The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027701	Escherichia coli strain 675SK2 chromosome, complete genome	4889200	980830	1053670	4889200	protease,plate,tRNA,transposase	Emiliania_huxleyi_virus(11.11%)	60	NA	NA
AVR71858.1|980830_982183_+|protease	zinc metalloprotease RseP	protease	NA	NA	NA	NA
AVR71859.1|982212_984645_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AVR71860.1|984766_985252_+	chaperone protein Skp	NA	NA	NA	NA	NA
AVR71861.1|985255_986281_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AVR71862.1|986385_986841_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AVR71863.1|986844_987633_+	acyl-[acyl-carrier-protein]--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AVR71864.1|987632_988781_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AVR71865.1|988777_989374_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
AVR71866.1|989410_992893_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
AVR71867.1|992905_993865_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AVR71868.1|993963_996105_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
AVR71869.1|996161_996551_+	VOC family protein	NA	NA	NA	NA	NA
AVR71870.1|996615_997914_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AVR75425.1|997962_998217_-	protein rof	NA	NA	NA	NA	NA
AVR71871.1|998209_998410_-	hypothetical protein	NA	NA	NA	NA	NA
AVR71872.1|998575_999121_+	hypothetical protein	NA	NA	NA	NA	NA
AVR71873.1|999117_999540_+|tRNA	peptidyl-tRNA hydrolase ArfB	tRNA	NA	NA	NA	NA
AVR71874.1|999553_1000264_+	lipoprotein NlpE	NA	NA	NA	NA	NA
AVR71875.1|1000463_1001288_-	endopeptidase	NA	NA	NA	NA	NA
AVR71876.1|1001341_1003060_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AVR71877.1|1003171_1003879_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AVR71878.1|1003875_1004280_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
AVR71879.1|1004397_1005213_-	methionine ABC transporter substrate-binding protein MetQ	NA	NA	NA	NA	NA
AVR71880.1|1005252_1005906_-	methionine ABC transporter	NA	NA	NA	NA	NA
AVR71881.1|1005898_1006930_-	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
AVR71882.1|1007117_1007693_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AVR71883.1|1013451_1014255_+	2,5-diketo-D-gluconic acid reductase B	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
AVR71884.1|1014251_1015166_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVR71885.1|1015406_1016207_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AVR71886.1|1016210_1016834_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVR71887.1|1016881_1018240_-	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AVR71888.1|1018311_1019067_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AVR71889.1|1019100_1019823_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVR71890.1|1019819_1020287_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AVR75426.1|1020351_1021083_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
AVR71891.1|1021022_1021202_-	hypothetical protein	NA	NA	NA	NA	NA
AVR71892.1|1021619_1022405_+	hypothetical protein	NA	NA	NA	NA	NA
AVR71893.1|1022541_1023021_-	hypothetical protein	NA	NA	NA	NA	NA
AVR71894.1|1023030_1023945_-	hypothetical protein	NA	NA	NA	NA	NA
AVR71895.1|1023988_1024471_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AVR71896.1|1024494_1025847_-	hypothetical protein	NA	NA	NA	NA	NA
AVR71897.1|1025857_1029322_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AVR71898.1|1029400_1030879_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AVR71899.1|1030817_1031561_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AVR71900.1|1031557_1034323_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
AVR71901.1|1034331_1035093_-	hypothetical protein	NA	NA	NA	NA	NA
AVR71902.1|1035097_1036429_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVR71903.1|1036431_1036956_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AVR71904.1|1036952_1038233_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AVR71905.1|1038257_1039340_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVR71906.1|1039303_1041154_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVR71907.1|1041157_1041571_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AVR71908.1|1041577_1043053_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AVR71909.1|1043103_1043328_-	hypothetical protein	NA	NA	NA	NA	NA
AVR71910.1|1043362_1043863_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AVR71911.1|1044557_1045076_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AVR71912.1|1045108_1045246_+	hypothetical protein	NA	NA	NA	NA	NA
AVR71913.1|1045285_1047427_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
AVR71914.1|1051711_1051930_+	hypothetical protein	NA	NA	NA	NA	NA
AVR71915.1|1052533_1053670_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP027701	Escherichia coli strain 675SK2 chromosome, complete genome	4889200	1745295	1782518	4889200	integrase,protease,transposase	Stx2-converting_phage(42.86%)	31	1735032:1735047	1764451:1764466
1735032:1735047	attL	TCAATCAGCGTATCAG	NA	NA	NA	NA
AVR72543.1|1745295_1745616_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AVR72544.1|1745646_1747923_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AVR72545.1|1748440_1749643_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
AVR72546.1|1749828_1751646_-	hypothetical protein	NA	NA	NA	NA	NA
AVR72547.1|1752756_1753053_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AVR72548.1|1753297_1753495_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AVR72549.1|1753713_1754826_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AVR72550.1|1754985_1756098_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AVR72551.1|1757317_1757881_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AVR75452.1|1758555_1763514_+	nuclease	NA	NA	NA	NA	NA
AVR72552.1|1763510_1764947_+	hypothetical protein	NA	NA	NA	NA	NA
1764451:1764466	attR	TCAATCAGCGTATCAG	NA	NA	NA	NA
AVR75453.1|1765051_1765258_+	methyltransferase	NA	NA	NA	NA	NA
AVR72553.1|1765426_1767316_-	enterotoxin	NA	NA	NA	NA	NA
AVR72554.1|1767329_1768505_-	putative C-S lyase	NA	NA	NA	NA	NA
AVR72555.1|1768516_1770088_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
AVR72556.1|1770201_1770606_-	aldolase	NA	NA	NA	NA	NA
AVR72557.1|1770553_1770856_-	hypothetical protein	NA	NA	NA	NA	NA
AVR72558.1|1770788_1771613_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AVR72559.1|1771675_1772113_-	hypothetical protein	NA	NA	NA	NA	NA
AVR72560.1|1772194_1772830_-	galactonate dehydratase	NA	NA	NA	NA	NA
AVR72561.1|1773016_1773256_-	hypothetical protein	NA	NA	NA	NA	NA
AVR72562.1|1773432_1774660_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	2.7e-170
AVR75454.1|1774945_1775146_+	hypothetical protein	NA	NA	NA	NA	NA
AVR72563.1|1775273_1775372_+	acetolactate synthase	NA	NA	NA	NA	NA
AVR72564.1|1775373_1776156_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AVR72565.1|1776461_1777382_+	ribokinase	NA	NA	NA	NA	NA
AVR72566.1|1777409_1778726_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AVR72567.1|1778737_1779751_+	DUF4432 domain-containing protein	NA	NA	NA	NA	NA
AVR75455.1|1780205_1780586_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.2e-65
AVR72568.1|1780582_1780930_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	1.1e-60
AVR72569.1|1780979_1782518_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	7.1e-298
>prophage 3
CP027701	Escherichia coli strain 675SK2 chromosome, complete genome	4889200	2080263	2137615	4889200	tRNA,protease,transposase,terminase,holin,integrase,tail,head,capsid,portal	Escherichia_phage(43.48%)	66	2075358:2075372	2081838:2081852
2075358:2075372	attL	GATCGCGATGTACGC	NA	NA	NA	NA
AVR72834.1|2080263_2081382_-|integrase	integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
AVR72835.1|2081350_2081620_-	excisionase	NA	NA	NA	NA	NA
AVR72836.1|2081681_2084123_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
2081838:2081852	attR	GCGTACATCGCGATC	NA	NA	NA	NA
AVR72837.1|2084216_2084408_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVR72838.1|2084404_2084593_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AVR75470.1|2084942_2085197_+	hypothetical protein	NA	NA	NA	NA	NA
AVR72839.1|2085161_2085380_-	hypothetical protein	NA	NA	NA	NA	NA
AVR72840.1|2085451_2085751_-	hypothetical protein	NA	NA	NA	NA	NA
AVR72841.1|2085734_2085893_-	hypothetical protein	NA	NA	NA	NA	NA
AVR75471.1|2086104_2086629_-	LexA family transcriptional repressor	NA	H9C160	Pectobacterium_phage	28.0	2.2e-12
AVR72842.1|2087058_2087484_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AVR72843.1|2087555_2088626_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
AVR72844.1|2088666_2089089_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
AVR72845.1|2089146_2089503_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
AVR72846.1|2089596_2089779_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
AVR72847.1|2090431_2090611_+	hypothetical protein	NA	NA	NA	NA	NA
AVR72848.1|2090813_2091026_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
AVR72849.1|2091193_2091472_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
AVR72850.1|2091473_2092532_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
AVR72851.1|2092532_2092913_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
AVR72852.1|2092909_2093731_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
AVR72853.1|2094700_2094913_-	hypothetical protein	NA	NA	NA	NA	NA
AVR72854.1|2094983_2095319_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
AVR72855.1|2095579_2095768_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
AVR72856.1|2095764_2095926_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
AVR72857.1|2096075_2096291_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
AVR72858.1|2096295_2096646_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
AVR72859.1|2096709_2097243_+	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
AVR72860.1|2097179_2097407_-	hypothetical protein	NA	NA	NA	NA	NA
AVR72861.1|2097459_2097642_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
AVR72862.1|2097732_2098026_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
AVR72863.1|2098118_2098259_+	Rz1 lytic protein	NA	U5P461	Shigella_phage	84.6	1.0e-09
AVR72864.1|2098551_2098902_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
AVR72865.1|2099049_2099532_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
AVR72866.1|2099531_2101289_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
AVR72867.1|2101436_2102663_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
AVR72868.1|2102655_2103255_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
AVR72869.1|2103269_2104487_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
AVR72870.1|2104563_2104881_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
AVR72871.1|2104889_2105228_+|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
AVR72872.1|2105224_2105674_+	hypothetical protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
AVR72873.1|2105670_2106015_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
AVR72874.1|2106075_2106780_+|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
AVR72875.1|2106779_2107166_+|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
AVR75472.1|2107207_2107468_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
AVR72876.1|2107514_2110742_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
AVR72877.1|2110719_2111076_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
AVR72878.1|2111075_2111774_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
AVR72879.1|2111922_2112522_+	endopeptidase	NA	K7PLW1	Enterobacteria_phage	97.5	6.1e-120
AVR72880.1|2112419_2113067_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	2.6e-108
AVR72881.1|2113127_2116607_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
AVR72882.1|2116674_2117274_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	95.0	5.9e-107
AVR72883.1|2123043_2123415_+	hypothetical protein	NA	NA	NA	NA	NA
AVR72884.1|2124148_2124679_+	chaperone of endosialidase	NA	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
AVR72885.1|2124901_2126114_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
AVR75473.1|2126229_2126856_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVR72886.1|2127452_2128316_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AVR72887.1|2128299_2129436_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
AVR75474.1|2129414_2129630_-	hypothetical protein	NA	NA	NA	NA	NA
AVR72888.1|2129685_2130912_+	peptidase T	NA	NA	NA	NA	NA
AVR72889.1|2130960_2132082_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AVR72890.1|2132157_2133618_-	sensor protein PhoQ	NA	NA	NA	NA	NA
AVR72891.1|2133617_2134289_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AVR72892.1|2134457_2135828_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
AVR75475.1|2135831_2136473_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AVR72893.1|2136508_2137615_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 4
CP027701	Escherichia coli strain 675SK2 chromosome, complete genome	4889200	3049110	3055539	4889200		Escherichia_phage(33.33%)	6	NA	NA
AVR73724.1|3049110_3050277_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	7.0e-112
AVR73725.1|3050457_3051012_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	3.3e-51
AVR73726.1|3051026_3051917_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.6	5.6e-29
AVR73727.1|3051948_3052818_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	3.4e-111
AVR73728.1|3052844_3053909_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	7.5e-105
AVR73729.1|3054132_3055539_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 5
CP027701	Escherichia coli strain 675SK2 chromosome, complete genome	4889200	3143306	3150237	4889200	transposase	Enterobacteria_phage(66.67%)	9	NA	NA
AVR73787.1|3143306_3144004_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	98.7	1.1e-131
AVR73788.1|3144045_3144516_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	3.6e-75
AVR73789.1|3144555_3145026_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
AVR73790.1|3145072_3145792_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVR73791.1|3145788_3147474_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AVR73792.1|3147695_3148427_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AVR73793.1|3148486_3148594_+	hypothetical protein	NA	NA	NA	NA	NA
AVR73794.1|3148574_3149306_-	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AVR73795.1|3149310_3150237_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 6
CP027701	Escherichia coli strain 675SK2 chromosome, complete genome	4889200	3661062	3767517	4889200	lysis,tRNA,transposase,plate,terminase,tail,integrase,holin,head,capsid,portal	Erwinia_phage(21.57%)	109	3655370:3655385	3762876:3762891
3655370:3655385	attL	ATGCCAGCTTTTCACC	NA	NA	NA	NA
AVR74239.1|3661062_3662411_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.1	5.1e-74
AVR74240.1|3667991_3670565_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	1.2e-127
AVR74241.1|3670694_3671426_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AVR74242.1|3671422_3672403_-	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
AVR74243.1|3672537_3673275_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AVR74244.1|3673304_3673511_+	hypothetical protein	NA	NA	NA	NA	NA
AVR74245.1|3673545_3673887_+	ribosome-associated inhibitor A	NA	NA	NA	NA	NA
AVR75547.1|3673990_3674038_+	hypothetical protein	NA	NA	NA	NA	NA
AVR74246.1|3674136_3675297_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AVR74247.1|3675339_3676461_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AVR74248.1|3676471_3677542_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
AVR74249.1|3677751_3678117_+	hypothetical protein	NA	NA	NA	NA	NA
AVR74250.1|3678266_3678785_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AVR74251.1|3678774_3680001_+	diguanylate cyclase	NA	NA	NA	NA	NA
AVR74252.1|3680016_3680499_+	hypothetical protein	NA	NA	NA	NA	NA
AVR74253.1|3680575_3680923_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AVR74254.1|3680964_3681732_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AVR74255.1|3681762_3682311_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AVR74256.1|3682329_3682578_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AVR74257.1|3682826_3684188_-	signal recognition particle protein	NA	NA	NA	NA	NA
AVR75548.1|3684354_3685146_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AVR75549.1|3685211_3686453_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AVR74258.1|3686507_3687101_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AVR74259.1|3687097_3687292_-	molecular chaperone GrpE	NA	NA	NA	NA	NA
AVR74260.1|3687223_3688102_+	NAD(+) kinase	NA	NA	NA	NA	NA
AVR74261.1|3688187_3689849_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AVR74262.1|3689997_3690339_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AVR74263.1|3690400_3690691_-	RnfH family protein	NA	NA	NA	NA	NA
AVR74264.1|3690680_3691157_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AVR74265.1|3691288_3691771_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	5.2e-29
AVR74266.1|3696563_3697178_-	hypothetical protein	NA	NA	NA	NA	NA
AVR74267.1|3697146_3697266_-	ATPase	NA	NA	NA	NA	NA
AVR74268.1|3698015_3699470_-	hypothetical protein	NA	NA	NA	NA	NA
AVR74269.1|3700515_3701979_+	hypothetical protein	NA	NA	NA	NA	NA
AVR74270.1|3701989_3702994_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	97.6	2.2e-191
AVR74271.1|3702993_3703569_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	65.4	1.2e-67
AVR74272.1|3703701_3703965_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
AVR74273.1|3703995_3704505_+	hypothetical protein	NA	A0A0M4QWN1	Salmonella_phage	98.8	1.2e-89
AVR74274.1|3704512_3704740_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	92.0	1.6e-33
AVR74275.1|3704726_3704927_+	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	89.4	1.1e-28
AVR74276.1|3704996_3705224_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	90.7	2.3e-27
AVR74277.1|3705223_3705451_+	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	70.7	4.8e-25
AVR74278.1|3705447_3705756_+	DUF3850 domain-containing protein	NA	A0A1S6KVH3	Escherichia_phage	43.2	1.6e-07
AVR74279.1|3705769_3708010_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	92.5	0.0e+00
AVR75550.1|3708153_3708336_+	Tum protein	NA	A0A218M4I0	Erwinia_phage	75.9	3.2e-16
AVR74280.1|3708624_3708837_+	hypothetical protein	NA	NA	NA	NA	NA
AVR74281.1|3708833_3709841_+	hypothetical protein	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	28.0	1.9e-20
AVR74282.1|3710307_3711345_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	79.0	5.9e-163
AVR74283.1|3711344_3713114_-	oxidoreductase	NA	A0A0M4RE51	Salmonella_phage	80.5	1.9e-286
AVR74284.1|3713278_3714142_+|capsid	capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	66.2	3.4e-103
AVR74285.1|3714163_3715324_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	63.1	2.5e-130
AVR74286.1|3715327_3716086_+|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	66.3	1.3e-79
AVR74287.1|3716183_3716684_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	2.9e-59
AVR74288.1|3716683_3716887_+|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
AVR74289.1|3716877_3717099_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
AVR74290.1|3717082_3717592_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.6	4.6e-76
AVR74291.1|3717588_3718002_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	67.2	5.4e-43
AVR74292.1|3717901_3718147_+|holin	holin	holin	S4TNY4	Salmonella_phage	71.8	9.4e-27
AVR74293.1|3718109_3718577_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.7	1.7e-56
AVR74294.1|3718569_3719019_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	72.7	8.5e-50
AVR74295.1|3719024_3720110_-	hypothetical protein	NA	NA	NA	NA	NA
AVR74296.1|3720225_3720867_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	83.1	1.5e-95
AVR74297.1|3720863_3721211_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	71.3	4.3e-41
AVR74298.1|3721215_3722124_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	81.5	3.0e-134
AVR74299.1|3722116_3722728_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	83.1	1.8e-95
AVR74300.1|3723896_3724310_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	45.7	4.0e-22
AVR74301.1|3724441_3725629_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	80.5	2.6e-183
AVR74302.1|3725641_3726160_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	2.0e-71
AVR74303.1|3726222_3726504_+|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	79.1	4.7e-30
AVR74304.1|3726536_3726656_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	3.7e-13
AVR74305.1|3726648_3729078_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	67.8	7.6e-270
AVR74306.1|3729089_3729554_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	74.8	1.7e-61
AVR74307.1|3729556_3730750_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	78.4	1.3e-166
AVR74308.1|3730789_3731008_+	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	86.1	4.6e-33
AVR75551.1|3733044_3734052_+	alpha amylase	NA	NA	NA	NA	NA
AVR74309.1|3734387_3735365_+	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
AVR74310.1|3735384_3736653_+	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
AVR74311.1|3736675_3738124_+	NADP-dependent succinate-semialdehyde dehydrogenase I	NA	NA	NA	NA	NA
AVR74312.1|3738137_3739418_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	2.1e-32
AVR74313.1|3739655_3741056_+	GABA permease	NA	NA	NA	NA	NA
AVR74314.1|3741076_3741739_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
AVR74315.1|3741739_3742189_-	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	39.5	2.6e-06
AVR74316.1|3742272_3742431_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
AVR74317.1|3742613_3742913_+	transcriptional regulator	NA	NA	NA	NA	NA
AVR74318.1|3742922_3743447_+	rhodanese-like domain-containing protein YgaP	NA	NA	NA	NA	NA
AVR74319.1|3743493_3743898_-	DNA-binding protein StpA	NA	NA	NA	NA	NA
AVR74320.1|3744564_3745014_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
AVR74321.1|3745050_3745395_-	hypothetical protein	NA	NA	NA	NA	NA
AVR74322.1|3745546_3745876_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
AVR74323.1|3746123_3746369_+	NrdH-redoxin	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
AVR74324.1|3746365_3746767_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	3.4e-18
AVR74325.1|3746748_3748893_+	ribonucleotide-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	2.9e-196
AVR74326.1|3748902_3749862_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	7.0e-134
AVR74327.1|3749980_3750229_+	hypothetical protein	NA	NA	NA	NA	NA
AVR74328.1|3750218_3751421_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
AVR74329.1|3751413_3752478_+	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
AVR74330.1|3752535_3753528_+	proline/glycine betaine ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
AVR74331.1|3753980_3755165_+	MFS transporter	NA	NA	NA	NA	NA
AVR74332.1|3755288_3756026_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVR74333.1|3756015_3756351_+	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
AVR74334.1|3756441_3756972_+	transcriptional regulator	NA	NA	NA	NA	NA
AVR74335.1|3757098_3758271_+	multidrug export protein EmrA	NA	NA	NA	NA	NA
AVR74336.1|3758287_3759826_+	multidrug effux MFS transporter subunit EmrB	NA	NA	NA	NA	NA
AVR74337.1|3759889_3760405_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
AVR74338.1|3760554_3762111_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AVR74339.1|3762183_3762612_-	hypothetical protein	NA	NA	NA	NA	NA
AVR74340.1|3762608_3763175_-	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
3762876:3762891	attR	ATGCCAGCTTTTCACC	NA	NA	NA	NA
AVR74341.1|3764466_3764652_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AVR74342.1|3764886_3767517_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
>prophage 7
CP027701	Escherichia coli strain 675SK2 chromosome, complete genome	4889200	3803818	3810958	4889200		Escherichia_phage(83.33%)	6	NA	NA
AVR74377.1|3803818_3806380_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
AVR74378.1|3806485_3807142_+	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
AVR74379.1|3807192_3807960_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
AVR74380.1|3808155_3809064_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
AVR74381.1|3809060_3810323_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AVR74382.1|3810319_3810958_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 1
CP027703	Escherichia coli strain 675SK2 plasmid p675SK2_B, complete sequence	173882	22564	63344	173882	transposase,integrase	Escherichia_phage(42.86%)	43	54876:54935	67391:68211
AVR75611.1|22564_23587_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AVR75612.1|24666_25041_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	9.8e-60
AVR75613.1|25065_25770_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVR75752.1|27360_27915_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AVR75614.1|28058_28763_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVR75615.1|31411_32155_-	histidine-type phosphatase	NA	NA	NA	NA	NA
AVR75616.1|32276_32762_-	hypothetical protein	NA	NA	NA	NA	NA
AVR75617.1|32786_33341_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
AVR75618.1|33258_33954_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
AVR75619.1|33958_35119_-	ABC transporter permease	NA	NA	NA	NA	NA
AVR75620.1|35078_36362_-	ABC transporter permease	NA	NA	NA	NA	NA
AVR75621.1|36364_37744_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
AVR75622.1|37847_38375_-	iron transporter	NA	NA	NA	NA	NA
AVR75623.1|38415_40362_-	iron permease	NA	NA	NA	NA	NA
AVR75753.1|40304_40490_-	hypothetical protein	NA	NA	NA	NA	NA
AVR75624.1|40648_41464_-	NADH:ubiquinone reductase (Na(+)-transporting) subunit C	NA	NA	NA	NA	NA
AVR75625.1|41646_42153_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
AVR75626.1|42142_42370_-	scsC protein	NA	NA	NA	NA	NA
AVR75627.1|43511_44639_+|transposase	IS4 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.7	3.1e-218
AVR75628.1|45077_45746_+	putative tetracyline resistance transcriptional regulator TetC	NA	NA	NA	NA	NA
AVR75629.1|45858_47064_-	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
AVR75630.1|47142_47769_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVR75631.1|47746_48433_-	transcriptional regulator	NA	NA	NA	NA	NA
AVR75632.1|48440_48827_-	amino acid-binding protein	NA	NA	NA	NA	NA
AVR75633.1|48819_49083_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AVR75634.1|49810_50002_-	hypothetical protein	NA	NA	NA	NA	NA
AVR75635.1|50055_50715_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AVR75636.1|50915_51293_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVR75637.1|51359_54326_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AVR75754.1|54328_54889_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
54876:54935	attL	CGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
AVR75638.1|54939_55644_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVR75639.1|55842_56457_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AVR75640.1|56395_57409_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVR75755.1|57566_58040_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
AVR75641.1|58170_58959_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
AVR75642.1|59164_59512_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVR75643.1|59505_60345_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AVR75644.1|60274_60454_-	hypothetical protein	NA	NA	NA	NA	NA
AVR75645.1|60472_60676_+	hypothetical protein	NA	NA	NA	NA	NA
AVR75646.1|60831_62037_+	chromate transporter	NA	NA	NA	NA	NA
AVR75647.1|62047_62353_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AVR75648.1|62368_62551_-	resolvase	NA	NA	NA	NA	NA
AVR75756.1|62579_63344_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
67391:68211	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGTTTACTCATACCTAGATTCTACGTCAGTACTTCAAAAAGCATAATCAAAGCCTTGATAAATATGCATTCCTTCGAAATTCAGCTTTCACCCATTGGGTGAAAGAAAAGTGCTCAACATAAAATACTCGAAGAAGATTTAGGCATAGATGTATATTTCTGTGACCCACATTCACCCTGGCAAAAAGGCACATGCGAAAATATGAATGGTTTAATTAGGCAATATTTACCTAAAGGGATTGATTTAAATCAGGCAGATCAGCATTATTTAAATCAAGTTGCCATGTCACTGAATACTCGTCCTAGAAAGGCGTTAGATTGGCTTACACCATTAGAGAAATTTGCTCAGCTTGTTGATTATCATATGGCTTTTGAAACTGTCGCACCTCATGTTTGAATTCGCCCCATATTTTTGCTACAGTGAACCAAATTAAGATCATCTATTTACTAGGCCTCGCATTTGCGGGGTTTTTAATGCTGAATAAAAGGAAAACTTGATGGAATTGCCCAATATTATGCACCCGGTCGCGAAGCTGAGCACCGCATTAGCCGCTGCATTGATGCTGAGCGGGTGCATGCCCGGTGAAATCCGCCCGACGATTGGCCAGCAAATGGAAACTGGCGACCAACGGTTTGGCGATCTGGTTTTCCGCCAGCTCGCACCGAATGTCTGGCAGCACACTTCCTATCTCGACATGCCGGGTTTCGGGGCAGTCGCTTCCAACGGTTTGATCGTCAGGGATGGCGGCCGCGTGCTGTTGGTC	NA	NA	NA	NA
>prophage 2
CP027703	Escherichia coli strain 675SK2 plasmid p675SK2_B, complete sequence	173882	66681	98858	173882	transposase,protease	Escherichia_phage(28.57%)	35	NA	NA
AVR75652.1|66681_67386_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVR75653.1|67944_68757_+	subclass B1 metallo-beta-lactamase NDM-5	NA	NA	NA	NA	NA
AVR75654.1|69129_69768_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AVR75655.1|69778_70810_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
AVR75656.1|71122_72664_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVR75657.1|73068_73908_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AVR75658.1|73901_74249_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVR75659.1|74412_75204_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AVR75660.1|75611_76109_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AVR75661.1|76998_77703_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVR75662.1|78912_79017_-	hypothetical protein	NA	NA	NA	NA	NA
AVR75663.1|79013_79478_-	mRNA interferase PemK	NA	NA	NA	NA	NA
AVR75664.1|79697_80351_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVR75665.1|80540_80927_-	hypothetical protein	NA	NA	NA	NA	NA
AVR75666.1|81289_82147_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AVR75757.1|82139_82214_-	positive regulator of RepFIC repA1 expression	NA	NA	NA	NA	NA
AVR75667.1|82297_82408_+	replication protein RepA	NA	NA	NA	NA	NA
AVR75668.1|82448_82706_-	replication protein RepA	NA	NA	NA	NA	NA
AVR75669.1|83110_84133_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVR75670.1|84604_84958_+	hypothetical protein	NA	NA	NA	NA	NA
AVR75671.1|86786_87149_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	88.5	9.0e-34
AVR75672.1|87145_87496_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AVR75673.1|87526_87748_+	hypothetical protein	NA	NA	NA	NA	NA
AVR75674.1|88104_88584_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
AVR75675.1|88664_90068_-	YfcC family protein	NA	NA	NA	NA	NA
AVR75676.1|90115_91120_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AVR75677.1|91204_92116_-	carbamate kinase	NA	NA	NA	NA	NA
AVR75678.1|92155_93346_-	arginine deiminase	NA	NA	NA	NA	NA
AVR75758.1|95105_95180_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
AVR75679.1|95263_95380_+	replication protein RepA	NA	NA	NA	NA	NA
AVR75680.1|95415_95673_-	transcriptional regulator	NA	NA	NA	NA	NA
AVR75759.1|95956_96106_-	Hok/Gef family protein	NA	NA	NA	NA	NA
AVR75681.1|96161_96404_+	hypothetical protein	NA	NA	NA	NA	NA
AVR75682.1|96349_96583_-	hypothetical protein	NA	NA	NA	NA	NA
AVR75683.1|97286_98858_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	3.8e-169
