546_1511332_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
AVS25943.1|1511451_1511799_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
AVS25944.1|1511991_1512402_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
AVS25945.1|1512385_1512577_+	hypothetical protein	NA	NA	NA	NA	NA
AVS25946.1|1512573_1512999_+	hypothetical protein	NA	NA	NA	NA	NA
AVS25947.1|1512995_1513739_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
AVS25948.1|1513909_1514122_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
AVS25949.1|1514118_1514787_+	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
AVS25950.1|1514779_1515019_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
AVS25951.1|1515018_1515357_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
AVS29608.1|1515431_1515689_+	lF-82	NA	NA	NA	NA	NA
AVS25952.1|1515766_1516351_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
AVS25953.1|1516347_1517823_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	92.9	1.9e-279
AVS25954.1|1517866_1518388_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	55.2	7.8e-47
AVS25955.1|1518883_1519072_+	hypothetical protein	NA	NA	NA	NA	NA
AVS25956.1|1519093_1519297_+	hypothetical protein	NA	NA	NA	NA	NA
AVS25957.1|1519300_1520980_+|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	58.9	3.4e-192
AVS25958.1|1520976_1521282_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
AVS25959.1|1521324_1521522_+	hypothetical protein	NA	NA	NA	NA	NA
AVS25960.1|1521563_1521962_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
AVS25961.1|1521974_1522982_+|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	2.7e-181
AVS25962.1|1522991_1523384_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
AVS25963.1|1523376_1523655_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	6.7e-21
AVS25964.1|1523703_1524315_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	1.2e-46
AVS25965.1|1524314_1526792_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.5	3.6e-267
AVS25966.1|1526793_1527264_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	7.3e-44
AVS25967.1|1527256_1527754_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	40.5	5.7e-23
AVS25968.1|1527766_1530511_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.2	9.1e-94
AVS25969.1|1530510_1533900_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	6.3e-121
AVS25970.1|1533909_1534524_+	hypothetical protein	NA	NA	NA	NA	NA
AVS25971.1|1534556_1534709_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	85.7	1.9e-14
AVS25972.1|1534798_1535197_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25973.1|1535201_1535384_-	hypothetical protein	NA	NA	NA	NA	NA
AVS25974.1|1535574_1536270_-	anti-repressor protein	NA	A0A193GYJ9	Enterobacter_phage	52.7	4.4e-61
AVS25975.1|1536650_1536848_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	69.8	2.0e-19
AVS25976.1|1536851_1537109_-	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	54.1	2.3e-12
AVS25977.1|1537199_1537496_-	hypothetical protein	NA	T1SA06	Salmonella_phage	65.5	6.2e-25
AVS25978.1|1537647_1540017_+|tail	phage tail protein	tail	A0A2H5BN49	Klebsiella_phage	79.5	9.1e-268
AVS25979.1|1540301_1540706_+	hypothetical protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
AVS25980.1|1540692_1540998_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
AVS25981.1|1540987_1541617_+	endolysin	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
AVS25982.1|1541613_1542096_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
AVS25983.1|1542315_1544184_-	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 104
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1547953	1548145	5438150		Escherichia_phage(100.0%)	1	NA	NA
AVS25987.1|1547953_1548145_-	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
>prophage 105
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1554556	1556232	5438150		Prochlorococcus_phage(100.0%)	2	NA	NA
AVS25991.1|1554556_1555198_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
AVS25992.1|1555194_1556232_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
>prophage 106
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1559771	1562766	5438150	transposase	Enterobacteria_phage(50.0%)	3	NA	NA
AVS25996.1|1559771_1561058_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
AVS25997.1|1561156_1561858_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
AVS25998.1|1561854_1562766_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
>prophage 107
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1569410	1570124	5438150		Cyanophage(100.0%)	1	NA	NA
AVS26006.1|1569410_1570124_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
>prophage 108
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1605023	1608600	5438150		Paenibacillus_phage(50.0%)	5	NA	NA
AVS26039.1|1605023_1605896_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.2e-17
AVS26040.1|1606107_1606533_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AVS26041.1|1606519_1606969_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AVS26042.1|1607030_1607606_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AVS26043.1|1607700_1608600_+	peroxidase	NA	S4VVJ7	Pandoravirus	32.6	3.8e-25
>prophage 109
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1611953	1614078	5438150		Planktothrix_phage(50.0%)	2	NA	NA
AVS26047.1|1611953_1613048_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	1.6e-30
AVS26048.1|1613166_1614078_+	cysteine synthase CysM	NA	A0A1W6JHY1	Lactococcus_phage	40.3	2.8e-52
>prophage 110
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1617686	1627613	5438150		Hokovirus(25.0%)	9	NA	NA
AVS26054.1|1617686_1619414_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.6	3.3e-17
AVS26055.1|1619458_1619716_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AVS26056.1|1620096_1621068_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	3.3e-75
AVS26057.1|1621244_1622006_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
AVS29610.1|1622239_1623298_+	cell division protein ZipA	NA	NA	NA	NA	NA
AVS26058.1|1623367_1625383_+	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.5	2.8e-145
AVS26059.1|1625384_1625603_+	hypothetical protein	NA	NA	NA	NA	NA
AVS26060.1|1625599_1626598_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
AVS26061.1|1626686_1627613_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.3	4.1e-06
>prophage 111
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1642103	1644550	5438150		Clostridioides_phage(50.0%)	2	NA	NA
AVS29612.1|1642103_1642841_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
AVS26072.1|1642852_1644550_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
>prophage 112
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1647820	1652403	5438150		Pandoravirus(25.0%)	5	NA	NA
AVS26076.1|1647820_1648279_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	32.3	1.2e-11
AVS26077.1|1648411_1649320_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	7.8e-10
AVS26078.1|1649329_1650211_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
AVS26079.1|1650578_1651061_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AVS26080.1|1651473_1652403_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	81.1	4.4e-133
>prophage 113
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1661518	1662604	5438150		Pandoravirus(100.0%)	1	NA	NA
AVS26089.1|1661518_1662604_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
>prophage 114
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1671086	1672223	5438150		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVS26096.1|1671086_1672223_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
>prophage 115
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1678665	1680183	5438150		Mollivirus(100.0%)	1	NA	NA
AVS26104.1|1678665_1680183_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.6	1.0e-86
>prophage 116
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1684474	1685248	5438150		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AVS26110.1|1684474_1685248_+	histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.9e-09
>prophage 117
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1697650	1698250	5438150		Salmonella_phage(100.0%)	1	NA	NA
AVS26124.1|1697650_1698250_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	2.4e-07
>prophage 118
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1726276	1727230	5438150	transposase	Sodalis_phage(100.0%)	1	NA	NA
AVS26150.1|1726276_1727230_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.1	1.1e-67
>prophage 119
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1739396	1751527	5438150		Pseudomonas_phage(33.33%)	9	NA	NA
AVS26160.1|1739396_1740467_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	52.6	2.1e-09
AVS26161.1|1740463_1740769_-	oxidoreductase	NA	NA	NA	NA	NA
AVS26162.1|1740930_1741185_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	65.3	8.2e-26
AVS26163.1|1741184_1742315_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.7	1.0e-176
AVS26164.1|1742416_1744702_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	2.5e-283
AVS26165.1|1744814_1745003_-	hypothetical protein	NA	NA	NA	NA	NA
AVS26166.1|1745046_1745775_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
AVS26167.1|1745921_1748555_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.0	6.0e-95
AVS26168.1|1748686_1751527_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.9	8.3e-42
>prophage 120
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1755666	1759070	5438150		Enterobacteria_phage(50.0%)	3	NA	NA
AVS26171.1|1755666_1756776_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.5	1.8e-117
AVS26172.1|1756879_1757932_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AVS26173.1|1758005_1759070_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	49.5	2.0e-17
>prophage 121
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1762990	1764151	5438150		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVS26177.1|1762990_1764151_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.2	8.6e-78
>prophage 122
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1770516	1771524	5438150		Vibrio_phage(100.0%)	1	NA	NA
AVS26182.1|1770516_1771524_+	nucleoid-associated protein	NA	A0A1V0E8C0	Vibrio_phage	49.8	2.4e-84
>prophage 123
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1775760	1781847	5438150		Vibrio_phage(33.33%)	5	NA	NA
AVS26188.1|1775760_1777518_-	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	41.8	6.4e-101
AVS26189.1|1777665_1778385_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
AVS26190.1|1778381_1779578_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	24.2	2.6e-21
AVS26191.1|1779909_1780254_+	hypothetical protein	NA	NA	NA	NA	NA
AVS26192.1|1780257_1781847_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	4.5e-21
>prophage 124
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1787602	1795574	5438150		Clostridioides_phage(33.33%)	8	NA	NA
AVS26197.1|1787602_1788172_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.0	3.1e-12
AVS29617.1|1788597_1789305_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AVS26198.1|1789348_1790326_-	GTP-binding protein	NA	NA	NA	NA	NA
AVS26199.1|1790446_1791913_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.2	3.2e-45
AVS26200.1|1792120_1793311_+	mannonate dehydratase	NA	NA	NA	NA	NA
AVS26201.1|1793381_1793954_-	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
AVS26202.1|1794101_1794356_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AVS26203.1|1794794_1795574_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.2	1.4e-39
>prophage 125
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1801282	1802137	5438150		Catovirus(100.0%)	1	NA	NA
AVS26210.1|1801282_1802137_-	endonuclease	NA	A0A1V0SBL9	Catovirus	33.2	1.5e-23
>prophage 126
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1806536	1810443	5438150		Acinetobacter_phage(50.0%)	3	NA	NA
AVS26214.1|1806536_1808510_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.5	4.8e-12
AVS26215.1|1808580_1809414_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AVS26216.1|1809774_1810443_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	3.4e-55
>prophage 127
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1814207	1815728	5438150		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVS26220.1|1814207_1815728_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
>prophage 128
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1831752	1832307	5438150		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVS26235.1|1831752_1832307_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.8	1.3e-20
>prophage 129
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1838841	1845895	5438150	tRNA	Enterobacteria_phage(50.0%)	7	NA	NA
AVS26240.1|1838841_1839789_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	6.9e-25
AVS26241.1|1839772_1840510_+	ABC transporter permease	NA	NA	NA	NA	NA
AVS26242.1|1840484_1840598_-	hypothetical protein	NA	NA	NA	NA	NA
AVS29620.1|1840827_1842516_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.0	1.6e-258
AVS26243.1|1842509_1843229_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
AVS26244.1|1843276_1843747_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	74.4	6.6e-61
AVS26245.1|1843861_1845895_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	8.9e-54
>prophage 130
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1872914	1879821	5438150		Planktothrix_phage(33.33%)	6	NA	NA
AVS29623.1|1872914_1873778_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AVS26268.1|1873788_1874562_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
AVS29624.1|1874804_1875698_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AVS26269.1|1875943_1877305_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.5	2.5e-206
AVS26270.1|1877623_1878346_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
AVS26271.1|1878342_1879821_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
>prophage 131
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1896941	1903815	5438150		Catovirus(25.0%)	5	NA	NA
AVS26283.1|1896941_1897583_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.0e-36
AVS26284.1|1897673_1898255_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
AVS26285.1|1898285_1900133_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AVS26286.1|1900575_1902159_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	5.0e-36
AVS29625.1|1902924_1903815_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	9.6e-45
>prophage 132
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1916388	1924013	5438150		Enterobacteria_phage(28.57%)	7	NA	NA
AVS26295.1|1916388_1917795_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
AVS26296.1|1918019_1919084_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
AVS26297.1|1919110_1919980_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
AVS26298.1|1920011_1920902_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
AVS26299.1|1920916_1921471_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
AVS26300.1|1921651_1922818_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
AVS26301.1|1923011_1924013_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
>prophage 133
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1929761	1946024	5438150	tail,transposase	Klebsiella_phage(12.5%)	13	NA	NA
AVS26305.1|1929761_1931339_+|tail	phage tail protein	tail	A0A2H5BN49	Klebsiella_phage	45.3	4.4e-117
AVS26306.1|1932074_1932269_-	hypothetical protein	NA	NA	NA	NA	NA
AVS26307.1|1932338_1933343_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.0e-31
AVS29627.1|1934386_1935154_+	ABC transporter permease	NA	NA	NA	NA	NA
AVS26308.1|1935153_1935894_+	O-antigen export system ATP-binding protein RfbB	NA	A0A2K9L3Z8	Tupanvirus	24.9	1.7e-07
AVS26309.1|1935909_1937805_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
AVS26310.1|1937820_1938975_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.5	1.1e-77
AVS26311.1|1938971_1939865_+	glycosyl transferase	NA	NA	NA	NA	NA
AVS26312.1|1940958_1941939_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AVS26313.1|1941920_1942208_+	hypothetical protein	NA	NA	NA	NA	NA
AVS26314.1|1942303_1943512_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.0	1.7e-07
AVS26315.1|1943581_1945042_-	glucosyl transferase GtrII family protein	NA	E5AGC8	Erwinia_phage	43.5	9.4e-106
AVS26316.1|1945043_1946024_-	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.8	8.9e-44
>prophage 134
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1952735	1953635	5438150		Cellulophaga_phage(100.0%)	1	NA	NA
AVS29628.1|1952735_1953635_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	1.4e-11
>prophage 135
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1958132	1966680	5438150	transposase	Streptococcus_phage(25.0%)	6	NA	NA
AVS26329.1|1958132_1960235_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.9	2.8e-63
AVS26330.1|1960401_1961765_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
AVS26331.1|1961906_1963331_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AVS26332.1|1963505_1964675_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	80.7	7.6e-183
AVS26333.1|1964944_1965196_+	hypothetical protein	NA	NA	NA	NA	NA
AVS26334.1|1965195_1966680_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
>prophage 136
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1982105	1982942	5438150		Mycobacterium_phage(100.0%)	1	NA	NA
AVS26353.1|1982105_1982942_+	alpha/beta hydrolase	NA	A0A2D1GKK1	Mycobacterium_phage	28.8	4.8e-14
>prophage 137
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1986915	1987134	5438150		Stenotrophomonas_phage(100.0%)	1	NA	NA
AVS26357.1|1986915_1987134_+	AlpA family transcriptional regulator	NA	B7SYF9	Stenotrophomonas_phage	50.0	2.5e-07
>prophage 138
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	1993750	1994170	5438150		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVS26368.1|1993750_1994170_-	TIR domain-containing protein	NA	A0A2H4J496	uncultured_Caudovirales_phage	33.3	9.2e-06
>prophage 139
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2005033	2012782	5438150		Erysipelothrix_phage(66.67%)	4	NA	NA
AVS26379.1|2005033_2007994_-	restriction endonuclease subunit R	NA	A0A2K5B2C2	Erysipelothrix_phage	38.1	1.9e-161
AVS26380.1|2008003_2009854_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	38.4	9.4e-103
AVS26381.1|2010047_2011436_+	SpnT protein	NA	NA	NA	NA	NA
AVS26382.1|2011507_2012782_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	38.2	6.1e-69
>prophage 140
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2031222	2039666	5438150		Burkholderia_phage(40.0%)	8	NA	NA
AVS26398.1|2031222_2032368_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
AVS26399.1|2032906_2033188_+	hypothetical protein	NA	NA	NA	NA	NA
AVS26400.1|2033230_2033938_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
AVS26401.1|2033981_2035415_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	4.0e-101
AVS29632.1|2035395_2035890_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	51.4	2.6e-31
AVS26402.1|2035864_2036776_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AVS26403.1|2036959_2037871_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AVS26404.1|2037986_2039666_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	6.9e-20
>prophage 141
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2046267	2047020	5438150		Bacillus_virus(100.0%)	1	NA	NA
AVS26413.1|2046267_2047020_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	2.2e-26
>prophage 142
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2063627	2065142	5438150		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVS26432.1|2063627_2065142_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	6.9e-11
>prophage 143
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2072080	2088627	5438150	tRNA	Tupanvirus(25.0%)	18	NA	NA
AVS26439.1|2072080_2073814_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
AVS26440.1|2074049_2074619_+	VOC family protein	NA	NA	NA	NA	NA
AVS26441.1|2074695_2075439_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AVS26442.1|2075520_2076525_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AVS26443.1|2076521_2077265_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
AVS26444.1|2077304_2077700_-	hypothetical protein	NA	NA	NA	NA	NA
AVS26445.1|2077752_2078571_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
AVS26446.1|2078567_2079134_-	hydrolase	NA	NA	NA	NA	NA
AVS26447.1|2079401_2081189_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
AVS26448.1|2081190_2081634_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AVS26449.1|2081661_2082402_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AVS26450.1|2082436_2082958_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	3.4e-10
AVS26451.1|2083037_2083649_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AVS26452.1|2083657_2084668_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	1.4e-07
AVS26453.1|2084731_2085517_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AVS26454.1|2085516_2086269_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.4	6.7e-15
AVS26455.1|2086347_2087292_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AVS26456.1|2087307_2088627_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	38.2	5.3e-15
>prophage 144
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2092552	2094028	5438150		Cyanophage(100.0%)	1	NA	NA
AVS26461.1|2092552_2094028_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.2e-77
>prophage 145
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2101453	2102422	5438150		Pseudoalteromonas_phage(50.0%)	2	NA	NA
AVS26468.1|2101453_2102113_-	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	31.7	2.2e-14
AVS26469.1|2102191_2102422_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	57.4	5.9e-15
>prophage 146
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2106145	2106799	5438150		Escherichia_phage(100.0%)	1	NA	NA
AVS26473.1|2106145_2106799_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	1.7e-54
>prophage 147
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2114306	2116355	5438150		Moraxella_phage(100.0%)	1	NA	NA
AVS26481.1|2114306_2116355_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	2.3e-86
>prophage 148
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2121591	2121801	5438150		Morganella_phage(100.0%)	1	NA	NA
AVS26490.1|2121591_2121801_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 149
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2129241	2130801	5438150		Moraxella_phage(100.0%)	1	NA	NA
AVS26497.1|2129241_2130801_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.0	1.1e-40
>prophage 150
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2134703	2142072	5438150	tRNA	Pandoravirus(33.33%)	7	NA	NA
AVS26501.1|2134703_2136059_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	40.4	1.8e-42
AVS26502.1|2136147_2136333_+	YoaH family protein	NA	NA	NA	NA	NA
AVS26503.1|2136333_2136678_-	RidA family protein	NA	NA	NA	NA	NA
AVS26504.1|2136809_2138720_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.0	8.5e-91
AVS26505.1|2138865_2139561_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AVS26506.1|2139599_2140181_+	hypothetical protein	NA	NA	NA	NA	NA
AVS29638.1|2140386_2142072_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.7e-34
>prophage 151
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2157697	2158309	5438150		Geobacillus_virus(100.0%)	1	NA	NA
AVS26523.1|2157697_2158309_+	murein transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
>prophage 152
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2174431	2176726	5438150		Tetraselmis_virus(100.0%)	1	NA	NA
AVS29639.1|2174431_2176726_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	2.3e-159
>prophage 153
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2180579	2223493	5438150	transposase,plate	Staphylococcus_phage(18.18%)	43	NA	NA
AVS26541.1|2180579_2181455_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	25.5	1.5e-10
AVS26542.1|2181451_2182171_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
AVS26543.1|2182176_2183070_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS26544.1|2183353_2184997_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	9.8e-136
AVS26545.1|2185046_2185523_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVS26546.1|2185621_2186548_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS26547.1|2186851_2188147_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
AVS26548.1|2188161_2188968_+	molybdenum ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS26549.1|2188942_2189842_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS26550.1|2189951_2190434_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
AVS26551.1|2190624_2191323_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
AVS29640.1|2191348_2191888_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
AVS26552.1|2192002_2192332_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AVS26553.1|2192418_2192664_+	hypothetical protein	NA	NA	NA	NA	NA
AVS26554.1|2192673_2192853_-	hypothetical protein	NA	NA	NA	NA	NA
AVS26555.1|2192900_2194241_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVS26556.1|2194237_2194891_+	type VI secretion system protein ImpK	NA	NA	NA	NA	NA
AVS26557.1|2194894_2196592_+	cell envelope biogenesis protein OmpA	NA	NA	NA	NA	NA
AVS26558.1|2199555_2200911_+	S-type Pyocin	NA	NA	NA	NA	NA
AVS26559.1|2200911_2201421_+	hypothetical protein	NA	NA	NA	NA	NA
AVS26560.1|2201417_2201924_+	hypothetical protein	NA	NA	NA	NA	NA
AVS26561.1|2202160_2202670_+	hypothetical protein	NA	NA	NA	NA	NA
AVS26562.1|2204320_2205244_+|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	1.6e-172
AVS26563.1|2205385_2205568_+	hypothetical protein	NA	NA	NA	NA	NA
AVS26564.1|2205564_2205894_+	hypothetical protein	NA	NA	NA	NA	NA
AVS26565.1|2205890_2206397_+	hypothetical protein	NA	NA	NA	NA	NA
AVS26566.1|2206442_2206673_+	hypothetical protein	NA	NA	NA	NA	NA
AVS26567.1|2206778_2208218_+	hypothetical protein	NA	NA	NA	NA	NA
AVS26568.1|2208239_2209133_+	sulfatase modifying factor 1	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
AVS26569.1|2209316_2210210_+	sulfatase modifying factor 1	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
AVS26570.1|2210385_2211279_+	sulfatase modifying factor 1	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
AVS26571.1|2211454_2212345_+	sulfatase modifying factor 1	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
AVS26572.1|2212681_2213662_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AVS29641.1|2213700_2213823_-	ABC transporter	NA	NA	NA	NA	NA
AVS29642.1|2213785_2214022_+	hypothetical protein	NA	NA	NA	NA	NA
AVS26573.1|2214210_2214468_+	hypothetical protein	NA	NA	NA	NA	NA
AVS26574.1|2214765_2215032_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
AVS26575.1|2215035_2216193_+	type VI secretion protein	NA	NA	NA	NA	NA
AVS26576.1|2216176_2219587_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
AVS26577.1|2219720_2221484_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVS26578.1|2221483_2222530_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVS29643.1|2222510_2223047_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AVS26579.1|2223049_2223493_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 154
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2230078	2232830	5438150		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVS26587.1|2230078_2231758_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	7.9e-24
AVS26588.1|2231882_2232830_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
>prophage 155
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2236042	2241756	5438150		Pseudomonas_phage(33.33%)	7	NA	NA
AVS26592.1|2236042_2237125_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.9e-07
AVS26593.1|2237124_2237973_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVS26594.1|2237972_2238365_+	siroheme synthase	NA	NA	NA	NA	NA
AVS26595.1|2238368_2239181_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
AVS26596.1|2239220_2240075_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.2	2.3e-48
AVS26597.1|2240161_2241262_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AVS26598.1|2241525_2241756_+	cation transport regulator	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	48.0	5.4e-08
>prophage 156
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2247267	2248056	5438150		Bacillus_virus(100.0%)	1	NA	NA
AVS26604.1|2247267_2248056_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	2.6e-30
>prophage 157
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2264549	2266085	5438150		Escherichia_phage(100.0%)	1	NA	NA
AVS26612.1|2264549_2266085_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	2.8e-20
>prophage 158
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2270098	2276368	5438150		Synechococcus_phage(25.0%)	7	NA	NA
AVS26617.1|2270098_2270941_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	43.1	8.3e-14
AVS26618.1|2270983_2271454_-	hypothetical protein	NA	NA	NA	NA	NA
AVS26619.1|2271554_2272457_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
AVS26620.1|2272546_2273560_+	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	29.4	1.1e-07
AVS26621.1|2273757_2274660_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	47.6	1.8e-59
AVS26622.1|2274781_2275189_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
AVS26623.1|2275750_2276368_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.2e-54
>prophage 159
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2284625	2287523	5438150		Planktothrix_phage(33.33%)	3	NA	NA
AVS26629.1|2284625_2285639_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	3.8e-13
AVS26630.1|2285635_2286640_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.6	2.6e-14
AVS26631.1|2286695_2287523_+	transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	3.9e-08
>prophage 160
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2297180	2304349	5438150	tRNA	Tupanvirus(25.0%)	7	NA	NA
AVS26643.1|2297180_2299109_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.3e-128
AVS26644.1|2299112_2299655_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	6.3e-15
AVS26645.1|2299747_2299945_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVS26646.1|2299995_2300352_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVS26647.1|2300658_2301642_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	4.9e-34
AVS26648.1|2301657_2304045_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AVS26649.1|2304049_2304349_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
>prophage 161
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2311415	2319384	5438150		Brazilian_cedratvirus(25.0%)	7	NA	NA
AVS26657.1|2311415_2312165_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	6.4e-10
AVS26658.1|2312246_2312711_+	lipoprotein	NA	NA	NA	NA	NA
AVS26659.1|2312824_2314267_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	37.0	5.1e-56
AVS26660.1|2314296_2314524_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
AVS29645.1|2314631_2315678_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	46.6	2.3e-82
AVS29646.1|2315832_2316666_-	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AVS26661.1|2317005_2319384_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	1.4e-172
>prophage 162
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2329393	2330155	5438150		Indivirus(100.0%)	1	NA	NA
AVS26671.1|2329393_2330155_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	2.3e-15
>prophage 163
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2344647	2347860	5438150		Indivirus(50.0%)	3	NA	NA
AVS26685.1|2344647_2345394_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.5	3.0e-07
AVS26686.1|2345368_2346643_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
AVS26687.1|2346639_2347860_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	9.9e-93
>prophage 164
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2357780	2358530	5438150		Erysipelothrix_phage(100.0%)	1	NA	NA
AVS26699.1|2357780_2358530_-	ABC transporter ATP-binding protein	NA	A0A2I4R674	Erysipelothrix_phage	29.4	3.7e-05
>prophage 165
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2365967	2367931	5438150		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
AVS26707.1|2365967_2366918_+	acetaldehyde dehydrogenase	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.3	2.1e-34
AVS26708.1|2366914_2367931_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	1.5e-41
>prophage 166
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2378581	2379355	5438150		Bacillus_virus(100.0%)	1	NA	NA
AVS26718.1|2378581_2379355_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.2	3.1e-31
>prophage 167
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2382870	2383692	5438150		Planktothrix_phage(100.0%)	1	NA	NA
AVS26720.1|2382870_2383692_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	8.6e-16
>prophage 168
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2403203	2404274	5438150		Bacillus_virus(100.0%)	1	NA	NA
AVS26738.1|2403203_2404274_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	4.1e-26
>prophage 169
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2409131	2409755	5438150		Staphylococcus_phage(100.0%)	1	NA	NA
AVS26742.1|2409131_2409755_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	23.4	1.8e-05
>prophage 170
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2421813	2427458	5438150		Bacillus_phage(50.0%)	4	NA	NA
AVS26756.1|2421813_2422518_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.4	1.6e-26
AVS26757.1|2422800_2423190_+	transporter	NA	NA	NA	NA	NA
AVS26758.1|2423419_2424304_+	hypothetical protein	NA	NA	NA	NA	NA
AVS26759.1|2424341_2427458_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.2	1.2e-54
>prophage 171
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2444790	2445621	5438150		Bacillus_virus(100.0%)	1	NA	NA
AVS26777.1|2444790_2445621_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.4e-26
>prophage 172
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2459662	2461611	5438150		Planktothrix_phage(50.0%)	2	NA	NA
AVS26793.1|2459662_2460634_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.6	1.1e-17
AVS26794.1|2460630_2461611_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	1.5e-11
>prophage 173
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2466795	2467566	5438150		Escherichia_phage(100.0%)	1	NA	NA
AVS26799.1|2466795_2467566_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.4	3.2e-12
>prophage 174
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2473042	2484028	5438150		Burkholderia_virus(20.0%)	11	NA	NA
AVS26807.1|2473042_2473927_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.7	1.5e-21
AVS26808.1|2474451_2474913_+	hypothetical protein	NA	NA	NA	NA	NA
AVS26809.1|2474909_2475137_+	hypothetical protein	NA	NA	NA	NA	NA
AVS26810.1|2475816_2476395_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.1	2.0e-19
AVS26811.1|2476535_2476886_-	acid-shock protein	NA	NA	NA	NA	NA
AVS26812.1|2477061_2478435_-	multidrug transporter MdtK	NA	NA	NA	NA	NA
AVS26813.1|2478664_2479300_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	1.3e-22
AVS26814.1|2479336_2480485_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	1.2e-84
AVS26815.1|2480777_2481959_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AVS26816.1|2482071_2483076_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS26817.1|2483002_2484028_-	PurR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.9	1.2e-30
>prophage 175
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2487299	2488172	5438150		Bacillus_phage(100.0%)	1	NA	NA
AVS26822.1|2487299_2488172_-	peptidoglycan endopeptidase	NA	A0A217EQL1	Bacillus_phage	39.5	1.7e-17
>prophage 176
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2492359	2493847	5438150		Indivirus(50.0%)	2	NA	NA
AVS26829.1|2492359_2493256_+	oxidoreductase	NA	A0A1V0SDE7	Indivirus	28.7	1.8e-06
AVS26830.1|2493325_2493847_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	58.0	3.1e-51
>prophage 177
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2497653	2499015	5438150		Bacillus_phage(100.0%)	1	NA	NA
AVS26835.1|2497653_2499015_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.7	6.9e-18
>prophage 178
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2502351	2503626	5438150	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AVS26840.1|2502351_2503626_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.0	1.1e-86
>prophage 179
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2514881	2516252	5438150		Pandoravirus(100.0%)	1	NA	NA
AVS26852.1|2514881_2516252_-	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	35.1	2.8e-67
>prophage 180
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2521803	2523855	5438150		Escherichia_phage(50.0%)	3	NA	NA
AVS26860.1|2521803_2522331_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	46.8	5.9e-18
AVS26861.1|2522436_2522712_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
AVS26862.1|2522736_2523855_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	30.0	8.1e-33
>prophage 181
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2530678	2533319	5438150		Moumouvirus(100.0%)	2	NA	NA
AVS26868.1|2530678_2532184_+	carboxylesterase/lipase family protein	NA	M1PNU1	Moumouvirus	38.0	7.3e-29
AVS26869.1|2532230_2533319_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	25.9	6.9e-05
>prophage 182
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2543751	2545713	5438150	protease	Phage_TP(100.0%)	1	NA	NA
AVS26881.1|2543751_2545713_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.0	5.1e-22
>prophage 183
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2552584	2553598	5438150		Mycoplasma_phage(100.0%)	1	NA	NA
AVS26888.1|2552584_2553598_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	56.4	2.1e-24
>prophage 184
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2569320	2571411	5438150		Salmonella_phage(100.0%)	1	NA	NA
AVS29658.1|2569320_2571411_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.6	1.6e-138
>prophage 185
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2582481	2583261	5438150		Bacillus_virus(100.0%)	1	NA	NA
AVS26918.1|2582481_2583261_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.6e-19
>prophage 186
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2591697	2592399	5438150		Bacillus_virus(100.0%)	1	NA	NA
AVS29659.1|2591697_2592399_+	ABC transporter substrate-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.2e-31
>prophage 187
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2597680	2599225	5438150		Escherichia_phage(100.0%)	1	NA	NA
AVS26932.1|2597680_2599225_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.4e-19
>prophage 188
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2605332	2606832	5438150		Mycobacterium_phage(100.0%)	1	NA	NA
AVS26936.1|2605332_2606832_+	methyl viologen resistance protein SmvA	NA	A0A0M3UL24	Mycobacterium_phage	29.3	4.6e-31
>prophage 189
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2613311	2614085	5438150		Bacillus_phage(100.0%)	1	NA	NA
AVS26944.1|2613311_2614085_+	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	W8CYX9	Bacillus_phage	48.5	3.8e-05
>prophage 190
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2625356	2626973	5438150		Planktothrix_phage(100.0%)	1	NA	NA
AVS26957.1|2625356_2626973_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	2.1e-18
>prophage 191
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2630561	2635297	5438150		Tupanvirus(66.67%)	4	NA	NA
AVS26961.1|2630561_2631572_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.8	4.9e-29
AVS26962.1|2631824_2632424_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	5.0e-21
AVS26963.1|2632591_2633545_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVS26964.1|2633581_2635297_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	23.8	3.6e-32
>prophage 192
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2641146	2643483	5438150		Trichoplusia_ni_ascovirus(50.0%)	5	NA	NA
AVS29660.1|2641146_2642019_-	NAD(P)-dependent oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	58.6	1.3e-83
AVS26971.1|2642716_2642902_+	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AVS26972.1|2642908_2643109_+	hypothetical protein	NA	NA	NA	NA	NA
AVS26973.1|2643011_2643242_-	hypothetical protein	NA	NA	NA	NA	NA
AVS26974.1|2643267_2643483_+	hypothetical protein	NA	H9NCK9	Mycobacterium_phage	48.0	9.4e-07
>prophage 193
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2648354	2649895	5438150	transposase	Escherichia_phage(50.0%)	2	NA	NA
AVS26980.1|2648354_2649335_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AVS26981.1|2649490_2649895_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	41.6	2.0e-10
>prophage 194
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2660479	2661160	5438150		Bacillus_virus(100.0%)	1	NA	NA
AVS26992.1|2660479_2661160_+	magnesium transport protein MgtC	NA	G3MA03	Bacillus_virus	41.9	2.1e-15
>prophage 195
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2669706	2671992	5438150		Indivirus(100.0%)	1	NA	NA
AVS27000.1|2669706_2671992_-	pyrroloquinoline quinone biosynthesis protein PqqF	NA	A0A1V0SD84	Indivirus	26.7	8.5e-13
>prophage 196
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2677681	2679762	5438150		Bacillus_phage(100.0%)	2	NA	NA
AVS27007.1|2677681_2678422_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.6	1.9e-30
AVS27008.1|2678418_2679762_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	24.3	5.2e-10
>prophage 197
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2683897	2688014	5438150		Klosneuvirus(50.0%)	4	NA	NA
AVS27012.1|2683897_2685283_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.0	7.4e-28
AVS27013.1|2685589_2686525_-	thiamine biosynthesis protein	NA	NA	NA	NA	NA
AVS27014.1|2686549_2687245_-	ABC transporter permease	NA	NA	NA	NA	NA
AVS27015.1|2687285_2688014_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.5	2.1e-18
>prophage 198
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2693954	2695211	5438150		Bacillus_phage(100.0%)	1	NA	NA
AVS27021.1|2693954_2695211_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.9	1.2e-19
>prophage 199
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2726406	2727144	5438150		Planktothrix_phage(100.0%)	1	NA	NA
AVS27053.1|2726406_2727144_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.9	3.0e-36
>prophage 200
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2742746	2743799	5438150		Enterobacteria_phage(100.0%)	1	NA	NA
AVS27068.1|2742746_2743799_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.6	1.2e-14
>prophage 201
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2747463	2748387	5438150	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
AVS27074.1|2747463_2748387_-|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	1.6e-172
>prophage 202
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2759538	2760321	5438150		Staphylococcus_phage(100.0%)	1	NA	NA
AVS27087.1|2759538_2760321_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	2.4e-15
>prophage 203
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2773733	2774252	5438150		Erysipelothrix_phage(100.0%)	1	NA	NA
AVS27099.1|2773733_2774252_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	37.6	1.3e-25
>prophage 204
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2787663	2788437	5438150		Escherichia_phage(100.0%)	1	NA	NA
AVS27110.1|2787663_2788437_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.6	2.0e-22
>prophage 205
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2795732	2797289	5438150		Catovirus(100.0%)	1	NA	NA
AVS27118.1|2795732_2797289_+	AMP-dependent synthetase	NA	A0A1V0SBX8	Catovirus	25.2	1.5e-16
>prophage 206
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2804651	2805827	5438150		Streptococcus_phage(100.0%)	1	NA	NA
AVS27125.1|2804651_2805827_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.1	1.6e-39
>prophage 207
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2831617	2832997	5438150		Enterobacteria_phage(100.0%)	1	NA	NA
AVS27152.1|2831617_2832997_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.6	1.5e-17
>prophage 208
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2843490	2844282	5438150		Bacillus_virus(100.0%)	1	NA	NA
AVS27164.1|2843490_2844282_+	ABC transporter	NA	G3M9Y6	Bacillus_virus	30.0	7.2e-20
>prophage 209
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2857316	2858690	5438150		Bacillus_phage(100.0%)	1	NA	NA
AVS29670.1|2857316_2858690_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.7	2.9e-16
>prophage 210
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2864137	2864899	5438150		Escherichia_phage(100.0%)	1	NA	NA
AVS27187.1|2864137_2864899_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	36.2	2.7e-32
>prophage 211
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2876847	2877222	5438150		Streptococcus_phage(100.0%)	1	NA	NA
AVS29672.1|2876847_2877222_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	2.3e-08
>prophage 212
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2880468	2881974	5438150		Staphylococcus_phage(50.0%)	2	NA	NA
AVS27204.1|2880468_2881167_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.2e-15
AVS27205.1|2881176_2881974_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.9	2.4e-10
>prophage 213
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2886125	2902020	5438150		Escherichia_phage(70.0%)	15	NA	NA
AVS27209.1|2886125_2887229_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	48.9	3.1e-101
AVS27210.1|2887377_2887776_-	rhodanese	NA	NA	NA	NA	NA
AVS27211.1|2887843_2888941_+	transcriptional regulator FtrA	NA	NA	NA	NA	NA
AVS29673.1|2888909_2889125_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
AVS27212.1|2889177_2889618_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVS27213.1|2889872_2890937_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	44.5	2.0e-65
AVS27214.1|2891133_2894241_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AVS27215.1|2894295_2895561_+	MFS transporter	NA	NA	NA	NA	NA
AVS27216.1|2895591_2896680_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AVS27217.1|2896766_2897027_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AVS27218.1|2897324_2898185_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AVS27219.1|2898205_2898967_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AVS27220.1|2899227_2900130_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
AVS27221.1|2900141_2901407_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
AVS27222.1|2901399_2902020_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 214
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2905317	2906298	5438150	transposase	Escherichia_phage(100.0%)	1	NA	NA
AVS27226.1|2905317_2906298_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 215
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2910970	2913204	5438150	transposase	Escherichia_phage(50.0%)	3	NA	NA
AVS27232.1|2910970_2911951_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AVS27233.1|2911989_2912175_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27234.1|2912529_2913204_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	62.1	2.5e-82
>prophage 216
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2918342	2929401	5438150		Escherichia_phage(57.14%)	12	NA	NA
AVS27239.1|2918342_2918774_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.7	2.7e-21
AVS27240.1|2919038_2920502_-	D-mannonate oxidoreductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.3	7.8e-44
AVS27241.1|2920755_2922039_-	MFS transporter	NA	NA	NA	NA	NA
AVS27242.1|2922152_2922479_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.9	1.1e-22
AVS27243.1|2922623_2922965_+	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AVS27244.1|2923042_2923603_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AVS27245.1|2923596_2924307_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AVS27246.1|2924408_2924678_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AVS27247.1|2924828_2927264_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.2e-214
AVS27248.1|2927274_2927892_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
AVS27249.1|2927893_2928751_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.9	9.0e-24
AVS27250.1|2928792_2929401_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.3	3.2e-23
>prophage 217
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2946525	2947485	5438150		Salmonella_phage(100.0%)	1	NA	NA
AVS27266.1|2946525_2947485_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
>prophage 218
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2956928	2959706	5438150		Lactobacillus_phage(100.0%)	1	NA	NA
AVS27276.1|2956928_2959706_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.1	6.2e-66
>prophage 219
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2979051	2979567	5438150		Streptococcus_phage(100.0%)	1	NA	NA
AVS27294.1|2979051_2979567_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
>prophage 220
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	2990810	2992112	5438150		Bacillus_phage(100.0%)	1	NA	NA
AVS27307.1|2990810_2992112_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.9e-18
>prophage 221
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3004932	3008460	5438150		Salmonella_phage(50.0%)	6	NA	NA
AVS27317.1|3004932_3005136_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	73.1	2.6e-22
AVS27318.1|3005205_3005724_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27319.1|3005921_3006275_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
AVS27320.1|3006378_3007587_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
AVS27321.1|3007583_3007817_+	SirA-like protein	NA	NA	NA	NA	NA
AVS27322.1|3008067_3008460_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	38.5	2.3e-19
>prophage 222
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3020634	3021840	5438150		Klosneuvirus(100.0%)	1	NA	NA
AVS27333.1|3020634_3021840_-	bifunctional succinylornithine transaminase/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.7	2.6e-21
>prophage 223
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3030526	3035164	5438150		Bacillus_phage(50.0%)	2	NA	NA
AVS27341.1|3030526_3031201_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	52.5	4.6e-31
AVS27342.1|3031261_3035164_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	30.0	8.4e-53
>prophage 224
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3061344	3062334	5438150		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AVS27368.1|3061344_3062334_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.9	2.5e-70
>prophage 225
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3067452	3074599	5438150	tRNA	Escherichia_phage(40.0%)	9	NA	NA
AVS27373.1|3067452_3068607_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	58.9	4.8e-113
AVS27374.1|3068750_3068963_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
AVS27375.1|3069044_3069479_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	50.7	3.2e-30
AVS27376.1|3069712_3070648_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
AVS27377.1|3070693_3072067_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
AVS27378.1|3072081_3072276_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27379.1|3072592_3073576_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AVS27380.1|3073645_3073837_+	hypothetical protein	NA	NA	NA	NA	NA
AVS29681.1|3073855_3074599_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	3.5e-16
>prophage 226
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3082205	3083219	5438150		Planktothrix_phage(100.0%)	1	NA	NA
AVS27388.1|3082205_3083219_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	1.7e-29
>prophage 227
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3096650	3268414	5438150	holin,plate,integrase,lysis,tail,protease,head,terminase,transposase	Klebsiella_phage(24.11%)	197	3122220:3122237	3276854:3276871
AVS27405.1|3096650_3097736_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVS27406.1|3097699_3099454_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVS27407.1|3101125_3104551_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AVS27408.1|3104534_3105674_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27409.1|3105670_3105928_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AVS27410.1|3105972_3108390_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27411.1|3108377_3108908_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AVS27412.1|3108975_3109506_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AVS27413.1|3109574_3110105_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AVS27414.1|3110172_3110703_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AVS27415.1|3110771_3111302_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AVS27416.1|3111365_3112145_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AVS27417.1|3112145_3114524_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.2e-18
AVS27418.1|3114516_3117171_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
AVS27419.1|3117435_3117927_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AVS27420.1|3117931_3119638_-	OmpA family protein	NA	NA	NA	NA	NA
AVS27421.1|3119634_3120324_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AVS29682.1|3120320_3121661_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVS27422.1|3121673_3123218_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
3122220:3122237	attL	ATCTTTCACCGCGCCGCC	NA	NA	NA	NA
AVS27423.1|3123260_3123752_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AVS27424.1|3124597_3124846_+	damage-inducible protein DinI	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
AVS27425.1|3125068_3125353_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27426.1|3125457_3125667_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27427.1|3125663_3126395_-	hypothetical protein	NA	NA	NA	NA	NA
AVS29683.1|3126405_3127134_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27428.1|3129484_3129682_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27429.1|3129681_3130548_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
AVS27430.1|3130547_3131321_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
AVS27431.1|3131317_3132514_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
AVS27432.1|3132513_3132867_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
AVS27433.1|3132868_3133522_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
AVS27434.1|3133575_3134142_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27435.1|3134178_3134364_+	hypothetical protein	NA	NA	NA	NA	NA
AVS27436.1|3134416_3134758_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
AVS27437.1|3134757_3135780_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
AVS27438.1|3135782_3136085_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
AVS27439.1|3136085_3136685_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
AVS27440.1|3136684_3138688_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
AVS27441.1|3138677_3138830_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
AVS27442.1|3138865_3139291_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
AVS27443.1|3139617_3140809_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
AVS27444.1|3140750_3141041_-	DUF3277 domain-containing protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
AVS27445.1|3141051_3142197_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
AVS27446.1|3142200_3142641_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AVS27447.1|3142735_3143122_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
AVS27448.1|3143121_3143628_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27449.1|3143624_3144044_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
AVS27450.1|3144012_3144294_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27451.1|3144333_3145275_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
AVS27452.1|3145286_3145781_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
AVS27453.1|3145784_3146987_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
AVS29684.1|3147038_3147587_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
AVS27454.1|3147642_3149094_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
AVS27455.1|3149331_3150732_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
AVS27456.1|3150682_3151435_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
AVS27457.1|3151536_3151857_-	negative regulator GrlR	NA	NA	NA	NA	NA
AVS27458.1|3152091_3152481_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
AVS27459.1|3152477_3153008_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
AVS27460.1|3153010_3153259_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AVS27461.1|3153664_3154447_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
AVS27462.1|3154443_3154920_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
AVS27463.1|3154916_3155879_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
AVS27464.1|3155880_3157539_-	helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
AVS27465.1|3157847_3158141_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
AVS27466.1|3158115_3158337_-	XRE family transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
AVS27467.1|3158434_3159103_+	LexA family transcriptional repressor	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
AVS27468.1|3159273_3159588_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
AVS27469.1|3159580_3159769_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
AVS27470.1|3159938_3160304_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
AVS27471.1|3160296_3160551_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
AVS27472.1|3160737_3161163_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
AVS27473.1|3161159_3161354_+	hypothetical protein	NA	NA	NA	NA	NA
AVS27474.1|3161350_3162178_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.0	5.5e-111
AVS27475.1|3162282_3162801_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
AVS27476.1|3162806_3163517_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
AVS27477.1|3163506_3163731_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
AVS27478.1|3163727_3163940_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
AVS27479.1|3163936_3164416_+	hypothetical protein	NA	NA	NA	NA	NA
AVS27480.1|3164594_3164837_+	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
AVS27481.1|3164817_3165999_-	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
AVS27482.1|3166195_3166744_+|protease	protease	protease	NA	NA	NA	NA
AVS27483.1|3166942_3168475_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
AVS27484.1|3168691_3169453_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
AVS27485.1|3169561_3170476_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS27486.1|3170776_3170965_+	cold-shock protein	NA	NA	NA	NA	NA
AVS27487.1|3171035_3171344_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
AVS27488.1|3171349_3171487_+	glycosyl hydrolase family 2	NA	NA	NA	NA	NA
AVS27489.1|3171511_3172381_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
AVS27490.1|3172459_3173662_-	MFS transporter	NA	NA	NA	NA	NA
AVS27491.1|3173734_3174871_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVS27492.1|3175043_3175928_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS27493.1|3176052_3176886_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27494.1|3177116_3177503_+	glyoxalase	NA	NA	NA	NA	NA
AVS27495.1|3177670_3179287_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS27496.1|3179472_3180180_+	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
AVS27497.1|3180176_3181142_-	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
AVS27498.1|3181244_3181751_+	thiol peroxidase	NA	NA	NA	NA	NA
AVS29685.1|3181821_3182844_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AVS27499.1|3182975_3184517_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
AVS27500.1|3184689_3186003_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AVS27501.1|3186134_3187016_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS27502.1|3187105_3188167_-	TIGR01620 family protein	NA	NA	NA	NA	NA
AVS27503.1|3188163_3189561_-	YcjX family protein	NA	NA	NA	NA	NA
AVS27504.1|3189663_3189882_-	phage shock protein D	NA	NA	NA	NA	NA
AVS27505.1|3189910_3190270_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
AVS27506.1|3190269_3190494_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
AVS27507.1|3190549_3191218_-	phage shock protein PspA	NA	NA	NA	NA	NA
AVS29686.1|3191385_3192360_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
AVS27508.1|3192350_3193742_-	MFS transporter	NA	NA	NA	NA	NA
AVS27509.1|3193767_3194937_-	amidohydrolase	NA	NA	NA	NA	NA
AVS27510.1|3195108_3197418_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVS27511.1|3197396_3198227_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVS27512.1|3198337_3199243_+	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AVS27513.1|3199576_3201220_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
AVS27514.1|3201216_3202182_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
AVS27515.1|3202386_3203058_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
AVS29687.1|3203244_3204072_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
AVS27516.1|3204147_3205413_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
AVS27517.1|3205414_3205834_-	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
AVS27518.1|3205913_3207398_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVS27519.1|3207397_3207649_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27520.1|3208295_3208718_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
AVS27521.1|3209310_3210015_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVS27522.1|3210191_3210956_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AVS27523.1|3211043_3211157_+	NTP-binding protein	NA	NA	NA	NA	NA
AVS27524.1|3211462_3211963_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVS27525.1|3211981_3212161_+	hypothetical protein	NA	NA	NA	NA	NA
AVS27526.1|3212090_3212930_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AVS27527.1|3212923_3213271_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVS29688.1|3213434_3214226_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AVS27528.1|3214371_3215331_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
AVS27529.1|3215221_3215926_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVS27530.1|3216174_3218118_+	flagellar biosynthesis protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
AVS27531.1|3218359_3218959_+	hypothetical protein	NA	NA	NA	NA	NA
AVS27532.1|3218992_3219187_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27533.1|3219183_3219915_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27534.1|3219918_3222873_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
AVS27535.1|3222949_3226018_-	kinase	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
AVS27536.1|3226014_3226395_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
AVS27537.1|3226404_3226887_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
AVS27538.1|3227067_3227532_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
AVS27539.1|3227846_3228182_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27540.1|3228372_3229353_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AVS27541.1|3229465_3232363_-|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
AVS29689.1|3232624_3232816_-	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
AVS27542.1|3233040_3233397_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
AVS27543.1|3233473_3233650_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27544.1|3233817_3234300_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27545.1|3234353_3235526_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
AVS27546.1|3235549_3235942_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AVS27547.1|3235938_3236490_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
AVS27548.1|3236491_3236875_-	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
AVS27549.1|3236861_3237095_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
AVS27550.1|3237104_3237359_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
AVS27551.1|3237360_3237756_-	protein singed	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
AVS27552.1|3238077_3239031_-	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
AVS27553.1|3239041_3239827_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
AVS27554.1|3240357_3241470_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
AVS27555.1|3241453_3242854_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
AVS27556.1|3242853_3244161_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
AVS27557.1|3244138_3245143_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
AVS27558.1|3245691_3245877_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27559.1|3246005_3246251_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
AVS27560.1|3247064_3247259_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	1.4e-25
AVS27561.1|3247209_3247485_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
AVS27562.1|3247481_3247826_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
AVS27563.1|3247822_3248362_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
AVS27564.1|3248358_3248670_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	3.8e-49
AVS27565.1|3249136_3250183_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
AVS29690.1|3250408_3251098_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
AVS27566.1|3251097_3251238_-	YlcG family protein	NA	NA	NA	NA	NA
AVS27567.1|3251234_3251873_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
AVS27568.1|3251865_3252534_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
AVS27569.1|3252530_3252698_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
AVS27570.1|3252678_3253146_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
AVS27571.1|3253666_3254695_+	hypothetical protein	NA	NA	NA	NA	NA
AVS27572.1|3254902_3255148_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27573.1|3255203_3255506_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVS27574.1|3255502_3256351_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
AVS27575.1|3256347_3257208_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
AVS27576.1|3257293_3257515_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AVS27577.1|3257555_3257783_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
AVS29691.1|3257894_3258593_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
AVS29692.1|3258615_3258735_+	hypothetical protein	NA	NA	NA	NA	NA
AVS27578.1|3258880_3259957_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
AVS27579.1|3260038_3260242_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
AVS27580.1|3260670_3260865_+	hypothetical protein	NA	NA	NA	NA	NA
AVS27581.1|3260953_3261238_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
AVS27582.1|3261253_3262099_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
AVS27583.1|3262384_3263065_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
AVS27584.1|3263061_3263490_+	regulator	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
AVS27585.1|3263486_3264149_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
AVS27586.1|3264145_3264460_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
AVS29693.1|3264356_3265544_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
AVS27587.1|3265720_3266611_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
AVS27588.1|3266610_3267603_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AVS27589.1|3267604_3268414_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
3276854:3276871	attR	ATCTTTCACCGCGCCGCC	NA	NA	NA	NA
>prophage 228
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3273044	3274979	5438150		Bodo_saltans_virus(100.0%)	1	NA	NA
AVS27593.1|3273044_3274979_+	exoribonuclease 2	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
>prophage 229
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3280569	3281172	5438150		Staphylococcus_phage(100.0%)	1	NA	NA
AVS27602.1|3280569_3281172_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
>prophage 230
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3286012	3291378	5438150	protease	Tupanvirus(50.0%)	5	NA	NA
AVS27607.1|3286012_3288610_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
AVS27608.1|3289016_3289268_+	hypothetical protein	NA	NA	NA	NA	NA
AVS27609.1|3289315_3290362_-|protease	protease SohB	protease	NA	NA	NA	NA
AVS27610.1|3290406_3290622_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27611.1|3290616_3291378_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	1.6e-08
>prophage 231
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3298497	3301455	5438150		Acinetobacter_phage(100.0%)	2	NA	NA
AVS27619.1|3298497_3300093_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.5	2.8e-47
AVS27620.1|3300096_3301455_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.4	3.3e-36
>prophage 232
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3313699	3314377	5438150		Cyanophage(100.0%)	1	NA	NA
AVS27632.1|3313699_3314377_+	Fe2+-dependent dioxygenase	NA	A0A127KM56	Cyanophage	33.8	3.3e-21
>prophage 233
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3321671	3327405	5438150		Trichoplusia_ni_ascovirus(50.0%)	5	NA	NA
AVS27640.1|3321671_3322433_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	1.8e-15
AVS27641.1|3322524_3323115_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AVS27642.1|3323250_3324642_+	L-cystine transporter	NA	NA	NA	NA	NA
AVS27643.1|3324701_3325034_-	cell division activator CedA	NA	NA	NA	NA	NA
AVS27644.1|3325146_3327405_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.4	1.0e-143
>prophage 234
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3333669	3334497	5438150		Bacillus_virus(100.0%)	1	NA	NA
AVS27652.1|3333669_3334497_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.5	2.7e-70
>prophage 235
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3341180	3342401	5438150		Klosneuvirus(100.0%)	1	NA	NA
AVS27659.1|3341180_3342401_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	8.0e-26
>prophage 236
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3348458	3349091	5438150		Bacillus_phage(100.0%)	1	NA	NA
AVS27666.1|3348458_3349091_+	ATPase	NA	W8CYL7	Bacillus_phage	31.3	1.3e-08
>prophage 237
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3354393	3360407	5438150	transposase	Streptococcus_phage(50.0%)	5	NA	NA
AVS27671.1|3354393_3356340_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.3	8.2e-41
AVS27672.1|3356344_3357388_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
AVS27673.1|3357613_3358360_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AVS29697.1|3358619_3358955_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27674.1|3359043_3360407_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 238
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3364281	3368340	5438150		Tupanvirus(50.0%)	4	NA	NA
AVS27678.1|3364281_3364923_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	37.1	3.2e-18
AVS27679.1|3364960_3366319_-	MFS transporter	NA	NA	NA	NA	NA
AVS27680.1|3366460_3367219_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AVS27681.1|3367356_3368340_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.1	1.5e-06
>prophage 239
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3374032	3375286	5438150		Artogeia_rapae_granulovirus(100.0%)	1	NA	NA
AVS27687.1|3374032_3375286_+	chitinase	NA	D2J4H7	Artogeia_rapae_granulovirus	25.6	2.6e-24
>prophage 240
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3378970	3379825	5438150		Indivirus(100.0%)	1	NA	NA
AVS27693.1|3378970_3379825_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	26.0	3.6e-17
>prophage 241
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3383099	3394533	5438150		Bacillus_phage(14.29%)	13	NA	NA
AVS27696.1|3383099_3384383_+	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.7e-10
AVS27697.1|3384428_3384992_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27698.1|3385150_3385633_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	39.1	1.6e-17
AVS27699.1|3385754_3386066_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27700.1|3386323_3387205_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS27701.1|3387380_3388598_+	MFS transporter	NA	NA	NA	NA	NA
AVS27702.1|3388594_3389344_-	oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.1	4.3e-14
AVS27703.1|3389510_3390416_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS27704.1|3390422_3391688_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	79.6	7.6e-197
AVS27705.1|3391690_3392110_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	57.5	5.5e-35
AVS27706.1|3392188_3393673_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVS27707.1|3393672_3393924_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27708.1|3394290_3394533_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	72.2	4.1e-27
>prophage 242
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3401462	3405048	5438150		Bacillus_phage(50.0%)	7	NA	NA
AVS27717.1|3401462_3402476_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
AVS27718.1|3402533_3402635_+	hypothetical protein	NA	NA	NA	NA	NA
AVS29699.1|3402634_3402709_+	hypothetical protein	NA	NA	NA	NA	NA
AVS27719.1|3402826_3402952_+	hypothetical protein	NA	NA	NA	NA	NA
AVS27720.1|3403011_3403275_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AVS27721.1|3403405_3404044_-	leucine efflux protein	NA	NA	NA	NA	NA
AVS27722.1|3404133_3405048_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
>prophage 243
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3408337	3410122	5438150		Bacillus_phage(100.0%)	1	NA	NA
AVS27726.1|3408337_3410122_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
>prophage 244
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3424732	3425983	5438150		Phage_21(100.0%)	1	NA	NA
AVS27744.1|3424732_3425983_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 245
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3429211	3430582	5438150		Bodo_saltans_virus(100.0%)	1	NA	NA
AVS27748.1|3429211_3430582_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.6e-107
>prophage 246
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3437147	3438284	5438150		Bacillus_virus(100.0%)	1	NA	NA
AVS27755.1|3437147_3438284_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.0	2.6e-31
>prophage 247
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3442716	3448782	5438150		Staphylococcus_phage(33.33%)	6	NA	NA
AVS27760.1|3442716_3444345_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	1.5e-27
AVS27761.1|3444596_3444941_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27762.1|3445031_3445862_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	5.3e-21
AVS27763.1|3445876_3446788_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AVS27764.1|3446836_3448081_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AVS27765.1|3448080_3448782_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.4	7.8e-34
>prophage 248
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3468506	3469148	5438150		Pseudomonas_phage(100.0%)	1	NA	NA
AVS27783.1|3468506_3469148_-	thymidylate kinase	NA	Q2Z0N0	Pseudomonas_phage	37.0	3.8e-27
>prophage 249
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3472427	3473609	5438150		Ralstonia_phage(50.0%)	2	NA	NA
AVS27786.1|3472427_3472664_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
AVS27787.1|3472874_3473609_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.0e-15
>prophage 250
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3492764	3493016	5438150		Salmonella_phage(100.0%)	1	NA	NA
AVS27804.1|3492764_3493016_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	5.1e-12
>prophage 251
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3496257	3497178	5438150		Morganella_phage(100.0%)	1	NA	NA
AVS27810.1|3496257_3497178_+	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	41.9	5.6e-56
>prophage 252
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3505528	3506056	5438150		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
AVS27817.1|3505528_3506056_-	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.3	1.3e-28
>prophage 253
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3513974	3515033	5438150		Cronobacter_phage(100.0%)	1	NA	NA
AVS27826.1|3513974_3515033_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.6	8.6e-93
>prophage 254
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3531587	3535106	5438150		Enterobacteria_phage(100.0%)	4	NA	NA
AVS27840.1|3531587_3532082_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	75.0	6.9e-37
AVS27841.1|3532103_3533426_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.6	1.8e-201
AVS27842.1|3533832_3534771_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AVS27843.1|3534932_3535106_-	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 255
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3559244	3559904	5438150		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVS27868.1|3559244_3559904_+	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
>prophage 256
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3564846	3566901	5438150		Bacillus_phage(100.0%)	1	NA	NA
AVS27877.1|3564846_3566901_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.0	1.8e-14
>prophage 257
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3579620	3581528	5438150		Tupanvirus(100.0%)	1	NA	NA
AVS27891.1|3579620_3581528_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	2.1e-49
>prophage 258
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3590294	3595417	5438150		Bacillus_virus(33.33%)	3	NA	NA
AVS27900.1|3590294_3591068_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	2.9e-29
AVS27901.1|3591272_3593888_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	1.7e-20
AVS27902.1|3594214_3595417_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.5	5.1e-41
>prophage 259
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3601500	3604573	5438150	tRNA	Bandra_megavirus(50.0%)	2	NA	NA
AVS27907.1|3601500_3602901_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.8	1.0e-80
AVS27908.1|3603598_3604573_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	52.2	1.4e-89
>prophage 260
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3621936	3626479	5438150		Bacillus_phage(100.0%)	3	NA	NA
AVS27923.1|3621936_3623685_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	4.6e-59
AVS27924.1|3623721_3625986_-	ComEC family protein	NA	NA	NA	NA	NA
AVS27925.1|3626191_3626479_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.2e-10
>prophage 261
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3630652	3631741	5438150		Streptococcus_phage(100.0%)	1	NA	NA
AVS27929.1|3630652_3631741_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	1.0e-80
>prophage 262
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3635791	3739584	5438150	plate,integrase,portal,lysis,tail,protease,head,capsid,tRNA	Salmonella_phage(52.38%)	106	3700249:3700267	3739659:3739677
AVS27932.1|3635791_3638074_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	8.4e-162
AVS27933.1|3638265_3639006_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.4e-20
AVS27934.1|3639168_3640317_-	MFS transporter	NA	NA	NA	NA	NA
AVS27935.1|3640433_3640580_-	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
AVS27936.1|3640591_3641455_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AVS27937.1|3641456_3642074_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
AVS27938.1|3642084_3644523_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.2	2.8e-219
AVS27939.1|3644723_3646016_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AVS27940.1|3646106_3647450_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
AVS27941.1|3647458_3648070_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AVS27942.1|3648192_3652446_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
AVS27943.1|3652581_3653076_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AVS27944.1|3653608_3654577_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
AVS27945.1|3654691_3656458_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
AVS27946.1|3656458_3658180_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AVS27947.1|3658224_3658926_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVS27948.1|3659279_3659498_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AVS27949.1|3659618_3661898_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AVS27950.1|3661928_3662246_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AVS27951.1|3662571_3662793_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AVS27952.1|3662747_3662930_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27953.1|3662869_3664810_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AVS27954.1|3664806_3665922_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AVS27955.1|3666068_3667727_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AVS27956.1|3668146_3668842_+	aquaporin Z	NA	NA	NA	NA	NA
AVS27957.1|3668957_3669857_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
AVS29709.1|3670000_3671653_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AVS27958.1|3671663_3672632_+	NADH oxidoreductase	NA	NA	NA	NA	NA
AVS27959.1|3672582_3672786_+	hypothetical protein	NA	NA	NA	NA	NA
AVS27960.1|3672843_3673278_-	DoxX family protein	NA	NA	NA	NA	NA
AVS29710.1|3673429_3675148_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AVS27961.1|3675186_3676188_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AVS27962.1|3676198_3677641_+	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
AVS27963.1|3677728_3678742_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVS27964.1|3678738_3679569_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
AVS27965.1|3679600_3680740_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AVS27966.1|3680792_3680972_+	hypothetical protein	NA	NA	NA	NA	NA
AVS27967.1|3681617_3682133_+	lipoprotein	NA	NA	NA	NA	NA
AVS27968.1|3682359_3683088_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
AVS29711.1|3683108_3683840_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS27969.1|3683846_3684563_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AVS27970.1|3684562_3685231_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AVS27971.1|3685414_3686146_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS27972.1|3686188_3687661_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
AVS27973.1|3687657_3688374_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
AVS27974.1|3688452_3689580_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AVS27975.1|3689621_3690110_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AVS27976.1|3690167_3691013_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AVS27977.1|3691009_3691963_-	putrescine ABC transporter permease	NA	NA	NA	NA	NA
AVS29712.1|3691973_3693107_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AVS27978.1|3693270_3694383_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AVS27979.1|3694731_3695211_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AVS27980.1|3695299_3696202_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
AVS27981.1|3697023_3697311_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27982.1|3697513_3697777_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AVS27983.1|3697783_3698167_-	hypothetical protein	NA	NA	NA	NA	NA
AVS29713.1|3698433_3700119_+	transporter	NA	NA	NA	NA	NA
3700249:3700267	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
AVS27984.1|3700338_3700557_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AVS27985.1|3700648_3701749_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
AVS27986.1|3701745_3702231_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
AVS27987.1|3702227_3704855_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
AVS27988.1|3704847_3704967_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AVS27989.1|3704981_3705281_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
AVS27990.1|3705333_3705849_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AVS27991.1|3705858_3707031_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
AVS27992.1|3707169_3708246_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
AVS27993.1|3708275_3708479_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27994.1|3708475_3709207_-	hypothetical protein	NA	NA	NA	NA	NA
AVS27995.1|3709210_3712162_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
AVS29714.1|3712163_3712763_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
AVS27996.1|3712755_3713664_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
AVS27997.1|3713650_3714013_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
AVS27998.1|3714009_3714582_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
AVS27999.1|3714676_3715369_+	hypothetical protein	NA	NA	NA	NA	NA
AVS28000.1|3715365_3715812_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
AVS28001.1|3715804_3716236_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AVS28002.1|3716331_3716760_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
AVS28003.1|3716756_3717140_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
AVS28004.1|3717144_3717654_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
AVS28005.1|3717634_3717850_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
AVS28006.1|3717853_3718057_-|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AVS28007.1|3718056_3718521_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
AVS28008.1|3718616_3719267_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AVS28009.1|3719270_3720329_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
AVS28010.1|3720345_3721179_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AVS28011.1|3721321_3723088_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
AVS28012.1|3723087_3724113_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
AVS28013.1|3724174_3725917_-	hypothetical protein	NA	NA	NA	NA	NA
AVS28014.1|3726192_3726870_-	hypothetical protein	NA	NA	NA	NA	NA
AVS28015.1|3726984_3727290_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AVS29715.1|3727228_3727417_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AVS28016.1|3727517_3729002_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVS28017.1|3729001_3729253_-	hypothetical protein	NA	NA	NA	NA	NA
AVS28018.1|3729480_3731895_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AVS28019.1|3731891_3732749_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
AVS28020.1|3732745_3732973_-	hypothetical protein	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
AVS28021.1|3732972_3733206_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
AVS28022.1|3733273_3733615_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AVS28023.1|3733578_3733779_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
AVS28024.1|3733786_3734296_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AVS28025.1|3734328_3734550_-	regulator	NA	NA	NA	NA	NA
AVS29716.1|3734695_3735574_+	Repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
AVS28026.1|3735585_3736530_+	hypothetical protein	NA	NA	NA	NA	NA
AVS28027.1|3736628_3738113_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVS28028.1|3738112_3738364_-	hypothetical protein	NA	NA	NA	NA	NA
AVS28029.1|3738531_3739584_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3739659:3739677	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 263
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3744659	3746659	5438150		Escherichia_phage(50.0%)	2	NA	NA
AVS28036.1|3744659_3745418_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.6	2.4e-12
AVS28037.1|3745456_3746659_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.6	5.0e-97
>prophage 264
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3758364	3760224	5438150		Planktothrix_phage(100.0%)	1	NA	NA
AVS28047.1|3758364_3760224_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.2	6.3e-14
>prophage 265
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3764467	3766900	5438150		Bacteriophage(100.0%)	1	NA	NA
AVS28052.1|3764467_3766900_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A2K8HAT8	Bacteriophage	47.4	8.0e-09
>prophage 266
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3774879	3776472	5438150		Tupanvirus(100.0%)	1	NA	NA
AVS28058.1|3774879_3776472_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	5.0e-60
>prophage 267
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3779481	3780858	5438150		Pandoravirus(100.0%)	1	NA	NA
AVS28062.1|3779481_3780858_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	23.6	4.2e-23
>prophage 268
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3784859	3790011	5438150		Escherichia_phage(33.33%)	6	NA	NA
AVS28067.1|3784859_3785372_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.7e-14
AVS28068.1|3785723_3786611_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AVS28069.1|3786848_3787352_+	DNA starvation/stationary phase protection protein	NA	A0A222Z0F3	Streptomyces_phage	47.6	9.3e-05
AVS28070.1|3787760_3788507_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
AVS28071.1|3788632_3789292_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AVS28072.1|3789288_3790011_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	3.3e-35
>prophage 269
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3794055	3802050	5438150		Erwinia_phage(20.0%)	8	NA	NA
AVS28076.1|3794055_3794346_+	DUF1471 domain-containing protein	NA	A0A1B2IB27	Erwinia_phage	47.9	1.1e-05
AVS28077.1|3794366_3794633_+	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	52.3	1.6e-16
AVS28078.1|3794918_3795179_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVS28079.1|3795288_3796257_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AVS28080.1|3796286_3798455_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.4	4.4e-43
AVS28081.1|3798642_3799998_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	8.3e-48
AVS28082.1|3800212_3801205_-	transketolase family protein	NA	NA	NA	NA	NA
AVS28083.1|3801204_3802050_-	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	30.3	3.1e-08
>prophage 270
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3807255	3808995	5438150		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AVS28089.1|3807255_3808995_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	4.3e-17
>prophage 271
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3819162	3820068	5438150		Streptococcus_phage(100.0%)	1	NA	NA
AVS28106.1|3819162_3820068_+	hypothetical protein	NA	A1IMD5	Streptococcus_phage	30.2	5.7e-29
>prophage 272
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3826565	3827288	5438150		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AVS28113.1|3826565_3827288_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	2.9e-07
>prophage 273
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3831091	3836714	5438150		Klosneuvirus(50.0%)	5	NA	NA
AVS29719.1|3831091_3832381_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	3.8e-18
AVS28119.1|3832451_3832928_+	kinase inhibitor	NA	NA	NA	NA	NA
AVS28120.1|3833191_3833461_+	hypothetical protein	NA	NA	NA	NA	NA
AVS28121.1|3833706_3835089_-	amino acid permease	NA	NA	NA	NA	NA
AVS28122.1|3835187_3836714_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.0	2.9e-81
>prophage 274
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3846806	3847541	5438150		Enterobacteria_phage(100.0%)	1	NA	NA
AVS28132.1|3846806_3847541_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.3	1.8e-49
>prophage 275
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3852387	3858910	5438150		Planktothrix_phage(33.33%)	7	NA	NA
AVS29721.1|3852387_3853446_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.2	1.5e-17
AVS28138.1|3853448_3854138_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AVS28139.1|3854137_3854911_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS28140.1|3855053_3855203_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
AVS28141.1|3855355_3856144_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AVS28142.1|3856211_3857684_+	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	28.5	2.0e-10
AVS28143.1|3857893_3858910_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.4	6.8e-79
>prophage 276
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3863271	3866782	5438150		Edwardsiella_phage(33.33%)	4	NA	NA
AVS28147.1|3863271_3864324_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.0	1.2e-81
AVS28148.1|3864638_3865004_+	hypothetical protein	NA	NA	NA	NA	NA
AVS28149.1|3865121_3866066_+	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.4	3.4e-24
AVS28150.1|3866062_3866782_-	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	34.6	2.0e-24
>prophage 277
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3891105	3891897	5438150		Kaumoebavirus(100.0%)	1	NA	NA
AVS28171.1|3891105_3891897_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.2	2.1e-11
>prophage 278
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3897706	3905136	5438150		Acinetobacter_phage(33.33%)	6	NA	NA
AVS28179.1|3897706_3899185_+	dipeptide permease D	NA	A0A0P0IY73	Acinetobacter_phage	29.3	8.4e-46
AVS28180.1|3899156_3900599_-	deoxyribodipyrimidine photo-lyase	NA	F2Y1V1	Organic_Lake_phycodnavirus	33.1	1.1e-55
AVS29725.1|3900782_3900989_-	DUF2517 domain-containing protein	NA	NA	NA	NA	NA
AVS28181.1|3901298_3901388_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
AVS28182.1|3901387_3903067_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AVS28183.1|3903087_3905136_+	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.3	6.0e-26
>prophage 279
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3911962	3912736	5438150		Mycobacterium_phage(100.0%)	1	NA	NA
AVS28190.1|3911962_3912736_+	esterase	NA	A0A286MQ79	Mycobacterium_phage	29.7	2.9e-05
>prophage 280
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3917424	3921226	5438150	tRNA	Escherichia_phage(50.0%)	2	NA	NA
AVS28197.1|3917424_3919092_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	93.5	0.0e+00
AVS28198.1|3919270_3921226_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	6.4e-09
>prophage 281
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3925979	3927644	5438150		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVS28204.1|3925979_3927644_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.7	7.2e-86
>prophage 282
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3931684	3932731	5438150		Pseudomonas_phage(100.0%)	1	NA	NA
AVS28208.1|3931684_3932731_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	5.4e-47
>prophage 283
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3938735	3946701	5438150	tRNA	Planktothrix_phage(33.33%)	5	NA	NA
AVS28214.1|3938735_3939461_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	1.2e-29
AVS28215.1|3939834_3941505_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
AVS28216.1|3941570_3943364_+	filamentous hemagglutinin	NA	A0A0R6PJK4	Moraxella_phage	35.9	9.6e-28
AVS29727.1|3943409_3943892_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
AVS28217.1|3944118_3946701_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	5.2e-184
>prophage 284
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3953745	3956232	5438150		Synechococcus_phage(50.0%)	2	NA	NA
AVS28227.1|3953745_3954894_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.1e-08
AVS28228.1|3955032_3956232_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.0	6.5e-105
>prophage 285
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3961110	3961771	5438150		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVS28235.1|3961110_3961494_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	6.8e-24
AVS28236.1|3961561_3961771_-	cold-shock protein CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	1.2e-22
>prophage 286
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3965861	3967932	5438150		Morganella_phage(50.0%)	2	NA	NA
AVS28241.1|3965861_3966290_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.0	7.4e-19
AVS28242.1|3966366_3967932_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	6.4e-44
>prophage 287
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	3971067	3984782	5438150	tRNA	Streptococcus_phage(20.0%)	12	NA	NA
AVS28246.1|3971067_3972291_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.1	4.1e-62
AVS28247.1|3972275_3972902_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	48.2	1.1e-52
AVS28248.1|3972902_3974063_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AVS28249.1|3974189_3974879_+	acireductone synthase	NA	NA	NA	NA	NA
AVS28250.1|3974875_3975418_+	1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase	NA	NA	NA	NA	NA
AVS28251.1|3975525_3977835_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit C	tRNA	A0A077SK27	Escherichia_phage	33.6	1.0e-82
AVS28252.1|3978243_3979224_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS28253.1|3979220_3980771_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	1.1e-16
AVS28254.1|3980767_3981757_+	ABC transporter permease	NA	NA	NA	NA	NA
AVS28255.1|3981753_3982758_+	ABC transporter permease	NA	NA	NA	NA	NA
AVS28256.1|3982769_3983711_+	sugar kinase	NA	NA	NA	NA	NA
AVS28257.1|3983753_3984782_-	dihydrofolate reductase	NA	A0A2R8FCS0	Cedratvirus	34.0	7.2e-28
>prophage 288
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4001893	4006314	5438150		Staphylococcus_phage(50.0%)	5	NA	NA
AVS28271.1|4001893_4003396_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	4.9e-17
AVS28272.1|4003559_4004648_+	oxidoreductase	NA	NA	NA	NA	NA
AVS28273.1|4004705_4005449_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
AVS28274.1|4005632_4005935_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AVS28275.1|4005909_4006314_+	XRE family transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	34.1	4.7e-07
>prophage 289
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4018656	4023397	5438150		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
AVS28285.1|4018656_4019451_+	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	25.7	1.5e-09
AVS28286.1|4019515_4023397_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	27.6	3.1e-55
>prophage 290
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4034789	4036334	5438150		Bacillus_virus(100.0%)	1	NA	NA
AVS28298.1|4034789_4036334_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.3	3.6e-15
>prophage 291
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4043037	4048951	5438150	holin	Vibrio_phage(50.0%)	5	NA	NA
AVS28306.1|4043037_4045071_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.7	5.8e-21
AVS29731.1|4045067_4045283_-	hypothetical protein	NA	NA	NA	NA	NA
AVS28307.1|4045199_4045787_+	transcriptional regulator	NA	NA	NA	NA	NA
AVS28308.1|4045800_4047273_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVS28309.1|4047286_4048951_+|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	6.1e-61
>prophage 292
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4053508	4055036	5438150		Planktothrix_phage(100.0%)	2	NA	NA
AVS28314.1|4053508_4054345_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	1.5e-12
AVS28315.1|4054331_4055036_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	3.9e-25
>prophage 293
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4058106	4062786	5438150		Bacillus_virus(50.0%)	5	NA	NA
AVS28318.1|4058106_4058868_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	2.6e-19
AVS28319.1|4058860_4059526_-	ABC transporter permease	NA	NA	NA	NA	NA
AVS28320.1|4059540_4060182_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVS28321.1|4060229_4061081_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS28322.1|4061322_4062786_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.1e-16
>prophage 294
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4067292	4068656	5438150	transposase	Bacillus_phage(100.0%)	1	NA	NA
AVS28327.1|4067292_4068656_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 295
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4073189	4075904	5438150		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AVS28330.1|4073189_4075904_-	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.1	2.1e-66
>prophage 296
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4118798	4119914	5438150		Tupanvirus(100.0%)	1	NA	NA
AVS28367.1|4118798_4119914_-	class II histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	32.7	1.5e-39
>prophage 297
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4134696	4135494	5438150		Bacillus_virus(100.0%)	1	NA	NA
AVS28381.1|4134696_4135494_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	6.0e-14
>prophage 298
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4142116	4147917	5438150		Bacillus_phage(50.0%)	5	NA	NA
AVS28387.1|4142116_4143517_+	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	24.5	3.3e-15
AVS29736.1|4143546_4144551_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AVS28388.1|4144598_4145207_-	hypothetical protein	NA	NA	NA	NA	NA
AVS28389.1|4145390_4146422_-	ABC transporter permease	NA	NA	NA	NA	NA
AVS28390.1|4146432_4147917_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	3.8e-14
>prophage 299
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4156158	4231062	5438150	integrase,lysis,tail,head,terminase,tRNA,transposase,coat	Escherichia_phage(23.33%)	90	4177899:4177945	4228134:4228180
AVS28397.1|4156158_4157676_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
AVS28398.1|4158007_4159483_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
AVS28399.1|4159542_4161690_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
AVS28400.1|4161772_4163107_-	lysine:cadaverine antiporter	NA	NA	NA	NA	NA
AVS28401.1|4163472_4165041_-	transcriptional regulator CadC	NA	NA	NA	NA	NA
AVS28402.1|4165333_4165606_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVS28403.1|4165706_4166627_-	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
AVS28404.1|4167137_4168004_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVS28405.1|4168026_4169052_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AVS28406.1|4169053_4171489_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AVS28407.1|4171499_4172195_-	fimbrial chaperone	NA	NA	NA	NA	NA
AVS28408.1|4172253_4172814_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AVS28409.1|4173285_4173948_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AVS28410.1|4173925_4174231_+	hypothetical protein	NA	NA	NA	NA	NA
AVS28411.1|4174283_4175588_-	citrate synthase	NA	NA	NA	NA	NA
AVS29738.1|4175832_4176021_+	hypothetical protein	NA	NA	NA	NA	NA
AVS28412.1|4176098_4176269_+	ATP-NAD kinase	NA	NA	NA	NA	NA
AVS28413.1|4176347_4176749_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AVS28414.1|4177144_4177438_-	hypothetical protein	NA	NA	NA	NA	NA
4177899:4177945	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AVS28415.1|4178100_4178418_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.9	3.7e-23
AVS28416.1|4178417_4178657_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	50.6	6.1e-15
AVS28417.1|4178734_4180219_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AVS28418.1|4180218_4180470_-	hypothetical protein	NA	NA	NA	NA	NA
AVS28419.1|4180671_4180881_-	hypothetical protein	NA	NA	NA	NA	NA
AVS28420.1|4180877_4181609_-	hypothetical protein	NA	NA	NA	NA	NA
AVS29739.1|4181612_4182482_-	hypothetical protein	NA	NA	NA	NA	NA
AVS28421.1|4184686_4187164_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	45.6	2.7e-198
AVS28422.1|4187150_4187546_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
AVS28423.1|4187542_4188013_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
AVS29740.1|4188012_4188432_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
AVS28424.1|4188531_4191978_-	hypothetical protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
AVS28425.1|4192070_4192574_-	hypothetical protein	NA	NA	NA	NA	NA
AVS28426.1|4192701_4193487_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
AVS28427.1|4193552_4194266_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
AVS28428.1|4194255_4194426_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
AVS28429.1|4194525_4194885_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
AVS28430.1|4194901_4195372_-	hypothetical protein	NA	NA	NA	NA	NA
AVS28431.1|4195665_4195920_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
AVS28432.1|4195922_4196678_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
AVS28433.1|4196853_4197531_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
AVS28434.1|4197583_4198336_-	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
AVS28435.1|4198404_4198797_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
AVS28436.1|4198793_4199219_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
AVS28437.1|4199221_4199584_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
AVS28438.1|4199583_4199757_-	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
AVS28439.1|4199756_4200137_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
AVS28440.1|4200139_4200379_-	hypothetical protein	NA	NA	NA	NA	NA
AVS28441.1|4200389_4201484_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	62.8	1.7e-123
AVS28442.1|4201495_4201924_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
AVS28443.1|4201927_4203313_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
AVS28444.1|4203385_4203862_-	hypothetical protein	NA	NA	NA	NA	NA
AVS28445.1|4203903_4204908_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
AVS28446.1|4204882_4206304_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
AVS28447.1|4206316_4207789_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
AVS28448.1|4207788_4208391_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
AVS28449.1|4208761_4209091_+	hypothetical protein	NA	NA	NA	NA	NA
AVS28450.1|4209196_4209661_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
AVS28451.1|4209657_4210188_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
AVS28452.1|4210190_4210439_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AVS28453.1|4211175_4212222_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
AVS28454.1|4212449_4213139_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
AVS28455.1|4213135_4213666_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
AVS28456.1|4213658_4213796_-	YlcG family protein	NA	NA	NA	NA	NA
AVS28457.1|4213792_4214428_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
AVS28458.1|4214420_4214591_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
AVS28459.1|4214590_4215046_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
AVS28460.1|4215298_4215547_-	hypothetical protein	NA	NA	NA	NA	NA
AVS28461.1|4215546_4216194_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
AVS28462.1|4216366_4217209_-	addiction module toxin RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
AVS28463.1|4217315_4217822_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
AVS28464.1|4217818_4218112_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
AVS28465.1|4218111_4219542_-	replicative DNA helicase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
AVS28466.1|4219531_4220431_-	DNA replication protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
AVS28467.1|4220655_4220877_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AVS28468.1|4220917_4221151_-	transcriptional regulator	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
AVS28469.1|4221278_4221968_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
AVS28470.1|4222318_4222534_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
AVS28471.1|4222633_4222828_+	hypothetical protein	NA	NA	NA	NA	NA
AVS28472.1|4222916_4223201_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
AVS28473.1|4223216_4224062_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
AVS28474.1|4224058_4224739_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
AVS28475.1|4224735_4224894_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
AVS28476.1|4224890_4225547_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
AVS28477.1|4225543_4226311_+	dcm methylase	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
AVS28478.1|4226307_4226526_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
AVS28479.1|4226527_4226743_+	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
AVS28480.1|4226956_4228120_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
AVS28481.1|4228550_4229417_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4228134:4228180	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AVS28482.1|4229418_4229631_+	ribosome-associated protein	NA	NA	NA	NA	NA
AVS28483.1|4229676_4231062_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 300
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4239607	4240294	5438150		Planktothrix_phage(100.0%)	1	NA	NA
AVS29741.1|4239607_4240294_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	2.1e-31
>prophage 301
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4243476	4248682	5438150		Bacillus_virus(50.0%)	5	NA	NA
AVS28496.1|4243476_4244154_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.5	7.8e-23
AVS28497.1|4244294_4245212_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
AVS28498.1|4245208_4245667_+	NfeD family protein	NA	NA	NA	NA	NA
AVS28499.1|4245663_4246074_-	HTH-type transcriptional regulator CueR	NA	NA	NA	NA	NA
AVS29743.1|4246180_4248682_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	1.6e-113
>prophage 302
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4258827	4266638	5438150	transposase	uncultured_Mediterranean_phage(25.0%)	9	NA	NA
AVS28508.1|4258827_4260702_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	6.4e-115
AVS28509.1|4260813_4261419_-	recombination protein RecR	NA	NA	NA	NA	NA
AVS28510.1|4261418_4261751_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AVS28511.1|4261808_4263716_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	2.3e-43
AVS28512.1|4263808_4264360_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	3.9e-28
AVS28513.1|4264510_4264888_-	DUF454 domain-containing protein	NA	NA	NA	NA	NA
AVS28514.1|4264957_4265485_+	primosomal replication protein N''	NA	NA	NA	NA	NA
AVS28515.1|4265497_4265671_+	DUF2496 domain-containing protein	NA	NA	NA	NA	NA
AVS28516.1|4265738_4266638_+|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	51.2	2.1e-63
>prophage 303
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4272159	4281550	5438150		Leptospira_phage(33.33%)	10	NA	NA
AVS28520.1|4272159_4275306_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.7	1.1e-47
AVS28521.1|4275791_4276166_+	Hha toxicity attenuator	NA	NA	NA	NA	NA
AVS28522.1|4276192_4276411_+	transcriptional regulator	NA	NA	NA	NA	NA
AVS28523.1|4276569_4277136_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
AVS28524.1|4277268_4277739_+	hypothetical protein	NA	NA	NA	NA	NA
AVS28525.1|4277713_4279165_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	4.6e-12
AVS28526.1|4279265_4279964_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVS28527.1|4279960_4280101_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
AVS28528.1|4280100_4280364_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
AVS28529.1|4280479_4281550_-	lac repressor	NA	C6ZCU4	Enterobacteria_phage	42.8	6.1e-70
>prophage 304
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4290724	4291834	5438150		Planktothrix_phage(100.0%)	1	NA	NA
AVS28537.1|4290724_4291834_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.5	1.1e-26
>prophage 305
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4302757	4306301	5438150		Bacillus_phage(100.0%)	2	NA	NA
AVS28550.1|4302757_4304536_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	6.0e-38
AVS28551.1|4304528_4306301_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	9.1e-47
>prophage 306
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4310728	4311430	5438150		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVS28556.1|4310728_4311430_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.1e-88
>prophage 307
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4314660	4319829	5438150	protease	Sodalis_phage(25.0%)	4	NA	NA
AVS28560.1|4314660_4314933_-	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
AVS28561.1|4315142_4317497_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	2.7e-224
AVS28562.1|4317680_4318955_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	7.3e-131
AVS28563.1|4319205_4319829_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	3.8e-64
>prophage 308
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4334135	4335833	5438150		Lactobacillus_phage(100.0%)	1	NA	NA
AVS28579.1|4334135_4335833_+	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	25.5	7.2e-17
>prophage 309
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4348618	4353278	5438150		Klosneuvirus(33.33%)	6	NA	NA
AVS28592.1|4348618_4349593_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	21.2	1.2e-08
AVS28593.1|4349638_4350142_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
AVS28594.1|4350134_4351106_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
AVS28595.1|4351177_4351597_-	N utilization substance protein B	NA	NA	NA	NA	NA
AVS28596.1|4351616_4352087_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
AVS28597.1|4352174_4353278_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	6.5e-51
>prophage 310
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4356876	4361215	5438150	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
AVS28603.1|4356876_4357848_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.1	3.6e-45
AVS28604.1|4357858_4359706_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AVS28605.1|4359732_4360065_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	4.9e-10
AVS28606.1|4360087_4361215_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	1.6e-89
>prophage 311
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4378020	4386540	5438150		Bacillus_phage(60.0%)	6	NA	NA
AVS28622.1|4378020_4379316_-	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.0	2.2e-26
AVS28623.1|4379337_4380027_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.6	3.7e-36
AVS28624.1|4380209_4381415_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	35.5	1.8e-06
AVS28625.1|4381411_4384549_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	24.9	1.0e-08
AVS28626.1|4384622_4385537_-	fructokinase	NA	NA	NA	NA	NA
AVS28627.1|4385628_4386540_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	5.5e-104
>prophage 312
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4407023	4407791	5438150		Planktothrix_phage(100.0%)	1	NA	NA
AVS28648.1|4407023_4407791_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	4.3e-25
>prophage 313
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4418794	4422515	5438150		Anomala_cuprea_entomopoxvirus(66.67%)	5	NA	NA
AVS28658.1|4418794_4419577_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	8.8e-10
AVS28659.1|4419569_4420265_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.9	1.1e-06
AVS28660.1|4420381_4420552_-	hypothetical protein	NA	NA	NA	NA	NA
AVS28661.1|4420885_4421695_+	cysteine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS28662.1|4421696_4422515_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	3.1e-34
>prophage 314
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4431588	4432431	5438150		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVS28670.1|4431588_4432431_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.2	2.4e-13
>prophage 315
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4439275	4452271	5438150	integrase	Enterobacteria_phage(72.73%)	14	4441067:4441081	4464124:4464138
AVS28678.1|4439275_4440328_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	57.9	1.4e-111
AVS28679.1|4440617_4441721_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4441067:4441081	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
AVS28680.1|4441731_4442985_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
AVS28681.1|4443337_4444528_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
AVS28682.1|4444515_4445466_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
AVS28683.1|4445465_4445891_+	hypothetical protein	NA	NA	NA	NA	NA
AVS28684.1|4446459_4447026_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
AVS28685.1|4447043_4447289_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
AVS28686.1|4447285_4448023_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
AVS28687.1|4448564_4448831_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
AVS28688.1|4448827_4449385_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
AVS28689.1|4449381_4449609_+	hypothetical protein	NA	NA	NA	NA	NA
AVS28690.1|4449605_4449926_+	hypothetical protein	NA	NA	NA	NA	NA
AVS28691.1|4449937_4452271_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4464124:4464138	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 316
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4460727	4462125	5438150		Erysipelothrix_phage(100.0%)	1	NA	NA
AVS28697.1|4460727_4462125_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.5	5.7e-44
>prophage 317
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4466772	4467768	5438150		Catovirus(100.0%)	1	NA	NA
AVS28703.1|4466772_4467768_+	oxidoreductase	NA	A0A1V0SBV6	Catovirus	29.9	2.4e-28
>prophage 318
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4475301	4476585	5438150		Klosneuvirus(100.0%)	1	NA	NA
AVS28710.1|4475301_4476585_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.4	6.4e-34
>prophage 319
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4493834	4494416	5438150		Caulobacter_phage(100.0%)	1	NA	NA
AVS28729.1|4493834_4494416_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	29.8	2.2e-13
>prophage 320
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4499924	4504134	5438150		Bradyrhizobium_phage(33.33%)	5	NA	NA
AVS29752.1|4499924_4500656_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	36.9	7.1e-38
AVS28734.1|4500720_4501188_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	56.6	8.0e-51
AVS28735.1|4501184_4501907_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVS28736.1|4501939_4502695_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AVS28737.1|4502766_4504134_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	29.1	4.0e-10
>prophage 321
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4508199	4509003	5438150		Indivirus(100.0%)	1	NA	NA
AVS28741.1|4508199_4509003_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	37.0	8.4e-40
>prophage 322
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4515515	4516547	5438150		Planktothrix_phage(100.0%)	1	NA	NA
AVS28743.1|4515515_4516547_+	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	9.4e-36
>prophage 323
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4529531	4533631	5438150		Saccharomonospora_phage(50.0%)	2	NA	NA
AVS28756.1|4529531_4533014_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.4	9.1e-208
AVS28757.1|4533031_4533631_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.6	1.6e-27
>prophage 324
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4542462	4543221	5438150		Flavobacterium_phage(100.0%)	1	NA	NA
AVS28766.1|4542462_4543221_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	6.1e-24
>prophage 325
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4554799	4556233	5438150	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVS28777.1|4554799_4556233_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	3.9e-24
>prophage 326
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4560188	4560533	5438150		Lake_Baikal_phage(100.0%)	1	NA	NA
AVS28782.1|4560188_4560533_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.2e-27
>prophage 327
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4566499	4567297	5438150		Planktothrix_phage(100.0%)	1	NA	NA
AVS28786.1|4566499_4567297_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	9.2e-15
>prophage 328
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4589432	4596203	5438150	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
AVS28805.1|4589432_4591862_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	31.0	5.1e-40
AVS28806.1|4591934_4592471_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AVS28807.1|4592470_4593187_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AVS28808.1|4593349_4593805_+	RNA polymerase-binding transcription factor	NA	NA	NA	NA	NA
AVS28809.1|4593864_4594746_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AVS28810.1|4594808_4596203_+	polynucleotide adenylyltransferase	NA	H7BUW3	unidentified_phage	36.9	1.6e-25
>prophage 329
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4601607	4611484	5438150	transposase	Anomala_cuprea_entomopoxvirus(25.0%)	9	NA	NA
AVS28818.1|4601607_4602534_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.4	1.8e-22
AVS28819.1|4602718_4603381_+	carbonate dehydratase	NA	NA	NA	NA	NA
AVS28820.1|4603440_4603977_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.8	3.9e-17
AVS28821.1|4604181_4606572_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
AVS28822.1|4606655_4608254_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	51.1	7.5e-16
AVS28823.1|4608399_4608747_+	hypothetical protein	NA	NA	NA	NA	NA
AVS28824.1|4608994_4609405_+	hypothetical protein	NA	NA	NA	NA	NA
AVS28825.1|4609401_4610244_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AVS28826.1|4610292_4611484_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
>prophage 330
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4621134	4622559	5438150		Erysipelothrix_phage(100.0%)	1	NA	NA
AVS28835.1|4621134_4622559_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	2.1e-41
>prophage 331
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4633899	4634463	5438150		Sphingobium_phage(100.0%)	1	NA	NA
AVS28843.1|4633899_4634463_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.4	4.1e-09
>prophage 332
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4638730	4639774	5438150		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVS28848.1|4638730_4639774_-	guanosine monophosphate reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.9	3.1e-103
>prophage 333
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4665966	4667691	5438150		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVS28874.1|4665966_4667691_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.8	3.3e-33
>prophage 334
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4679090	4679846	5438150		Streptococcus_phage(100.0%)	1	NA	NA
AVS28885.1|4679090_4679846_+	3-dehydroquinase	NA	W6LP76	Streptococcus_phage	36.5	5.5e-25
>prophage 335
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4688545	4689247	5438150		Bacillus_virus(100.0%)	1	NA	NA
AVS28893.1|4688545_4689247_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	36.2	8.1e-23
>prophage 336
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4695543	4700995	5438150		Fish_lymphocystis_disease_virus(50.0%)	2	NA	NA
AVS28899.1|4695543_4697901_+	DNA polymerase II	NA	X5FTI3	Fish_lymphocystis_disease_virus	23.4	6.7e-13
AVS28900.1|4698088_4700995_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.9	4.9e-21
>prophage 337
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4713453	4715037	5438150		Pseudomonas_phage(50.0%)	3	NA	NA
AVS28912.1|4713453_4714302_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	48.4	3.4e-07
AVS28913.1|4714254_4714458_-	hypothetical protein	NA	NA	NA	NA	NA
AVS28914.1|4714557_4715037_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.2e-28
>prophage 338
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4721378	4722527	5438150		Halovirus(100.0%)	1	NA	NA
AVS28919.1|4721378_4722527_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.1	9.1e-48
>prophage 339
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4741324	4751277	5438150	tRNA	Tupanvirus(25.0%)	8	NA	NA
AVS29763.1|4741324_4744141_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.3	4.6e-77
AVS28939.1|4744184_4745123_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
AVS29764.1|4745138_4745333_+	hypothetical protein	NA	NA	NA	NA	NA
AVS28940.1|4745452_4745716_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AVS28941.1|4745835_4746732_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
AVS28942.1|4746786_4747962_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.4	4.9e-89
AVS28943.1|4748139_4749273_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	1.2e-28
AVS28944.1|4749360_4751277_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
>prophage 340
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4755648	4756602	5438150		Cyanophage(100.0%)	1	NA	NA
AVS28950.1|4755648_4756602_-	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	1.3e-10
>prophage 341
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4773759	4778919	5438150		Bacillus_phage(33.33%)	3	NA	NA
AVS29768.1|4773759_4775697_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	2.7e-12
AVS28967.1|4775925_4777593_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.8	2.9e-42
AVS28968.1|4777686_4778919_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.3	1.3e-87
>prophage 342
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4785250	4786573	5438150		Geobacillus_virus(100.0%)	1	NA	NA
AVS28975.1|4785250_4786573_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.9	2.0e-78
>prophage 343
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4791308	4794029	5438150		Salmonella_phage(50.0%)	3	NA	NA
AVS28979.1|4791308_4791470_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	67.9	1.2e-11
AVS28980.1|4791599_4792220_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AVS28981.1|4792439_4794029_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.9	5.3e-30
>prophage 344
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4807251	4808531	5438150		Salmonella_phage(50.0%)	2	NA	NA
AVS28996.1|4807251_4807791_+	primosomal protein 1	NA	T1SA92	Salmonella_phage	62.8	2.4e-27
AVS28997.1|4807793_4808531_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.7	1.2e-64
>prophage 345
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4811691	4814859	5438150	transposase	Sodalis_phage(50.0%)	3	NA	NA
AVS29772.1|4811691_4812630_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	53.4	2.9e-68
AVS29000.1|4812769_4813801_-	SIS domain-containing protein	NA	NA	NA	NA	NA
AVS29001.1|4813797_4814859_-	glucosamine--fructose-6-phosphate aminotransferase	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	22.5	2.5e-07
>prophage 346
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4821863	4825509	5438150	transposase	Tupanvirus(50.0%)	4	NA	NA
AVS29007.1|4821863_4822886_-	galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	27.3	1.7e-13
AVS29008.1|4823022_4823937_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVS29774.1|4824364_4824490_+	ABC transporter	NA	NA	NA	NA	NA
AVS29009.1|4824528_4825509_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 347
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4856187	4857114	5438150	transposase	Sodalis_phage(100.0%)	1	NA	NA
AVS29040.1|4856187_4857114_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	51.2	3.9e-73
>prophage 348
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4872701	4874186	5438150		Bacillus_virus(100.0%)	1	NA	NA
AVS29059.1|4872701_4874186_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	3.2e-13
>prophage 349
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4878102	4880847	5438150		Staphylococcus_phage(100.0%)	1	NA	NA
AVS29062.1|4878102_4880847_+	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	2.7e-21
>prophage 350
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4888671	4890778	5438150		Hokovirus(50.0%)	2	NA	NA
AVS29067.1|4888671_4890105_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.6	2.0e-12
AVS29068.1|4890094_4890778_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	7.9e-31
>prophage 351
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4894016	4898974	5438150		Leptospira_phage(33.33%)	4	NA	NA
AVS29073.1|4894016_4897166_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.4	6.4e-59
AVS29074.1|4897238_4897586_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
AVS29075.1|4897595_4898129_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	59.6	8.2e-52
AVS29076.1|4898245_4898974_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	47.4	1.4e-46
>prophage 352
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4919784	4925609	5438150		Enterobacteria_phage(100.0%)	7	NA	NA
AVS29098.1|4919784_4922118_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
AVS29099.1|4922132_4922453_-	hypothetical protein	NA	NA	NA	NA	NA
AVS29100.1|4922449_4922677_-	hypothetical protein	NA	NA	NA	NA	NA
AVS29101.1|4922673_4923222_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
AVS29102.1|4924045_4924783_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
AVS29103.1|4924779_4925025_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
AVS29104.1|4925042_4925609_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
>prophage 353
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4928984	4930247	5438150	integrase	Stenotrophomonas_phage(100.0%)	1	4921263:4921277	4931795:4931809
4921263:4921277	attL	GCGGCAGGGCGACAA	NA	NA	NA	NA
AVS29108.1|4928984_4930247_-|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.7	8.2e-74
AVS29108.1|4928984_4930247_-|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.7	8.2e-74
4931795:4931809	attR	TTGTCGCCCTGCCGC	NA	NA	NA	NA
>prophage 354
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4933329	4938155	5438150		Tupanvirus(50.0%)	5	NA	NA
AVS29111.1|4933329_4934349_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.7	8.4e-45
AVS29777.1|4934491_4935364_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AVS29112.1|4935353_4936241_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AVS29113.1|4936251_4937076_+	phosphodiesterase	NA	NA	NA	NA	NA
AVS29114.1|4937081_4938155_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	5.2e-29
>prophage 355
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4954046	4963096	5438150	tRNA	Klebsiella_phage(33.33%)	7	NA	NA
AVS29130.1|4954046_4955549_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.1	1.6e-84
AVS29131.1|4955597_4956680_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AVS29132.1|4956679_4957777_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AVS29133.1|4957766_4957886_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AVS29134.1|4958166_4959678_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	9.2e-48
AVS29135.1|4959797_4960241_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AVS29136.1|4960240_4963096_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.4	6.0e-141
>prophage 356
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4973189	4979247	5438150		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
AVS29148.1|4973189_4974125_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	1.3e-52
AVS29149.1|4974138_4974600_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AVS29150.1|4974752_4975139_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
AVS29151.1|4975211_4977920_-	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	26.5	4.1e-46
AVS29778.1|4978065_4978263_-	hypothetical protein	NA	NA	NA	NA	NA
AVS29152.1|4978299_4979247_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.6	1.5e-11
>prophage 357
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	4987004	4990136	5438150		Vibrio_phage(33.33%)	3	NA	NA
AVS29158.1|4987004_4989143_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.2	5.3e-267
AVS29159.1|4989383_4989848_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	58.9	2.9e-53
AVS29160.1|4989851_4990136_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.6	2.4e-26
>prophage 358
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5006269	5012848	5438150		Klosneuvirus(33.33%)	6	NA	NA
AVS29178.1|5006269_5007268_+	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	1.3e-69
AVS29179.1|5007310_5008309_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
AVS29180.1|5008295_5009321_-	ABC transporter permease	NA	NA	NA	NA	NA
AVS29181.1|5009331_5010834_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	7.6e-10
AVS29182.1|5010957_5011914_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS29183.1|5012317_5012848_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	2.7e-55
>prophage 359
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5029347	5030172	5438150		Bordetella_phage(100.0%)	1	NA	NA
AVS29197.1|5029347_5030172_+	AraC family transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	42.0	1.9e-07
>prophage 360
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5049769	5054113	5438150		Lactococcus_phage(50.0%)	3	NA	NA
AVS29222.1|5049769_5052202_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.7	1.4e-66
AVS29223.1|5052238_5052664_-	transcriptional regulator	NA	NA	NA	NA	NA
AVS29224.1|5052814_5054113_-	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
>prophage 361
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5060043	5063269	5438150		Wolbachia_phage(50.0%)	2	NA	NA
AVS29232.1|5060043_5061903_-	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.8	2.2e-59
AVS29233.1|5061913_5063269_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	3.1e-18
>prophage 362
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5068111	5068657	5438150		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVS29239.1|5068111_5068657_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	42.1	1.2e-29
>prophage 363
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5076011	5081205	5438150		Tupanvirus(33.33%)	6	NA	NA
AVS29245.1|5076011_5076989_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.7	2.8e-29
AVS29246.1|5077264_5079055_+	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.2	3.8e-16
AVS29247.1|5079047_5079782_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AVS29248.1|5079792_5080188_+	fumarate reductase subunit C	NA	NA	NA	NA	NA
AVS29249.1|5080198_5080558_+	fumarate reductase subunit D	NA	NA	NA	NA	NA
AVS29250.1|5080671_5081205_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	50.0	5.0e-41
>prophage 364
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5085319	5086300	5438150	transposase	Escherichia_phage(100.0%)	1	NA	NA
AVS29257.1|5085319_5086300_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 365
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5093584	5099230	5438150		Bacillus_phage(33.33%)	5	NA	NA
AVS29265.1|5093584_5095708_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.9	7.6e-32
AVS29266.1|5095720_5096584_+	hypothetical protein	NA	NA	NA	NA	NA
AVS29267.1|5096638_5096992_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
AVS29268.1|5097252_5098899_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	9.0e-190
AVS29269.1|5098936_5099230_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	42.3	3.5e-12
>prophage 366
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5110143	5111507	5438150	transposase	Bacillus_phage(100.0%)	1	NA	NA
AVS29277.1|5110143_5111507_-|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
>prophage 367
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5120748	5125835	5438150	transposase	Escherichia_phage(40.0%)	6	NA	NA
AVS29284.1|5120748_5121432_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	42.2	5.1e-30
AVS29285.1|5121577_5122495_+	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	42.2	2.8e-07
AVS29286.1|5122494_5122800_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
AVS29287.1|5122968_5124331_+|transposase	IS3-like element ISKpn1 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.5	1.4e-74
AVS29288.1|5124497_5124869_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	53.7	2.8e-22
AVS29289.1|5124878_5125835_-	recombinase	NA	A0A222YXF2	Escherichia_phage	78.0	1.3e-143
>prophage 368
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5130199	5131702	5438150		Burkholderia_virus(100.0%)	1	NA	NA
AVS29293.1|5130199_5131702_-	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.7	1.1e-56
>prophage 369
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5137062	5138609	5438150		Bacillus_virus(50.0%)	2	NA	NA
AVS29301.1|5137062_5137821_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.7	2.6e-14
AVS29302.1|5137928_5138609_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.0	6.7e-06
>prophage 370
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5143989	5145510	5438150		Staphylococcus_phage(100.0%)	1	NA	NA
AVS29308.1|5143989_5145510_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	1.7e-12
>prophage 371
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5151451	5158236	5438150		Escherichia_phage(50.0%)	5	NA	NA
AVS29315.1|5151451_5153599_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.3	2.0e-32
AVS29316.1|5153828_5154515_+	sel1 repeat family protein	NA	NA	NA	NA	NA
AVS29317.1|5154551_5155865_-	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
AVS29318.1|5155976_5156177_-	hypothetical protein	NA	NA	NA	NA	NA
AVS29319.1|5156277_5158236_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.3	3.0e-91
>prophage 372
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5170519	5171869	5438150		Moraxella_phage(100.0%)	1	NA	NA
AVS29331.1|5170519_5171869_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.1	1.5e-158
>prophage 373
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5179398	5180430	5438150		Mycoplasma_phage(100.0%)	1	NA	NA
AVS29787.1|5179398_5180430_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	51.5	1.6e-19
>prophage 374
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5192409	5197716	5438150		Vibrio_phage(33.33%)	3	NA	NA
AVS29350.1|5192409_5193990_+	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	6.3e-07
AVS29351.1|5194114_5194639_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	95.4	5.1e-54
AVS29352.1|5194890_5197716_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
>prophage 375
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5200897	5203424	5438150		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
AVS29357.1|5200897_5201977_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.4	1.9e-26
AVS29358.1|5202008_5203424_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.8	5.7e-201
>prophage 376
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5209419	5210028	5438150		Lactococcus_phage(100.0%)	1	NA	NA
AVS29366.1|5209419_5210028_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	40.7	4.6e-14
>prophage 377
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5217094	5218204	5438150		Mycoplasma_phage(100.0%)	1	NA	NA
AVS29373.1|5217094_5218204_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	3.6e-17
>prophage 378
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5234713	5235517	5438150		Moumouvirus(100.0%)	1	NA	NA
AVS29389.1|5234713_5235517_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2P1ELN2	Moumouvirus	24.2	1.8e-05
>prophage 379
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5242085	5245769	5438150		Dickeya_phage(100.0%)	1	NA	NA
AVS29397.1|5242085_5245769_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 380
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5259312	5260902	5438150		Prochlorococcus_phage(100.0%)	1	NA	NA
AVS29405.1|5259312_5260902_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.0	5.3e-70
>prophage 381
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5266323	5268087	5438150		Bacillus_phage(50.0%)	3	NA	NA
AVS29410.1|5266323_5266596_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	9.4e-20
AVS29411.1|5266782_5267373_-	DUF416 domain-containing protein	NA	NA	NA	NA	NA
AVS29412.1|5267415_5268087_-	endonuclease V	NA	A0A1V0SJW5	Klosneuvirus	27.6	2.6e-18
>prophage 382
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5276575	5288956	5438150		Bacillus_phage(33.33%)	6	NA	NA
AVS29793.1|5276575_5278045_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.1	2.1e-12
AVS29423.1|5278217_5278523_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AVS29424.1|5278526_5278844_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AVS29425.1|5278886_5280227_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
AVS29426.1|5280627_5284851_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	9.1e-69
AVS29427.1|5284927_5288956_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.6	2.3e-21
>prophage 383
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5293183	5296304	5438150		Tupanvirus(50.0%)	2	NA	NA
AVS29436.1|5293183_5294368_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
AVS29437.1|5295353_5296304_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	2.7e-29
>prophage 384
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5306240	5306855	5438150		Streptococcus_phage(100.0%)	1	NA	NA
AVS29443.1|5306240_5306855_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.5	9.6e-20
>prophage 385
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5315573	5318917	5438150		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AVS29452.1|5315573_5316353_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.7	7.4e-25
AVS29453.1|5316355_5316892_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AVS29454.1|5316895_5317147_-	Sec-independent protein translocase protein TatA	NA	NA	NA	NA	NA
AVS29455.1|5317276_5318917_-	ubiquinone biosynthesis protein UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	2.2e-39
>prophage 386
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5330918	5334380	5438150	transposase	Sodalis_phage(50.0%)	3	NA	NA
AVS29467.1|5330918_5331827_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	53.8	6.3e-68
AVS29468.1|5331871_5332492_-	threonine export protein RhtC	NA	NA	NA	NA	NA
AVS29469.1|5332553_5334380_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	5.7e-84
>prophage 387
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5338215	5342060	5438150		Bacillus_phage(50.0%)	3	NA	NA
AVS29475.1|5338215_5340378_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	6.0e-117
AVS29476.1|5340441_5341158_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
AVS29477.1|5341157_5342060_-	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.4	5.9e-18
>prophage 388
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5358426	5364568	5438150		uncultured_marine_virus(20.0%)	6	NA	NA
AVS29492.1|5358426_5359557_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
AVS29493.1|5359562_5360237_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AVS29494.1|5360214_5361096_-	glucose-1-phosphate thymidylyltransferase	NA	A0A291LA53	Escherichia_phage	67.4	6.0e-108
AVS29495.1|5361114_5362182_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	2.4e-98
AVS29496.1|5362178_5363441_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	25.9	3.8e-23
AVS29497.1|5363437_5364568_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.2	9.7e-26
>prophage 389
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5368618	5377241	5438150	transposase	Indivirus(25.0%)	9	NA	NA
AVS29502.1|5368618_5368948_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	39.6	2.5e-14
AVS29503.1|5369289_5370555_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.3	1.8e-41
AVS29504.1|5370573_5370711_-	addiction module toxin RelE	NA	NA	NA	NA	NA
AVS29505.1|5370682_5372182_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
AVS29506.1|5372201_5373128_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS29794.1|5373239_5373389_+	ABC transporter	NA	NA	NA	NA	NA
AVS29507.1|5373427_5374408_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AVS29508.1|5374492_5375215_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
AVS29509.1|5375219_5377241_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	1.1e-112
>prophage 390
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5385344	5386991	5438150		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVS29518.1|5385344_5386991_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	3.1e-65
>prophage 391
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5397053	5398892	5438150		Acinetobacter_phage(100.0%)	1	NA	NA
AVS29524.1|5397053_5398892_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.2	1.7e-08
>prophage 392
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5413522	5414185	5438150		Cyanophage(100.0%)	1	NA	NA
AVS29537.1|5413522_5414185_+	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	1.0e-27
>prophage 393
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5418956	5420513	5438150		Pandoravirus(100.0%)	1	NA	NA
AVS29543.1|5418956_5420513_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	23.8	5.6e-08
>prophage 394
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5431577	5432912	5438150		Erwinia_phage(100.0%)	1	NA	NA
AVS29553.1|5431577_5432912_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.5	2.1e-43
>prophage 395
CP028180	Klebsiella pneumoniae strain CFSAN054110 chromosome, complete genome	5438150	5437414	5438113	5438150		Feldmannia_irregularis_virus(100.0%)	1	NA	NA
AVS29558.1|5437414_5438113_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
>prophage 1
CP028181	Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence	227967	1904	56901	227967	integrase,protease,transposase	Escherichia_phage(25.0%)	52	31809:31822	58680:58693
AVS29993.1|1904_3251_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AVS29801.1|5093_6056_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AVS29802.1|6042_6792_-	diguanylate cyclase	NA	NA	NA	NA	NA
AVS29803.1|7029_7227_-	hypothetical protein	NA	NA	NA	NA	NA
AVS29804.1|7226_10022_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
AVS29805.1|10136_10706_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AVS29994.1|10740_11022_-	DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
AVS29806.1|13008_13989_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AVS29995.1|14027_14114_-	ABC transporter	NA	NA	NA	NA	NA
AVS29996.1|14165_14492_+	hypothetical protein	NA	NA	NA	NA	NA
AVS29807.1|15197_16067_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS29808.1|16060_17071_-	phosphonate dehydrogenase	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
AVS29997.1|17079_17907_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
AVS29809.1|17915_18779_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS29810.1|18775_19603_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
AVS29811.1|20458_21163_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AVS29812.1|22466_23135_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	3.3e-130
AVS29813.1|23256_24162_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AVS29814.1|24158_25397_+	MFS transporter	NA	NA	NA	NA	NA
AVS29815.1|25396_25981_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVS29816.1|25926_26283_+	hypothetical protein	NA	NA	NA	NA	NA
AVS29817.1|26473_27238_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AVS29818.1|27266_27449_+	resolvase	NA	NA	NA	NA	NA
AVS29819.1|27464_27770_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AVS29820.1|27780_28986_-	chromate transporter	NA	NA	NA	NA	NA
AVS29821.1|29141_29345_-	hypothetical protein	NA	NA	NA	NA	NA
AVS29822.1|29363_29543_+	hypothetical protein	NA	NA	NA	NA	NA
AVS29823.1|29472_30312_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AVS29824.1|30305_30653_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVS29825.1|30816_31608_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
31809:31822	attL	TGAAAACCTGCGCA	NA	NA	NA	NA
AVS29826.1|32015_32513_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AVS29827.1|32657_33671_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVS29828.1|33609_34224_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AVS29829.1|34349_34910_+	DNA resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AVS29830.1|34912_37879_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AVS29831.1|37945_38323_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVS29832.1|38523_39183_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AVS29833.1|39236_39428_+	hypothetical protein	NA	NA	NA	NA	NA
AVS29834.1|40160_40391_+	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
AVS29835.1|40390_41779_+	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	1.1e-50
AVS29836.1|41771_42884_+	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
AVS29837.1|42880_43516_+	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
AVS29998.1|44072_44450_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	91.3	1.6e-57
AVS29838.1|44446_44794_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
AVS29839.1|48616_50350_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
AVS29840.1|50357_51305_-	acetamidase	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
AVS29841.1|51349_52954_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS29842.1|52966_53887_-	ABC transporter permease	NA	NA	NA	NA	NA
AVS29843.1|53886_54735_-	ABC transporter permease	NA	NA	NA	NA	NA
AVS29844.1|54731_55325_-	response regulator	NA	NA	NA	NA	NA
AVS29845.1|55321_56449_-	regulator	NA	NA	NA	NA	NA
AVS29846.1|56733_56901_-|integrase	integrase	integrase	NA	NA	NA	NA
58680:58693	attR	TGAAAACCTGCGCA	NA	NA	NA	NA
>prophage 2
CP028181	Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence	227967	84666	112196	227967	integrase,transposase	Escherichia_phage(27.27%)	23	99901:99914	102363:102376
AVS29864.1|84666_85371_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
AVS30000.1|85443_88341_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
AVS29865.1|88429_89050_+	serine recombinase	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
AVS29866.1|90215_90575_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
AVS29867.1|91078_92263_+|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
AVS29868.1|92539_93859_+|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AVS29869.1|94108_94990_-	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
AVS29870.1|95041_95281_-	hypothetical protein	NA	NA	NA	NA	NA
AVS29871.1|95277_96057_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AVS29872.1|96053_97079_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AVS29873.1|97185_100215_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
99901:99914	attL	GTAGCGTTCATGCT	NA	NA	NA	NA
AVS29874.1|100324_102040_+|integrase	integrase	integrase	NA	NA	NA	NA
AVS30001.1|102574_103531_+	hypothetical protein	NA	NA	NA	NA	NA
102363:102376	attR	AGCATGAACGCTAC	NA	NA	NA	NA
AVS29875.1|103927_104539_-	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
AVS29876.1|104522_105086_-	hypothetical protein	NA	NA	NA	NA	NA
AVS29877.1|105811_106000_+	hypothetical protein	NA	NA	NA	NA	NA
AVS29878.1|106304_107162_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AVS30002.1|107154_107232_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
AVS30003.1|107463_107715_-	transcriptional regulator	NA	NA	NA	NA	NA
AVS30004.1|107850_108402_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	4.0e-17
AVS29879.1|108505_108814_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
AVS29880.1|108810_109116_-	hypothetical protein	NA	NA	NA	NA	NA
AVS29881.1|109178_112196_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
>prophage 1
CP028182	Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_02, complete sequence	43380	13699	23997	43380	transposase	Escherichia_phage(55.56%)	11	NA	NA
AVS30031.1|13699_16717_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
AVS30032.1|17925_18828_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AVS30033.1|18865_19099_-	hypothetical protein	NA	NA	NA	NA	NA
AVS30034.1|19089_19851_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AVS30035.1|19871_20732_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AVS30036.1|20695_20878_-	hypothetical protein	NA	NA	NA	NA	NA
AVS30037.1|20868_21573_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AVS30038.1|21606_21963_-	sOS mutagenesis and repair protein UmuD	NA	A0A222YZE2	Escherichia_phage	46.6	5.5e-20
AVS30039.1|21965_22205_-	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
AVS30064.1|22291_22954_-	resolvase	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
AVS30040.1|23334_23997_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
