The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028176	Klebsiella pneumoniae strain CFSAN054111 chromosome, complete genome	5279647	15822	62725	5279647	terminase,integrase,holin,tail	Klebsiella_phage(23.4%)	60	5914:5929	60031:60046
5914:5929	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
AVS19225.1|15822_18024_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	38.0	4.4e-99
AVS19226.1|18099_21174_-	kinase	NA	A0A286S259	Klebsiella_phage	96.7	0.0e+00
AVS19227.1|21170_21551_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	94.4	2.4e-69
AVS19228.1|21560_22043_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	96.2	1.1e-82
AVS19229.1|22223_22688_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.4	3.0e-58
AVS19230.1|22687_25588_-|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.0	5.2e-100
AVS23979.1|25679_26153_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	57.4	4.6e-22
AVS19231.1|26266_26434_-	hypothetical protein	NA	NA	NA	NA	NA
AVS19232.1|26601_27084_-	hypothetical protein	NA	NA	NA	NA	NA
AVS19233.1|27137_28310_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
AVS19234.1|28333_28726_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AVS19235.1|28722_29274_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	7.8e-29
AVS19236.1|29275_29659_-	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
AVS19237.1|29645_29879_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
AVS19238.1|29888_30143_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
AVS19239.1|30144_30540_-	protein singed	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	3.3e-13
AVS19240.1|30861_31815_-	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.0	2.5e-131
AVS19241.1|31825_32611_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
AVS19242.1|32695_33808_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.2	4.8e-110
AVS19243.1|33791_35192_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	9.2e-127
AVS19244.1|35191_36499_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.7	5.2e-148
AVS19245.1|36476_37481_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
AVS19246.1|38029_38215_-	hypothetical protein	NA	NA	NA	NA	NA
AVS19247.1|38343_38589_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
AVS19248.1|39402_39597_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	1.4e-25
AVS19249.1|39547_39823_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
AVS19250.1|39819_40164_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
AVS19251.1|40160_40700_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
AVS19252.1|40696_41008_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	98.0	1.6e-47
AVS19253.1|41609_42056_+	hypothetical protein	NA	NA	NA	NA	NA
AVS23980.1|41961_42219_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	98.8	2.8e-42
AVS19254.1|42372_43155_-	antitermination protein	NA	F1C595	Cronobacter_phage	79.1	2.9e-114
AVS19255.1|43151_43520_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	63.8	3.5e-41
AVS19256.1|43516_43813_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.9	1.7e-35
AVS19257.1|43815_44022_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	72.7	1.4e-23
AVS19258.1|44021_44621_-	DUF1367 domain-containing protein	NA	K7PKS6	Enterobacteria_phage	79.9	1.7e-90
AVS19259.1|44678_44900_-	hypothetical protein	NA	NA	NA	NA	NA
AVS19260.1|44977_45211_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	67.5	7.0e-24
AVS19261.1|45813_46656_-	hypothetical protein	NA	NA	NA	NA	NA
AVS23981.1|46645_47689_-	DGQHR domain-containing protein	NA	NA	NA	NA	NA
AVS19262.1|47942_48179_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	92.1	2.4e-32
AVS19263.1|48171_48375_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	92.5	3.7e-29
AVS19264.1|48371_48740_-	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	44.3	6.4e-11
AVS19265.1|48747_49497_-	DNA replication protein DnaC	NA	H6WRX8	Salmonella_phage	80.3	3.0e-116
AVS23982.1|49499_50339_-	hypothetical protein	NA	Q8HA96	Salmonella_phage	53.1	2.3e-24
AVS19266.1|50404_51199_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.3	6.3e-64
AVS19267.1|51327_51864_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	69.5	4.4e-61
AVS19268.1|51866_52130_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AVS19269.1|52226_52583_+	hypothetical protein	NA	NA	NA	NA	NA
AVS19270.1|52809_53118_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	62.2	1.7e-25
AVS19271.1|53209_53308_+	hypothetical protein	NA	NA	NA	NA	NA
AVS19272.1|53414_53606_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVS19273.1|53907_57045_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	56.7	2.7e-291
AVS19274.1|57057_58167_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	86.7	1.0e-184
AVS19275.1|58207_58447_+	DUF4060 domain-containing protein	NA	M9P0E0	Enterobacteria_phage	67.5	6.8e-22
AVS19276.1|58456_58771_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
AVS19277.1|58667_59855_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.2	4.2e-120
AVS19278.1|60031_60922_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
60031:60046	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
AVS19279.1|60921_61914_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AVS19280.1|61915_62725_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 2
CP028176	Klebsiella pneumoniae strain CFSAN054111 chromosome, complete genome	5279647	181114	226785	5279647	integrase,portal,plate,capsid,tail,tRNA,terminase	Enterobacteria_phage(54.29%)	57	186338:186359	223047:223068
AVS19394.1|181114_181615_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AVS19395.1|181731_182178_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AVS23986.1|182161_182953_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVS19396.1|183054_184239_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AVS19397.1|184270_184963_-	hypothetical protein	NA	NA	NA	NA	NA
AVS19398.1|185108_185618_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AVS19399.1|185604_185961_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AVS19400.1|185950_186190_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
186338:186359	attL	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AVS19401.1|186454_186706_-	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
AVS19402.1|186749_187889_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.5	3.0e-144
AVS19403.1|188043_189216_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	1.1e-157
AVS19404.1|189215_189731_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
AVS19405.1|189776_190094_+|tail	phage tail protein	tail	B9A7B2	Serratia_phage	54.8	1.0e-17
AVS23987.1|190093_190252_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
AVS19406.1|190238_193214_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.6	1.8e-220
AVS19407.1|193229_193721_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	2.1e-54
AVS19408.1|193965_195324_+	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	28.7	7.5e-49
AVS19409.1|195477_196575_-|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
AVS19410.1|196574_196787_-	hypothetical protein	NA	NA	NA	NA	NA
AVS19411.1|196783_199810_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
AVS19412.1|199799_200723_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	44.6	6.9e-54
AVS19413.1|200724_201075_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	54.8	9.3e-28
AVS19414.1|201071_201659_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
AVS19415.1|201655_202291_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
AVS19416.1|202287_202755_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
AVS23988.1|202936_203266_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AVS19417.1|203277_203823_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	9.7e-32
AVS19418.1|203819_204104_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVS19419.1|204094_204295_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
AVS19420.1|204294_204810_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	49.4	3.1e-40
AVS19421.1|204914_205781_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	57.3	8.4e-70
AVS19422.1|205830_206865_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	8.1e-96
AVS19423.1|206875_207715_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.9	1.6e-94
AVS19424.1|207871_209599_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	68.1	6.9e-233
AVS19425.1|209592_210654_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	1.0e-141
AVS19426.1|211130_211883_-	hypothetical protein	NA	NA	NA	NA	NA
AVS19427.1|211975_212200_-	hypothetical protein	NA	NA	NA	NA	NA
AVS23989.1|212804_213812_-	hypothetical protein	NA	NA	NA	NA	NA
AVS19428.1|213804_215751_-	DUF3696 domain-containing protein	NA	Q2P9X8	Enterobacteria_phage	39.6	3.4e-18
AVS19429.1|216008_218156_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	63.6	2.4e-243
AVS19430.1|218193_219129_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	55.9	1.9e-83
AVS23990.1|219125_219353_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.0	1.9e-05
AVS19431.1|219361_219928_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	9.5e-14
AVS19432.1|219924_220149_-	hypothetical protein	NA	NA	NA	NA	NA
AVS19433.1|220226_220490_-	hypothetical protein	NA	NA	NA	NA	NA
AVS19434.1|220505_220883_-	hypothetical protein	NA	NA	NA	NA	NA
AVS19435.1|220898_221117_-	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
AVS19436.1|221137_221416_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
AVS19437.1|221536_221836_+	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
AVS19438.1|221951_222935_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	80.1	6.4e-151
AVS19439.1|223199_224213_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
223047:223068	attR	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AVS19440.1|224270_224372_+	hypothetical protein	NA	NA	NA	NA	NA
AVS23991.1|224371_224446_+	hypothetical protein	NA	NA	NA	NA	NA
AVS19441.1|224563_224689_+	hypothetical protein	NA	NA	NA	NA	NA
AVS19442.1|224748_225012_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AVS19443.1|225142_225781_-	leucine efflux protein	NA	NA	NA	NA	NA
AVS19444.1|225870_226785_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.0	3.2e-72
>prophage 3
CP028176	Klebsiella pneumoniae strain CFSAN054111 chromosome, complete genome	5279647	506784	516247	5279647	protease,tRNA	Brazilian_cedratvirus(16.67%)	9	NA	NA
AVS19690.1|506784_508506_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	2.0e-14
AVS19691.1|508550_509252_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVS19692.1|509605_509824_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AVS19693.1|509943_512223_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AVS19694.1|512253_512571_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AVS19695.1|512896_513118_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AVS19696.1|513072_513255_-	hypothetical protein	NA	NA	NA	NA	NA
AVS19697.1|513194_515135_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AVS19698.1|515131_516247_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 4
CP028176	Klebsiella pneumoniae strain CFSAN054111 chromosome, complete genome	5279647	4994911	5005798	5279647		Escherichia_phage(87.5%)	9	NA	NA
AVS23731.1|4994911_4998019_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AVS23732.1|4998073_4999339_+	MFS transporter	NA	NA	NA	NA	NA
AVS23733.1|4999369_5000458_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	99.7	3.0e-210
AVS23734.1|5000544_5000805_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AVS23735.1|5001102_5001963_+	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
AVS23736.1|5001983_5002745_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AVS23737.1|5003005_5003908_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AVS23738.1|5003919_5005185_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
AVS23739.1|5005177_5005798_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
CP028176	Klebsiella pneumoniae strain CFSAN054111 chromosome, complete genome	5279647	5173268	5233630	5279647	protease,plate,tRNA,transposase	Escherichia_phage(28.57%)	53	NA	NA
AVS23892.1|5173268_5174204_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
AVS23893.1|5174249_5175623_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
AVS23894.1|5175637_5175832_-	hypothetical protein	NA	NA	NA	NA	NA
AVS23895.1|5176148_5177132_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AVS24200.1|5177410_5178154_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.1	1.7e-15
AVS23896.1|5178170_5179235_+	oxidoreductase	NA	NA	NA	NA	NA
AVS23897.1|5179471_5179666_+	hypothetical protein	NA	NA	NA	NA	NA
AVS23898.1|5179778_5180528_-	hypothetical protein	NA	NA	NA	NA	NA
AVS23899.1|5180778_5182158_-	aromatic amino acid transporter AroP	NA	NA	NA	NA	NA
AVS23900.1|5182492_5182972_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AVS23901.1|5183223_5183838_+	YitT family protein	NA	NA	NA	NA	NA
AVS23902.1|5183876_5185076_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AVS23903.1|5185104_5185773_-	ABC transporter permease	NA	NA	NA	NA	NA
AVS23904.1|5185765_5186779_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	1.7e-29
AVS23905.1|5186787_5187594_-	methionine-binding protein	NA	NA	NA	NA	NA
AVS23906.1|5187814_5188990_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AVS23907.1|5189034_5190069_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AVS23908.1|5190157_5190706_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVS23909.1|5190762_5191674_-	NmrA/HSCARG family protein	NA	NA	NA	NA	NA
AVS23910.1|5191666_5192533_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AVS23911.1|5192623_5193547_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS24201.1|5193566_5194472_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS23912.1|5194612_5195542_+	aromatic alcohol reductase	NA	NA	NA	NA	NA
AVS23913.1|5195567_5195774_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVS23914.1|5195824_5196703_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVS23915.1|5196861_5197617_+	KR domain-containing protein	NA	NA	NA	NA	NA
AVS23916.1|5197621_5198215_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVS23917.1|5198288_5199002_+	oxidoreductase	NA	NA	NA	NA	NA
AVS23918.1|5199068_5199563_-	hypothetical protein	NA	NA	NA	NA	NA
AVS23919.1|5199690_5200233_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AVS23920.1|5200210_5201296_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVS23921.1|5201259_5203014_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVS23922.1|5203090_5203561_-	hypothetical protein	NA	NA	NA	NA	NA
AVS23923.1|5204644_5206243_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AVS23924.1|5206239_5209698_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AVS23925.1|5209694_5210903_-	hypothetical protein	NA	NA	NA	NA	NA
AVS23926.1|5212349_5213448_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	9.7e-47
AVS23927.1|5213640_5214162_-	hypothetical protein	NA	NA	NA	NA	NA
AVS23928.1|5214341_5215109_-	hypothetical protein	NA	NA	NA	NA	NA
AVS23929.1|5215095_5217114_-	M23 family peptidase	NA	NA	NA	NA	NA
AVS23930.1|5217302_5218334_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
AVS23931.1|5218349_5218667_-	hypothetical protein	NA	NA	NA	NA	NA
AVS24202.1|5219061_5219337_-	hypothetical protein	NA	NA	NA	NA	NA
AVS23932.1|5219470_5220682_-	hypothetical protein	NA	NA	NA	NA	NA
AVS23933.1|5220674_5223194_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.3e-19
AVS23934.1|5223186_5225841_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	5.9e-98
AVS23935.1|5226105_5226597_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AVS23936.1|5226601_5228308_-	OmpA family protein	NA	NA	NA	NA	NA
AVS23937.1|5228304_5228994_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AVS24203.1|5228990_5230331_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVS23938.1|5230343_5231888_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AVS23939.1|5231930_5232422_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AVS23940.1|5233063_5233630_+|protease	protease	protease	NA	NA	NA	NA
>prophage 1
CP028177	Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence	116768	11440	23532	116768		Escherichia_phage(25.0%)	13	NA	NA
AVS24223.1|11440_12142_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
AVS24224.1|12578_12809_-	hypothetical protein	NA	NA	NA	NA	NA
AVS24225.1|12869_13541_-	Mediator of plasmid stability	NA	NA	NA	NA	NA
AVS24226.1|13543_14515_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AVS24227.1|14746_15178_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
AVS24228.1|15177_16449_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
AVS24229.1|16849_17746_+	replication initiation protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
AVS24230.1|18067_19273_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
AVS24231.1|19269_20244_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
AVS24232.1|20415_20601_+	hypothetical protein	NA	NA	NA	NA	NA
AVS24233.1|20620_20953_+	hypothetical protein	NA	NA	NA	NA	NA
AVS24234.1|21177_21393_+	hypothetical protein	NA	NA	NA	NA	NA
AVS24235.1|21504_23532_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
>prophage 2
CP028177	Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence	116768	28107	59697	116768	protease,integrase,transposase	Enterobacteria_phage(44.44%)	34	21749:21764	40284:40299
21749:21764	attL	ACAACACCTCTGAATA	NA	NA	NA	NA
AVS24238.1|28107_29376_+|transposase	ISL3 family transposase ISKpn25	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
AVS24239.1|29495_29969_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AVS24240.1|30133_30328_+	hypothetical protein	NA	NA	NA	NA	NA
AVS24241.1|31182_31965_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
AVS24242.1|31964_32297_-	hypothetical protein	NA	NA	NA	NA	NA
AVS24243.1|32303_32660_-	hypothetical protein	NA	NA	NA	NA	NA
AVS24244.1|32727_33057_-	hypothetical protein	NA	NA	NA	NA	NA
AVS24245.1|33084_33393_-	hypothetical protein	NA	NA	NA	NA	NA
AVS24246.1|33438_33645_-	hypothetical protein	NA	NA	NA	NA	NA
AVS24338.1|33879_34314_-	hypothetical protein	NA	NA	NA	NA	NA
AVS24247.1|34297_34528_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AVS24248.1|34524_34941_+	VapC toxin family PIN domain ribonuclease	NA	NA	NA	NA	NA
AVS24249.1|36517_37795_+	colicin V secretion protein CvaA	NA	NA	NA	NA	NA
AVS24250.1|37784_39893_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.3	2.4e-38
AVS24251.1|39892_40528_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
40284:40299	attR	TATTCAGAGGTGTTGT	NA	NA	NA	NA
AVS24252.1|40635_40980_-	hypothetical protein	NA	NA	NA	NA	NA
AVS24253.1|41173_41452_-	hypothetical protein	NA	NA	NA	NA	NA
AVS24254.1|41546_41810_+	hypothetical protein	NA	NA	NA	NA	NA
AVS24255.1|41874_42579_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVS24256.1|42590_43247_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVS24257.1|43342_44527_+	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
AVS24258.1|44621_44912_+	alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	40.6	4.8e-06
AVS24259.1|45006_45867_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVS24260.1|46687_48058_-|transposase	IS1182 family transposase ISCfr1	transposase	NA	NA	NA	NA
AVS24261.1|48172_49309_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
AVS24262.1|49359_49605_-	hypothetical protein	NA	NA	NA	NA	NA
AVS24263.1|49610_49802_+	hypothetical protein	NA	NA	NA	NA	NA
AVS24264.1|50283_50826_-	tunicamycin resistance protein	NA	NA	NA	NA	NA
AVS24265.1|50838_51699_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AVS24266.1|51880_52741_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVS24267.1|54324_55113_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AVS24339.1|55182_55737_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
AVS24268.1|55970_56528_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
AVS24269.1|56691_59697_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.5	0.0e+00
>prophage 1
CP028178	Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_2, complete sequence	100222	5679	37386	100222	transposase	Salmonella_phage(27.27%)	28	NA	NA
AVS24349.1|5679_8652_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AVS24350.1|8726_9017_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AVS24351.1|9013_9415_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AVS24352.1|9404_9761_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AVS24353.1|10015_10330_+	hypothetical protein	NA	NA	NA	NA	NA
AVS24354.1|10756_11938_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
AVS24355.1|12597_13203_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AVS24356.1|13426_14287_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVS24357.1|14986_15811_-	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
AVS24358.1|15870_16659_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AVS24437.1|16728_17283_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
AVS24359.1|17516_18074_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
AVS24360.1|18637_19900_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AVS24361.1|20155_21031_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AVS24362.1|21077_21410_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AVS24363.1|25671_26328_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
AVS24364.1|27107_28499_-|transposase	ISKra4 family transposase ISKpn19	transposase	NA	NA	NA	NA
AVS24365.1|28535_29108_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
AVS24366.1|29244_29835_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
AVS24367.1|30205_30985_+	APH(3')-VI family aminoglycoside O-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	34.7	6.9e-31
AVS24368.1|31136_32075_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.4	4.4e-48
AVS24369.1|32171_33203_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AVS24370.1|33417_34230_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
AVS24371.1|34233_34599_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
AVS24372.1|34603_35242_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AVS24373.1|35252_36284_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
AVS24374.1|36288_36618_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
AVS24375.1|36681_37386_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
>prophage 2
CP028178	Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_2, complete sequence	100222	86432	97668	100222	integrase,transposase	Stx2-converting_phage(30.0%)	11	86883:86895	98404:98416
AVS24442.1|86432_87110_-	resolvase	NA	I3WFA4	Macacine_betaherpesvirus	50.5	1.1e-21
86883:86895	attL	CGGCCGGGAACCG	NA	NA	NA	NA
AVS24424.1|87795_88044_-	XRE family transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	50.7	2.1e-10
AVS24425.1|89487_89919_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AVS24426.1|89918_91190_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	2.9e-151
AVS24427.1|91601_92477_+	replication initiation protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
AVS24428.1|92769_93147_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	90.5	7.9e-57
AVS24429.1|93143_93491_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
AVS24430.1|93540_95079_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	91.8	6.1e-273
AVS24431.1|95508_96135_+	cobyrinic acid ac-diamide synthase	NA	A0A222YXS3	Escherichia_phage	43.6	2.2e-40
AVS24432.1|96254_96434_+	Par-like protein	NA	NA	NA	NA	NA
AVS24433.1|96873_97668_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	87.8	1.2e-51
98404:98416	attR	CGGCCGGGAACCG	NA	NA	NA	NA
>prophage 1
CP028179	Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_3, complete sequence	38695	5604	15453	38695	transposase	Salmonella_phage(50.0%)	8	NA	NA
AVS24448.1|5604_7074_-	HNH endonuclease	NA	G0X580	Salmonella_phage	51.3	5.5e-21
AVS24449.1|7830_8400_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
AVS24484.1|8539_8821_-|transposase	transposase	transposase	NA	NA	NA	NA
AVS24450.1|8856_9561_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVS24451.1|9900_12867_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
AVS24452.1|12945_13950_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AVS24453.1|14131_14308_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AVS24454.1|14637_15453_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
>prophage 2
CP028179	Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_3, complete sequence	38695	19464	34858	38695	transposase,integrase	Escherichia_phage(50.0%)	19	23573:23586	35975:35988
AVS24461.1|19464_20169_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVS24485.1|20193_20706_+	restriction endonuclease	NA	NA	NA	NA	NA
AVS24462.1|20710_20917_+	hypothetical protein	NA	NA	NA	NA	NA
AVS24463.1|21298_22732_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AVS24464.1|22765_23974_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
23573:23586	attL	AATATTTACTTCCT	NA	NA	NA	NA
AVS24465.1|23986_24199_-	resolvase	NA	NA	NA	NA	NA
AVS24466.1|24240_25005_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AVS24467.1|25147_25414_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AVS24468.1|25634_26117_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	6.6e-16
AVS24469.1|26263_27277_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVS24470.1|27336_28041_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVS24471.1|28147_28831_+	DNA polymerase IV	NA	F1C5A5	Cronobacter_phage	64.7	3.5e-79
AVS24472.1|28912_29890_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
AVS24473.1|29886_31092_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
AVS24474.1|31506_31776_+	hypothetical protein	NA	NA	NA	NA	NA
AVS24475.1|31808_32006_-	hypothetical protein	NA	NA	NA	NA	NA
AVS24476.1|32132_32999_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AVS24477.1|33766_34024_+	hypothetical protein	NA	NA	NA	NA	NA
AVS24478.1|34081_34858_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
35975:35988	attR	AATATTTACTTCCT	NA	NA	NA	NA
