The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP020534	Vibrio anguillarum strain 425 chromosome 1, complete sequence	3164924	154743	231990	3164924	integrase,transposase	Leptospira_phage(38.1%)	59	207576:207589	232231:232244
AVT66790.1|154743_156285_-|transposase	IS66 family transposase ISVa5	transposase	S5VTP8	Leptospira_phage	38.9	1.9e-24
AVT66791.1|156344_156698_-	hypothetical protein	NA	S5VXZ8	Leptospira_phage	48.6	1.6e-14
AVT66792.1|156694_157012_-|transposase	transposase	transposase	NA	NA	NA	NA
AVT66793.1|157402_157546_-	DNA integration/recombination/inversion protein	NA	R9TMQ4	Vibrio_phage	76.2	1.7e-12
AVT66794.1|157723_158800_+	hypothetical protein	NA	A0A291AUQ0	Sinorhizobium_phage	23.0	1.2e-12
AVT66795.1|158802_160017_+	hypothetical protein	NA	NA	NA	NA	NA
AVT66796.1|160318_160636_+|transposase	transposase	transposase	NA	NA	NA	NA
AVT66797.1|160632_160986_+	hypothetical protein	NA	S5VXZ8	Leptospira_phage	48.6	1.6e-14
AVT66798.1|161045_162587_+|transposase	IS66 family transposase ISVa5	transposase	S5VTP8	Leptospira_phage	38.9	1.9e-24
AVT66799.1|162926_163400_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66800.1|163627_164548_-|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	100.0	1.7e-177
AVT66801.1|165049_168655_+	DNA-binding protein	NA	NA	NA	NA	NA
AVT66802.1|168934_169387_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66803.1|170604_171525_-|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	100.0	1.7e-177
AVT66804.1|171555_171741_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66805.1|171777_172536_-|integrase	integrase	integrase	NA	NA	NA	NA
AVT66806.1|172545_174234_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66807.1|174230_175433_-|integrase	integrase	integrase	NA	NA	NA	NA
AVT66808.1|175521_176874_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
AVT66809.1|176984_177824_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
AVT66810.1|178029_180072_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.7	2.1e-42
AVT66811.1|180228_182403_+	DNA-dependent helicase II	NA	A7KV33	Bacillus_phage	37.2	7.9e-117
AVT66812.1|183186_183846_-	threonine transporter	NA	NA	NA	NA	NA
AVT66813.1|183919_184735_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVT66814.1|184846_185764_-	EamA family transporter	NA	NA	NA	NA	NA
AVT66815.1|186015_187854_+	DNA helicase RecQ	NA	J2YAJ8	Acanthamoeba_polyphaga_lentillevirus	36.1	1.2e-81
AVT66816.1|187846_188149_+	aminopeptidase	NA	NA	NA	NA	NA
AVT66817.1|188239_188602_+	hypothetical protein	NA	NA	NA	NA	NA
AVT66818.1|188607_189456_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVT66819.1|189697_190600_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AVT66820.1|190629_192078_+	PTS N-acetylmuramic acid transporter subunits IIBC	NA	NA	NA	NA	NA
AVT66821.1|192222_194055_-	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	1.1e-29
AVT66822.1|194198_196295_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AVT66823.1|196301_197186_+	ABC transporter	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.2	6.4e-09
AVT66824.1|197176_198103_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVT66825.1|198099_200067_+	Fe3+-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
AVT66826.1|200974_201895_-|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	100.0	1.7e-177
AVT66827.1|201990_204783_+	peptidase M16	NA	NA	NA	NA	NA
AVT66828.1|205120_208009_+	hypothetical protein	NA	NA	NA	NA	NA
207576:207589	attL	ATGTCGGTGCTGAT	NA	NA	NA	NA
AVT66829.1|209508_209826_+|transposase	transposase	transposase	NA	NA	NA	NA
AVT66830.1|209822_210176_+	hypothetical protein	NA	S5VXZ8	Leptospira_phage	48.6	1.6e-14
AVT66831.1|210235_211777_+|transposase	IS66 family transposase ISVa5	transposase	S5VTP8	Leptospira_phage	38.9	1.9e-24
AVT66832.1|214520_215255_-	peptidase	NA	NA	NA	NA	NA
AVT66833.1|215401_216943_-|transposase	IS66 family transposase ISVa5	transposase	S5VTP8	Leptospira_phage	38.9	1.9e-24
AVT66834.1|217002_217356_-	hypothetical protein	NA	S5VXZ8	Leptospira_phage	48.6	1.6e-14
AVT66835.1|217352_217670_-|transposase	transposase	transposase	NA	NA	NA	NA
AVT66836.1|218158_218392_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66837.1|218378_218627_-	DNA-binding protein	NA	NA	NA	NA	NA
AVT66838.1|218780_220892_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66839.1|220888_221284_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66840.1|221346_221931_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66841.1|222308_222878_+	hypothetical protein	NA	NA	NA	NA	NA
AVT66842.1|223283_223520_+	hypothetical protein	NA	NA	NA	NA	NA
AVT66843.1|223516_224254_+	hypothetical protein	NA	A0A1J0GVN3	Pseudoalteromonas_phage	34.5	2.0e-08
AVT66844.1|224255_224963_+	replication protein P	NA	B5WZY0	Pseudomonas_phage	41.2	2.4e-38
AVT66845.1|225772_226162_+	hypothetical protein	NA	NA	NA	NA	NA
AVT66846.1|226173_226530_+	hypothetical protein	NA	NA	NA	NA	NA
AVT66847.1|226516_228493_+	hypothetical protein	NA	NA	NA	NA	NA
AVT66848.1|230772_231990_-|integrase	integrase	integrase	A0A1W6JPG6	Morganella_phage	36.7	4.6e-66
232231:232244	attR	ATGTCGGTGCTGAT	NA	NA	NA	NA
>prophage 2
CP020534	Vibrio anguillarum strain 425 chromosome 1, complete sequence	3164924	257411	264330	3164924		Enterobacteria_phage(50.0%)	7	NA	NA
AVT66876.1|257411_258353_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	36.8	4.3e-35
AVT66877.1|258613_259678_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.6	1.6e-102
AVT66878.1|259701_260580_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.9	4.9e-110
AVT66879.1|260576_261464_+	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	35.7	1.9e-37
AVT66880.1|261466_262012_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.5	4.5e-53
AVT66881.1|262168_262975_+	teichoic acid ABC transporter permease	NA	NA	NA	NA	NA
AVT66882.1|262989_264330_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.4	2.3e-10
>prophage 3
CP020534	Vibrio anguillarum strain 425 chromosome 1, complete sequence	3164924	786841	793465	3164924		Staphylococcus_phage(66.67%)	7	NA	NA
AVT67338.1|786841_787981_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.3	7.6e-63
AVT67339.1|787994_789245_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	48.7	7.3e-99
AVT67340.1|789376_789826_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AVT67341.1|789832_790930_+	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.8	8.7e-48
AVT67342.1|790931_791588_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.5	5.1e-35
AVT67343.1|791676_792786_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.3	9.7e-63
AVT67344.1|792994_793465_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.0	8.4e-32
>prophage 4
CP020534	Vibrio anguillarum strain 425 chromosome 1, complete sequence	3164924	1246798	1347586	3164924	portal,tRNA,head,transposase,tail,integrase,capsid,terminase	Vibrio_phage(90.8%)	118	1246807:1246822	1273087:1273102
AVT67756.1|1246798_1248340_-|transposase	IS66 family transposase ISVa5	transposase	S5VTP8	Leptospira_phage	38.9	1.9e-24
1246807:1246822	attL	TGAAGTTCCAAGGTAG	NA	NA	NA	NA
AVT67757.1|1248399_1248753_-	hypothetical protein	NA	S5VXZ8	Leptospira_phage	48.6	1.6e-14
AVT67758.1|1248749_1249067_-|transposase	transposase	transposase	NA	NA	NA	NA
AVT67759.1|1249170_1249752_-	hypothetical protein	NA	NA	NA	NA	NA
AVT67760.1|1249901_1252337_+	histidine kinase	NA	A0A1V0SGX0	Hokovirus	33.6	4.0e-53
AVT67761.1|1252574_1253024_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
AVT67762.1|1253600_1254839_+|integrase	integrase	integrase	A0A1V0E8G8	Vibrio_phage	100.0	4.2e-240
AVT67763.1|1254835_1255033_-	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	100.0	1.0e-28
AVT67764.1|1255073_1255256_-	hypothetical protein	NA	A0A1V0E8F6	Vibrio_phage	100.0	1.3e-25
AVT67765.1|1255245_1255542_-	hypothetical protein	NA	A0A1V0E8G7	Vibrio_phage	100.0	2.3e-56
AVT67766.1|1255617_1256043_-	hypothetical protein	NA	A0A1V0E8F1	Vibrio_phage	100.0	1.6e-74
AVT69382.1|1256044_1256296_-	hypothetical protein	NA	A0A1V0E8F8	Vibrio_phage	100.0	3.4e-40
AVT67767.1|1256351_1256567_-	hypothetical protein	NA	A0A1V0E8G0	Vibrio_phage	100.0	2.5e-23
AVT67768.1|1256568_1256964_-	hypothetical protein	NA	A0A1V0E8D9	Vibrio_phage	100.0	2.4e-72
AVT67769.1|1256953_1257646_-	hypothetical protein	NA	A0A1V0E8D0	Vibrio_phage	100.0	9.5e-125
AVT67770.1|1257638_1258016_-	hypothetical protein	NA	A0A1V0E8D4	Vibrio_phage	100.0	6.2e-70
AVT67771.1|1258016_1258265_-	hypothetical protein	NA	A0A1V0E8F5	Vibrio_phage	98.8	1.0e-41
AVT67772.1|1258254_1258689_-	hypothetical protein	NA	A0A1V0E8D7	Vibrio_phage	100.0	1.2e-80
AVT67773.1|1258699_1259392_-	hypothetical protein	NA	A0A1V0E8E6	Vibrio_phage	100.0	8.0e-140
AVT67774.1|1259632_1260553_-|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	100.0	1.7e-177
AVT67775.1|1261379_1261742_-	hypothetical protein	NA	A0A1V0E8D2	Vibrio_phage	100.0	1.2e-59
AVT67776.1|1261774_1262197_-	hypothetical protein	NA	A0A1V0E8C3	Vibrio_phage	100.0	2.3e-73
AVT67777.1|1262238_1262727_-	hypothetical protein	NA	A0A1V0E8C4	Vibrio_phage	99.4	5.9e-89
AVT67778.1|1262760_1263030_-	hypothetical protein	NA	A0A1V0E8E7	Vibrio_phage	100.0	1.0e-42
AVT69383.1|1263022_1263865_-	hypothetical protein	NA	A0A1V0E8C5	Vibrio_phage	99.6	4.8e-163
AVT67779.1|1263884_1264094_-	hypothetical protein	NA	A0A1V0E8D5	Vibrio_phage	100.0	2.4e-31
AVT67780.1|1264096_1264681_-	hypothetical protein	NA	A0A1V0E8E4	Vibrio_phage	100.0	7.8e-112
AVT67781.1|1264677_1264929_-	hypothetical protein	NA	A0A1V0E8D1	Vibrio_phage	100.0	3.2e-38
AVT67782.1|1264960_1265218_-	hypothetical protein	NA	A0A1V0E8D8	Vibrio_phage	100.0	9.5e-38
AVT67783.1|1265217_1265733_-	hypothetical protein	NA	A0A1V0E8E0	Vibrio_phage	100.0	1.6e-97
AVT67784.1|1265735_1266731_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	100.0	2.3e-188
AVT67785.1|1268225_1268639_-	hypothetical protein	NA	A0A1V0E8D6	Vibrio_phage	100.0	1.0e-73
AVT67786.1|1268654_1269326_-	LexA family transcriptional repressor	NA	A0A1V0E8B5	Vibrio_phage	100.0	5.4e-125
AVT67787.1|1269437_1269647_+	transcriptional regulator	NA	A0A1V0E8C7	Vibrio_phage	100.0	1.3e-32
AVT67788.1|1269692_1269950_+	hypothetical protein	NA	A0A1V0E8D3	Vibrio_phage	100.0	1.1e-38
AVT67789.1|1269994_1270630_+	phage N-6-adenine-methyltransferase	NA	A0A1V0E8C8	Vibrio_phage	100.0	4.1e-106
AVT67790.1|1270626_1270914_+	hypothetical protein	NA	A0A1V0E8C9	Vibrio_phage	100.0	9.2e-50
AVT67791.1|1270906_1271875_+	helix-turn-helix domain-containing protein	NA	A0A1V0E831	Vibrio_phage	100.0	1.1e-158
AVT69384.1|1271888_1272089_+	hypothetical protein	NA	A0A1V0E856	Vibrio_phage	100.0	1.6e-24
AVT67792.1|1272090_1272786_+	DNA-binding protein	NA	A0A1V0E838	Vibrio_phage	100.0	4.7e-124
AVT67793.1|1272782_1273022_+	hypothetical protein	NA	A0A1V0E850	Vibrio_phage	100.0	4.2e-40
AVT67794.1|1273021_1273234_+	hypothetical protein	NA	A0A1V0E854	Vibrio_phage	100.0	1.2e-33
1273087:1273102	attR	CTACCTTGGAACTTCA	NA	NA	NA	NA
AVT67795.1|1273223_1273430_+	hypothetical protein	NA	A0A1V0E836	Vibrio_phage	100.0	9.3e-28
AVT67796.1|1273422_1273752_+	hypothetical protein	NA	A0A1V0E853	Vibrio_phage	100.0	4.9e-55
AVT67797.1|1273744_1274236_+	hypothetical protein	NA	A0A1V0E852	Vibrio_phage	100.0	4.6e-89
AVT67798.1|1274232_1274475_+	hypothetical protein	NA	A0A1V0E827	Vibrio_phage	100.0	3.7e-36
AVT67799.1|1274483_1274774_+	nucleoside 2-deoxyribosyltransferase	NA	A0A1V0E824	Vibrio_phage	100.0	3.4e-52
AVT67800.1|1274767_1275775_+	hypothetical protein	NA	A0A1V0E819	Vibrio_phage	100.0	1.3e-199
AVT67801.1|1275822_1276083_+	hypothetical protein	NA	A0A1U9GY50	Vibrio_phage	100.0	3.4e-43
AVT67802.1|1276137_1276335_-	hypothetical protein	NA	A0A1V0E828	Vibrio_phage	100.0	6.8e-28
AVT67803.1|1276331_1276763_-	hypothetical protein	NA	A0A1V0E842	Vibrio_phage	100.0	2.3e-81
AVT67804.1|1276993_1277662_+	hypothetical protein	NA	A0A1V0E841	Vibrio_phage	100.0	1.5e-122
AVT67805.1|1277782_1277974_+	hypothetical protein	NA	A0A1V1FD92	Vibrio_phage	100.0	1.9e-19
AVT67806.1|1278480_1278969_+	hypothetical protein	NA	A0A1V0E843	Vibrio_phage	99.3	1.5e-71
AVT67807.1|1279516_1279729_+	hypothetical protein	NA	A0A1V0E8A4	Vibrio_phage	100.0	6.8e-34
AVT67808.1|1279725_1279953_+	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	100.0	8.4e-38
AVT67809.1|1280121_1280358_+	hypothetical protein	NA	A0A1V0E8C6	Vibrio_phage	100.0	8.4e-33
AVT67810.1|1280357_1280717_+	HNH endonuclease	NA	A0A1V0E8A5	Vibrio_phage	100.0	4.8e-64
AVT67811.1|1280723_1281197_+|terminase	terminase	terminase	A0A1V0E8B7	Vibrio_phage	100.0	1.1e-87
AVT67812.1|1281193_1282912_+|terminase	terminase	terminase	A0A1V0E8C2	Vibrio_phage	100.0	0.0e+00
AVT67813.1|1282908_1283115_+	hypothetical protein	NA	A0A1V0E8A8	Vibrio_phage	98.0	1.8e-18
AVT67814.1|1283114_1284425_+|portal	phage portal protein	portal	A0A1V0E8B9	Vibrio_phage	100.0	2.7e-253
AVT67815.1|1284427_1285300_+	peptidase	NA	A0A1V0E8B8	Vibrio_phage	100.0	1.0e-160
AVT67816.1|1285302_1286490_+|capsid	capsid protein	capsid	A0A1V0E898	Vibrio_phage	100.0	8.5e-198
AVT67817.1|1286948_1287257_+	hypothetical protein	NA	A0A1V0E887	Vibrio_phage	100.0	1.2e-50
AVT67818.1|1287256_1287625_+|head,tail	phage head-tail adapter protein	head,tail	A0A1V0E8B6	Vibrio_phage	100.0	1.7e-64
AVT67819.1|1287626_1288094_+	hypothetical protein	NA	A0A1V0E895	Vibrio_phage	100.0	7.4e-81
AVT67820.1|1288090_1288459_+	hypothetical protein	NA	A0A1V0E8A7	Vibrio_phage	100.0	9.6e-68
AVT67821.1|1288554_1289031_+|tail	phage tail protein	tail	A0A1V0E8B3	Vibrio_phage	100.0	3.0e-85
AVT67822.1|1289041_1289485_+	hypothetical protein	NA	A0A1V0E823	Vibrio_phage	100.0	6.4e-74
AVT69385.1|1289784_1292664_+|tail	phage tail tape measure protein	tail	A0A1V0E821	Vibrio_phage	100.0	0.0e+00
AVT67823.1|1292666_1293005_+|tail	phage tail protein	tail	A0A1V0E890	Vibrio_phage	100.0	1.4e-60
AVT67824.1|1293018_1293765_+|tail	phage minor tail protein L	tail	A0A1V0E876	Vibrio_phage	100.0	9.8e-144
AVT67825.1|1293767_1294514_+	peptidase P60	NA	A0A1V0E882	Vibrio_phage	100.0	8.9e-153
AVT67826.1|1295788_1296118_+	zinc ribbon domain-containing protein	NA	A0A1V0E899	Vibrio_phage	100.0	2.1e-58
AVT67827.1|1296188_1296788_+|tail	phage tail protein	tail	A0A1V0E8A0	Vibrio_phage	100.0	1.2e-102
AVT67828.1|1296797_1300328_+|tail	phage tail protein	tail	A0A1V0E886	Vibrio_phage	100.0	0.0e+00
AVT67829.1|1300324_1301419_+	hypothetical protein	NA	A0A1V0E897	Vibrio_phage	100.0	6.6e-213
AVT67830.1|1301615_1303262_+	hypothetical protein	NA	A0A1V0E7U1	Vibrio_phage	100.0	3.8e-289
AVT67831.1|1303261_1303792_+	hypothetical protein	NA	A0A1V0E872	Vibrio_phage	100.0	4.9e-97
AVT67832.1|1303879_1304542_+	hypothetical protein	NA	A0A1V0E868	Vibrio_phage	100.0	2.0e-119
AVT67833.1|1304543_1305155_+	hypothetical protein	NA	A0A1V0E8A2	Vibrio_phage	100.0	3.5e-107
AVT67834.1|1305151_1305400_+	hypothetical protein	NA	A0A1V0E877	Vibrio_phage	100.0	6.8e-41
AVT67835.1|1305396_1306347_+	hypothetical protein	NA	A0A1V0E894	Vibrio_phage	100.0	2.0e-181
AVT67836.1|1306349_1307162_+	hypothetical protein	NA	A0A1V0E892	Vibrio_phage	100.0	7.6e-158
AVT67837.1|1307605_1308640_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVT67838.1|1308636_1309977_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.5	2.7e-11
AVT67839.1|1310062_1311580_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AVT67840.1|1311591_1311846_-	hypothetical protein	NA	NA	NA	NA	NA
AVT67841.1|1311874_1312768_-	1-aminocyclopropane-1-carboxylate deaminase	NA	NA	NA	NA	NA
AVT67842.1|1313216_1313843_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVT67843.1|1313898_1316181_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVT67844.1|1316358_1317561_+	trans-2-enoyl-CoA reductase	NA	NA	NA	NA	NA
AVT67845.1|1317683_1318082_-	hypothetical protein	NA	NA	NA	NA	NA
AVT67846.1|1318411_1318594_-	hypothetical protein	NA	NA	NA	NA	NA
AVT67847.1|1318766_1319744_-	hypothetical protein	NA	NA	NA	NA	NA
AVT67848.1|1319849_1320533_-	transcriptional regulator	NA	NA	NA	NA	NA
AVT67849.1|1320660_1321350_-	chemotaxis protein CheX	NA	NA	NA	NA	NA
AVT67850.1|1321625_1324661_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AVT67851.1|1324711_1325203_+	hypothetical protein	NA	NA	NA	NA	NA
AVT69386.1|1325344_1326070_-	hypothetical protein	NA	NA	NA	NA	NA
AVT67852.1|1326179_1327712_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.8	1.6e-87
AVT67853.1|1327723_1329421_-	urocanate hydratase	NA	NA	NA	NA	NA
AVT67854.1|1329498_1330512_-	formimidoylglutamase	NA	NA	NA	NA	NA
AVT67855.1|1330504_1331719_-	imidazolonepropionase	NA	NA	NA	NA	NA
AVT67856.1|1331846_1332647_-	histidine utilization repressor	NA	NA	NA	NA	NA
AVT67857.1|1332808_1333153_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
AVT67858.1|1333251_1333572_-	hypothetical protein	NA	NA	NA	NA	NA
AVT67859.1|1333574_1334141_-	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
AVT67860.1|1334275_1335043_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AVT67861.1|1335067_1337446_-	DNA polymerase II	NA	A0A0N7KVW0	Yellowstone_lake_phycodnavirus	25.8	8.3e-35
AVT69387.1|1337912_1338557_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVT67862.1|1338556_1340389_+	excinuclease ABC subunit C	NA	NA	NA	NA	NA
AVT67863.1|1340435_1340993_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AVT67864.1|1342438_1343416_+	porin	NA	NA	NA	NA	NA
AVT67865.1|1343500_1343983_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVT67866.1|1344198_1345182_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.7	2.1e-37
AVT67867.1|1345198_1347586_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	23.9	7.3e-07
>prophage 5
CP020534	Vibrio anguillarum strain 425 chromosome 1, complete sequence	3164924	2417252	2424323	3164924		Megavirus(16.67%)	9	NA	NA
AVT68755.1|2417252_2417678_-	nucleoside-diphosphate kinase	NA	K7YW26	Megavirus	41.4	2.7e-21
AVT68756.1|2417750_2419046_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.5	1.1e-33
AVT68757.1|2419230_2419425_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AVT68758.1|2419475_2419814_-	ferredoxin, 2Fe-2S type, ISC system	NA	NA	NA	NA	NA
AVT68759.1|2419825_2421679_-	molecular chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.4	3.2e-111
AVT68760.1|2421700_2422216_-	co-chaperone HscB	NA	NA	NA	NA	NA
AVT68761.1|2422282_2422606_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	53.3	3.6e-26
AVT68762.1|2422668_2423052_-	iron-sulfur cluster scaffold-like protein	NA	A0A218MKD1	uncultured_virus	78.2	1.8e-53
AVT68763.1|2423108_2424323_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.4	2.4e-30
>prophage 6
CP020534	Vibrio anguillarum strain 425 chromosome 1, complete sequence	3164924	2673467	2736966	3164924	tRNA,integrase,transposase	uncultured_Mediterranean_phage(10.0%)	60	2693032:2693076	2739555:2739599
AVT68955.1|2673467_2674358_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.1	1.5e-58
AVT68956.1|2674600_2677189_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.2	1.3e-36
AVT68957.1|2677305_2678307_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.8	3.5e-35
AVT69413.1|2678379_2679312_-	hypothetical protein	NA	I3PV79	Clostridium_phage	32.8	5.9e-13
AVT68958.1|2679317_2679944_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.9	8.0e-38
AVT68959.1|2679943_2680690_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	54.5	1.0e-68
AVT68960.1|2680702_2681800_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
AVT68961.1|2681954_2682440_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
AVT68962.1|2682432_2683164_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AVT68963.1|2683164_2683461_-	cell division protein FtsB	NA	NA	NA	NA	NA
AVT68964.1|2683575_2684379_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AVT68965.1|2684391_2684883_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AVT68966.1|2684879_2685233_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
AVT68967.1|2685420_2686023_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AVT68968.1|2686134_2686983_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
AVT68969.1|2687118_2688135_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	3.7e-109
AVT68970.1|2688375_2688591_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVT68971.1|2688620_2689064_+|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	43.8	1.3e-23
AVT68972.1|2689159_2690902_+	DNA primase	NA	A0A1S5RG58	Helicobacter_phage	30.9	3.8e-45
AVT68973.1|2691000_2692857_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.2	1.2e-33
2693032:2693076	attL	CTCATAATCGATTGGTCCCCAGTTCAAGTCTGGGAGGGGCCACCA	NA	NA	NA	NA
AVT68974.1|2693411_2693747_+	transcriptional regulator	NA	NA	NA	NA	NA
AVT68975.1|2693739_2695146_+	HIPA protein	NA	NA	NA	NA	NA
AVT68976.1|2695360_2695753_+	hypothetical protein	NA	NA	NA	NA	NA
AVT68977.1|2695742_2696873_+	hypothetical protein	NA	NA	NA	NA	NA
AVT68978.1|2696922_2697735_-	hypothetical protein	NA	NA	NA	NA	NA
AVT68979.1|2697915_2699562_-	DNA helicase UvrD	NA	A0A068EQC7	Bacillus_phage	24.0	3.3e-14
AVT68980.1|2699558_2700182_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AVT68981.1|2701724_2703500_+	hypothetical protein	NA	NA	NA	NA	NA
AVT68982.1|2703502_2704498_+	hypothetical protein	NA	NA	NA	NA	NA
AVT68983.1|2704795_2706238_+	hypothetical protein	NA	NA	NA	NA	NA
AVT69414.1|2706610_2707201_-	resolvase	NA	A0A219Y9V9	Aeromonas_phage	34.8	3.0e-18
AVT68984.1|2707823_2708111_-	hypothetical protein	NA	NA	NA	NA	NA
AVT68985.1|2708695_2709235_+	hypothetical protein	NA	NA	NA	NA	NA
AVT68986.1|2709517_2709856_+	hypothetical protein	NA	NA	NA	NA	NA
AVT68987.1|2709852_2710173_-	transcriptional regulator	NA	NA	NA	NA	NA
AVT68988.1|2712382_2712769_+	transcriptional regulator	NA	NA	NA	NA	NA
AVT68989.1|2712848_2713142_-	hypothetical protein	NA	NA	NA	NA	NA
AVT68990.1|2713519_2715052_+|transposase	transposase	transposase	K4I413	Acidithiobacillus_phage	42.4	2.9e-110
AVT68991.1|2715063_2715804_+|transposase	transposase	transposase	K4HZD4	Acidithiobacillus_phage	42.7	1.3e-47
AVT68992.1|2715984_2716761_+	serine/threonine protein phosphatase	NA	A0A285PXQ5	Cedratvirus	27.9	3.5e-11
AVT68993.1|2717051_2717267_+	hypothetical protein	NA	NA	NA	NA	NA
AVT68994.1|2717239_2718607_-|integrase	integrase	integrase	A0A248SL35	Klebsiella_phage	31.3	1.9e-39
AVT68995.1|2719768_2720353_-	hypothetical protein	NA	NA	NA	NA	NA
AVT68996.1|2720291_2721314_-	hypothetical protein	NA	NA	NA	NA	NA
AVT68997.1|2721476_2721866_+	hypothetical protein	NA	NA	NA	NA	NA
AVT68998.1|2721858_2723061_+|integrase	integrase	integrase	Q7Y5X7	Haemophilus_phage	32.8	3.9e-17
AVT68999.1|2723101_2723467_-	hypothetical protein	NA	NA	NA	NA	NA
AVT69000.1|2723467_2724538_-	mRNA endoribonuclease LS	NA	NA	NA	NA	NA
AVT69001.1|2725691_2726477_+	hypothetical protein	NA	NA	NA	NA	NA
AVT69002.1|2726469_2727597_+	XRE family transcriptional regulator	NA	B6SBZ6	Clostridium_virus	33.0	2.8e-33
AVT69003.1|2727660_2727933_-	hypothetical protein	NA	NA	NA	NA	NA
AVT69004.1|2728062_2728617_-	hypothetical protein	NA	NA	NA	NA	NA
AVT69005.1|2728765_2729299_-	hypothetical protein	NA	NA	NA	NA	NA
AVT69006.1|2730670_2732110_-	ATP-binding protein	NA	NA	NA	NA	NA
AVT69007.1|2732106_2733018_-	DNA polymerase I	NA	NA	NA	NA	NA
AVT69008.1|2733189_2733984_-	hypothetical protein	NA	NA	NA	NA	NA
AVT69009.1|2734263_2734512_-	hypothetical protein	NA	NA	NA	NA	NA
AVT69010.1|2734697_2735015_+|transposase	transposase	transposase	NA	NA	NA	NA
AVT69011.1|2735011_2735365_+	hypothetical protein	NA	S5VXZ8	Leptospira_phage	48.6	1.6e-14
AVT69012.1|2735424_2736966_+|transposase	IS66 family transposase ISVa5	transposase	S5VTP8	Leptospira_phage	38.9	1.9e-24
2739555:2739599	attR	CTCATAATCGATTGGTCCCCAGTTCAAGTCTGGGAGGGGCCACCA	NA	NA	NA	NA
>prophage 7
CP020534	Vibrio anguillarum strain 425 chromosome 1, complete sequence	3164924	3053475	3088659	3164924	protease,tRNA,transposase,integrase	Leptospira_phage(28.57%)	32	3046513:3046526	3093443:3093456
3046513:3046526	attL	CAAGAGAAATCACT	NA	NA	NA	NA
AVT69260.1|3053475_3055665_-|integrase	integrase	integrase	NA	NA	NA	NA
AVT69261.1|3055676_3058136_-	hypothetical protein	NA	NA	NA	NA	NA
AVT69423.1|3058140_3059550_-|integrase	integrase	integrase	NA	NA	NA	NA
AVT69262.1|3059902_3061012_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
AVT69263.1|3061051_3061243_-	hypothetical protein	NA	NA	NA	NA	NA
AVT69264.1|3061696_3064798_+	beta-D-galactosidase	NA	L0N6M2	Herpes_simplex_virus	52.4	3.4e-307
AVT69265.1|3064957_3065335_-	hypothetical protein	NA	NA	NA	NA	NA
AVT69424.1|3065334_3065976_-	DNA-binding transcriptional regulator FabR	NA	NA	NA	NA	NA
AVT69266.1|3066262_3067663_+	NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
AVT69267.1|3067766_3069110_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AVT69268.1|3069172_3069991_-	methyltransferase	NA	NA	NA	NA	NA
AVT69269.1|3070085_3070709_-	repressor LexA	NA	A5LH73	Enterobacteria_phage	44.0	2.0e-09
AVT69270.1|3071028_3073452_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AVT69271.1|3073512_3074367_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AVT69272.1|3074363_3074918_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AVT69273.1|3075154_3075562_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
AVT69274.1|3075594_3076428_-|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
AVT69275.1|3076436_3076757_-	thiosulfate sulfurtransferase	NA	NA	NA	NA	NA
AVT69276.1|3077153_3078011_-	RNA polymerase factor sigma-32	NA	A0A248SJA5	Salicola_phage	38.7	1.5e-42
AVT69277.1|3078186_3079155_-	ABC transporter permease	NA	NA	NA	NA	NA
AVT69278.1|3079144_3079819_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	3.9e-14
AVT69279.1|3079881_3081060_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
AVT69425.1|3081266_3081866_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
AVT69280.1|3081862_3082129_+	hypothetical protein	NA	NA	NA	NA	NA
AVT69281.1|3082204_3082588_-	antibiotic resistance protein MarC	NA	NA	NA	NA	NA
AVT69282.1|3082700_3083864_+	hypothetical protein	NA	NA	NA	NA	NA
AVT69283.1|3083860_3084781_-|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	100.0	1.7e-177
AVT69284.1|3084894_3085200_+	hypothetical protein	NA	NA	NA	NA	NA
AVT69285.1|3085196_3086339_+	hypothetical protein	NA	NA	NA	NA	NA
AVT69286.1|3086390_3086708_+|transposase	transposase	transposase	NA	NA	NA	NA
AVT69287.1|3086704_3087058_+	hypothetical protein	NA	S5VXZ8	Leptospira_phage	48.6	1.6e-14
AVT69288.1|3087117_3088659_+|transposase	IS66 family transposase ISVa5	transposase	S5VTP8	Leptospira_phage	38.9	1.9e-24
3093443:3093456	attR	CAAGAGAAATCACT	NA	NA	NA	NA
>prophage 1
CP020533	Vibrio anguillarum strain 425 chromosome 2, complete sequence	1141928	2484	53167	1141928	transposase,integrase,protease	Vibrio_phage(18.18%)	51	171:184	9202:9215
171:184	attL	TTTCTTTATTAGAT	NA	NA	NA	NA
AVT65686.1|2484_4899_+|integrase	integrase	integrase	NA	NA	NA	NA
AVT65687.1|4910_5441_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65688.1|5440_6805_+|integrase	integrase	integrase	NA	NA	NA	NA
AVT65689.1|7027_8203_-	hypothetical protein	NA	NA	NA	NA	NA
AVT65690.1|8351_9608_+	chromosome partitioning protein ParB	NA	R9U8L2	Vibrio_phage	34.1	7.2e-14
9202:9215	attR	ATCTAATAAAGAAA	NA	NA	NA	NA
AVT65691.1|9658_9943_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65692.1|9939_10128_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65693.1|10614_11820_+	cobalamin biosynthesis protein CobQ	NA	NA	NA	NA	NA
AVT65694.1|11812_13603_+	thiamine biosynthesis protein ThiF	NA	NA	NA	NA	NA
AVT65695.1|13571_14078_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65696.1|14067_14583_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65697.1|14774_15092_+|transposase	transposase	transposase	NA	NA	NA	NA
AVT65698.1|15088_15442_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65699.1|15501_17043_+|transposase	IS66 family transposase ISVa5	transposase	S5VTD3	Leptospira_phage	35.9	3.4e-74
AVT65700.1|19041_19356_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65701.1|19397_20366_-|transposase	IS30 family transposase ISVa6	transposase	W5R8L2	Staphylococcus_phage	37.5	5.7e-43
AVT66627.1|20447_20573_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
AVT65702.1|20610_21126_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVT65703.1|21644_22076_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65704.1|22072_22606_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVT65705.1|23288_23573_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65706.1|23880_24087_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65707.1|24080_24206_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
AVT65708.1|24259_24808_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65709.1|24958_25303_+	regulator of ribonuclease activity A	NA	A0A2I7S9F9	Vibrio_phage	42.6	3.6e-08
AVT66628.1|25299_25416_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65710.1|25455_26112_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65711.1|26269_26587_+|transposase	transposase	transposase	NA	NA	NA	NA
AVT65712.1|26583_26937_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65713.1|26996_28538_+|transposase	IS66 family transposase ISVa5	transposase	S5VTD3	Leptospira_phage	35.9	3.4e-74
AVT65714.1|29162_30200_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
AVT65715.1|30209_30461_-	acetyltransferase	NA	NA	NA	NA	NA
AVT65716.1|30465_31647_-	methyltransferase	NA	NA	NA	NA	NA
AVT65717.1|32195_33896_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.5	1.8e-31
AVT65718.1|33963_34794_-	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	39.5	3.5e-33
AVT65719.1|35059_35782_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
AVT65720.1|36282_36867_-	NADPH quinone reductase MdaB	NA	NA	NA	NA	NA
AVT65721.1|36868_37669_-	2,5-didehydrogluconate reductase B	NA	A0A1V0SKP9	Klosneuvirus	34.9	4.9e-40
AVT65722.1|37779_38685_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVT65723.1|38869_39091_-	hypothetical protein	NA	NA	NA	NA	NA
AVT65724.1|39395_40385_-	hypothetical protein	NA	NA	NA	NA	NA
AVT65725.1|41205_42198_-	multidrug transporter	NA	NA	NA	NA	NA
AVT65726.1|42187_43294_-	hemolysin D	NA	NA	NA	NA	NA
AVT65727.1|43313_43823_-	permease	NA	NA	NA	NA	NA
AVT65728.1|43921_44635_+	transporter	NA	NA	NA	NA	NA
AVT65729.1|44952_47832_-	glycine dehydrogenase (aminomethyl-transferring)	NA	M4QFZ1	Prochlorococcus_phage	51.4	1.5e-269
AVT65730.1|47913_48294_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
AVT65731.1|48351_49659_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.1	9.6e-102
AVT65732.1|50051_50675_+	transcriptional regulator	NA	NA	NA	NA	NA
AVT65733.1|50954_52100_+	glycine cleavage system aminomethyltransferase T	NA	NA	NA	NA	NA
AVT65734.1|52177_53167_+|protease	serine protease	protease	D2TEK9	Emiliania_huxleyi_virus	30.2	7.9e-16
>prophage 2
CP020533	Vibrio anguillarum strain 425 chromosome 2, complete sequence	1141928	122888	183067	1141928	tRNA,integrase,transposase	Leptospira_phage(26.67%)	72	127641:127654	133133:133146
AVT65795.1|122888_124940_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	23.6	5.5e-27
AVT65796.1|125260_127279_+	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.5	4.1e-51
AVT65797.1|127492_129421_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.6	3.8e-123
127641:127654	attL	TTATCGAAAATGAT	NA	NA	NA	NA
AVT65798.1|129424_129976_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	39.0	1.2e-13
AVT66630.1|130079_130274_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVT65799.1|130315_130669_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVT66631.1|130740_131280_-|integrase	integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.1	6.0e-34
AVT65800.1|131276_132818_-|transposase	IS66 family transposase ISVa5	transposase	S5VTD3	Leptospira_phage	35.9	3.4e-74
AVT65801.1|132877_133231_-	hypothetical protein	NA	NA	NA	NA	NA
133133:133146	attR	ATCATTTTCGATAA	NA	NA	NA	NA
AVT65802.1|133227_133545_-|transposase	transposase	transposase	NA	NA	NA	NA
AVT65803.1|133850_134129_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65804.1|134312_134630_+|transposase	transposase	transposase	NA	NA	NA	NA
AVT65805.1|134626_134980_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65806.1|135039_136581_+|transposase	IS66 family transposase ISVa5	transposase	S5VTD3	Leptospira_phage	35.9	3.4e-74
AVT65807.1|136562_136832_+|transposase	transposase	transposase	NA	NA	NA	NA
AVT65808.1|136828_137182_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65809.1|137241_138783_+|transposase	IS66 family transposase ISVa5	transposase	S5VTD3	Leptospira_phage	35.9	3.4e-74
AVT66632.1|138851_139310_-	hypothetical protein	NA	NA	NA	NA	NA
AVT65810.1|139528_139621_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
AVT65811.1|139811_140027_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65812.1|141153_141597_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65813.1|141789_142476_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65814.1|143658_143868_-	hypothetical protein	NA	NA	NA	NA	NA
AVT65815.1|143965_144934_-|transposase	IS30 family transposase ISVa6	transposase	W5R8L2	Staphylococcus_phage	37.5	5.7e-43
AVT65816.1|144964_145141_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65817.1|145700_146003_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65818.1|146034_147003_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.5	3.3e-43
AVT65819.1|147402_147582_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65820.1|149339_149555_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65821.1|149636_150173_+	nitrate reductase	NA	NA	NA	NA	NA
AVT65822.1|150296_150899_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65823.1|151106_151397_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AVT65824.1|152049_152490_+	excinuclease	NA	NA	NA	NA	NA
AVT65825.1|152600_152798_-	hypothetical protein	NA	NA	NA	NA	NA
AVT65826.1|152796_153012_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65827.1|153094_153274_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65828.1|153266_154331_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65829.1|154305_154446_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
AVT65830.1|155207_155450_-	hypothetical protein	NA	NA	NA	NA	NA
AVT65831.1|155436_155850_-	hypothetical protein	NA	NA	NA	NA	NA
AVT65832.1|156302_156812_+	AAA family ATPase	NA	A0A097BYE2	Leuconostoc_phage	32.0	1.4e-08
AVT65833.1|157962_158736_+	phosphotransferase	NA	NA	NA	NA	NA
AVT65834.1|159344_159902_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65835.1|159920_160034_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
AVT65836.1|160986_161724_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65837.1|162883_163132_+	glutathione peroxidase	NA	NA	NA	NA	NA
AVT65838.1|163918_164464_+	ribosomal-protein-L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
AVT65839.1|164596_165112_+	lipocalin	NA	A0A1W6JNX6	Morganella_phage	49.1	1.9e-45
AVT66633.1|166044_166155_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65840.1|166660_166945_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65841.1|167197_167404_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
AVT65842.1|167523_167754_-	secretion protein	NA	NA	NA	NA	NA
AVT65843.1|168436_168973_+	nitrate reductase	NA	NA	NA	NA	NA
AVT65844.1|169636_169996_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65845.1|170150_170510_+	glyoxalase family protein	NA	NA	NA	NA	NA
AVT65846.1|171038_171128_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65847.1|171686_172610_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65848.1|172606_173005_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65849.1|173335_174877_-|transposase	IS66 family transposase ISVa5	transposase	S5VTD3	Leptospira_phage	35.9	3.4e-74
AVT65850.1|174936_175290_-	hypothetical protein	NA	NA	NA	NA	NA
AVT65851.1|175286_175604_-|transposase	transposase	transposase	NA	NA	NA	NA
AVT66634.1|175694_175811_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65852.1|175898_176105_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
AVT65853.1|176224_176455_-	secretion protein	NA	NA	NA	NA	NA
AVT65854.1|176748_176985_-	RNA recognition motif containing protein	NA	NA	NA	NA	NA
AVT65855.1|177269_177758_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65856.1|178467_178965_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVT65857.1|178961_179234_-	hypothetical protein	NA	NA	NA	NA	NA
AVT65858.1|179303_179549_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65859.1|180760_181681_-|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	100.0	1.7e-177
AVT65860.1|181779_182073_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65861.1|182098_183067_-|transposase	IS30 family transposase ISVa6	transposase	W5R8L2	Staphylococcus_phage	37.5	5.7e-43
>prophage 3
CP020533	Vibrio anguillarum strain 425 chromosome 2, complete sequence	1141928	193073	235827	1141928	tail,integrase,transposase,protease	Vibrio_phage(22.22%)	43	186894:186908	211390:211404
186894:186908	attL	AATTGAGAGGATTGT	NA	NA	NA	NA
AVT65875.1|193073_193445_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVT65876.1|193547_194507_+|integrase	integrase	integrase	A0A2I7R1N2	Vibrio_phage	23.9	2.5e-14
AVT65877.1|194490_195495_-	D-alanine--D-alanine ligase A	NA	NA	NA	NA	NA
AVT65878.1|195666_196248_-	cytochrome C biogenesis protein CcdA	NA	NA	NA	NA	NA
AVT65879.1|196467_199158_+	protein acetyltransferase	NA	NA	NA	NA	NA
AVT65880.1|199201_200098_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVT65881.1|200741_201905_-	hypothetical protein	NA	NA	NA	NA	NA
AVT65882.1|202042_202225_-	hypothetical protein	NA	NA	NA	NA	NA
AVT65883.1|202418_203960_-|transposase	IS66 family transposase ISVa5	transposase	S5VTD3	Leptospira_phage	35.9	3.4e-74
AVT65884.1|204019_204373_-	hypothetical protein	NA	NA	NA	NA	NA
AVT65885.1|204369_204687_-|transposase	transposase	transposase	NA	NA	NA	NA
AVT65886.1|204872_205028_-	YoaH family protein	NA	NA	NA	NA	NA
AVT65887.1|205073_206264_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
AVT65888.1|206324_207209_-	hypothetical protein	NA	NA	NA	NA	NA
AVT65889.1|207205_207865_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.1	1.2e-28
AVT65890.1|207839_209294_-	histidine kinase	NA	NA	NA	NA	NA
AVT65891.1|209445_210822_-	NAD(P) transhydrogenase subunit beta	NA	NA	NA	NA	NA
AVT65892.1|210833_212384_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
211390:211404	attR	AATTGAGAGGATTGT	NA	NA	NA	NA
AVT65893.1|212673_212988_-	transcriptional regulator	NA	NA	NA	NA	NA
AVT65894.1|212968_213337_-	competence protein ComFB	NA	NA	NA	NA	NA
AVT65895.1|213451_214816_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.9	6.0e-14
AVT65896.1|214991_215204_+	cold shock domain protein CspD	NA	A0A1W6JNX5	Morganella_phage	61.2	7.6e-17
AVT65897.1|215523_217536_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.7	3.9e-17
AVT65898.1|217768_220120_+	9-hexadecenoic acid cis-trans isomerase	NA	NA	NA	NA	NA
AVT65899.1|220155_220344_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65900.1|220403_220901_-	urease	NA	NA	NA	NA	NA
AVT65901.1|220975_221644_-	thiol:disulfide oxidoreductase	NA	NA	NA	NA	NA
AVT65902.1|221646_222267_-	glutathione S-transferase	NA	NA	NA	NA	NA
AVT65903.1|222366_222951_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVT65904.1|222947_223343_+	DNA-binding protein	NA	NA	NA	NA	NA
AVT65905.1|223610_225215_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	26.8	5.5e-51
AVT65906.1|225367_227056_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
AVT65907.1|227135_227381_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AVT65908.1|227370_227838_-	esterase	NA	NA	NA	NA	NA
AVT65909.1|228094_229177_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AVT65910.1|229380_229947_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
AVT65911.1|230097_230289_-	hypothetical protein	NA	NA	NA	NA	NA
AVT65912.1|230878_231196_+|transposase	transposase	transposase	NA	NA	NA	NA
AVT65913.1|231192_231546_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65914.1|231605_233147_+|transposase	IS66 family transposase ISVa5	transposase	S5VTD3	Leptospira_phage	35.9	3.4e-74
AVT65915.1|233166_234372_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65916.1|234368_234878_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65917.1|234906_235827_-|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	100.0	1.7e-177
>prophage 4
CP020533	Vibrio anguillarum strain 425 chromosome 2, complete sequence	1141928	477292	549438	1141928	capsid,transposase,portal,tail,terminase,integrase,bacteriocin	Vibrio_phage(43.75%)	56	491574:491589	551175:551190
AVT66102.1|477292_478540_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVT66103.1|480607_481090_+	hypothetical protein	NA	NA	NA	NA	NA
AVT66104.1|481211_481556_+	HNH endonuclease	NA	A0A2P0PA14	Pectobacterium_phage	48.9	2.9e-05
AVT66105.1|481573_481789_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66106.1|481899_483855_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66107.1|484128_484638_+	cytochrome B	NA	NA	NA	NA	NA
AVT66108.1|484988_485348_+	diacylglycerol kinase	NA	NA	NA	NA	NA
AVT66109.1|485514_485670_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	90.2	2.2e-21
AVT66110.1|485769_498483_-	helicase	NA	A0A240F4T3	Ochrobactrum_phage	29.5	0.0e+00
491574:491589	attL	TGGTTTTGAGCTGGTT	NA	NA	NA	NA
AVT66111.1|498955_500077_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66112.1|500078_500426_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66113.1|500473_501250_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66114.1|501356_501791_-	aegerolysin	NA	NA	NA	NA	NA
AVT66115.1|502098_503514_-	ATPase	NA	M4MHC7	Vibrio_phage	35.5	4.9e-43
AVT66646.1|503513_503774_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AVT66116.1|503776_504154_-	hypothetical protein	NA	A0A1I9KFD7	Aeromonas_phage	44.2	5.5e-18
AVT66117.1|504157_504808_-	hypothetical protein	NA	A0A1I9KFE8	Aeromonas_phage	44.2	8.3e-38
AVT66647.1|504807_505149_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66118.1|505189_505552_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66119.1|505556_507533_-|tail	phage tail protein	tail	A0A2L1IV54	Escherichia_phage	31.8	7.8e-47
AVT66120.1|507532_509140_-	hypothetical protein	NA	A0A1I9KFD2	Aeromonas_phage	44.9	3.0e-129
AVT66648.1|509212_511717_-	hypothetical protein	NA	A0A240EWW2	Vibrio_phage	31.6	2.3e-19
AVT66121.1|511731_512361_-	hypothetical protein	NA	A0A1I9KFD0	Aeromonas_phage	33.3	2.5e-23
AVT66122.1|512360_512960_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66123.1|512962_513427_-	hypothetical protein	NA	A0A1I9KFH0	Aeromonas_phage	57.7	4.2e-28
AVT66124.1|513484_513865_-	hypothetical protein	NA	M4MCI2	Vibrio_phage	31.1	1.8e-08
AVT66125.1|513879_515085_-|capsid	major capsid protein	capsid	A0A088CC32	Shigella_phage	58.0	6.1e-135
AVT66126.1|515147_516152_-	ATPase	NA	A0A1I9KFD1	Aeromonas_phage	31.3	7.5e-22
AVT66649.1|516269_516530_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66127.1|516541_517120_-	hypothetical protein	NA	A0A1V0E8A2	Vibrio_phage	36.4	6.0e-24
AVT66128.1|517122_517344_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66129.1|517787_518306_-	secretion activator protein	NA	Q6VT55	Vibrio_phage	63.2	1.4e-59
AVT66130.1|518374_518686_-	hypothetical protein	NA	R9TR41	Vibrio_phage	47.4	2.2e-20
AVT66650.1|518980_520015_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVT66131.1|523171_525292_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.0	2.5e-11
AVT66132.1|525288_526527_-	HlyD family secretion protein	NA	NA	NA	NA	NA
AVT66133.1|526606_527668_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66134.1|527646_529191_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66135.1|529212_529440_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66136.1|531945_532353_-	peptidase	NA	A0A1B1ITQ0	uncultured_Mediterranean_phage	48.3	6.6e-25
AVT66137.1|532514_534614_-|portal	portal protein	portal	A0A088CE71	Shigella_phage	58.2	1.8e-203
AVT66138.1|534598_536296_-|terminase	terminase	terminase	A0A1I9KFB6	Aeromonas_phage	64.9	8.1e-218
AVT66139.1|536288_537134_-	hypothetical protein	NA	A0A2R2Z334	Escherichia_phage	25.0	7.0e-13
AVT66140.1|537248_538067_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66141.1|538133_539099_-	helix-turn-helix domain-containing protein	NA	R9TPU9	Vibrio_phage	58.7	1.8e-97
AVT66142.1|539434_539692_-	hypothetical protein	NA	R9TMN6	Vibrio_phage	70.6	1.9e-22
AVT66143.1|539723_539918_-	hypothetical protein	NA	R9TPV3	Vibrio_phage	82.8	1.8e-25
AVT66144.1|539993_540707_+	transcriptional regulator	NA	R9TNM0	Vibrio_phage	85.3	3.2e-115
AVT66145.1|540974_541235_+	hypothetical protein	NA	A0A1V0E8D5	Vibrio_phage	47.0	1.8e-07
AVT66146.1|541244_541433_+	hypothetical protein	NA	NA	NA	NA	NA
AVT66147.1|541408_542632_+|integrase	site-specific integrase	integrase	R9TMP3	Vibrio_phage	74.9	5.9e-178
AVT66148.1|542722_544012_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66149.1|544004_545495_-	type II restriction endonuclease subunit R	NA	M1NSM1	Streptococcus_phage	36.6	1.4e-48
AVT66150.1|545575_546904_+	DNA (cytosine-5-)-methyltransferase	NA	Q6DMX0	Streptococcus_phage	53.9	3.6e-112
AVT66151.1|547213_548245_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	94.2	2.7e-22
AVT66152.1|548241_549438_-	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	28.7	8.6e-41
551175:551190	attR	AACCAGCTCAAAACCA	NA	NA	NA	NA
>prophage 5
CP020533	Vibrio anguillarum strain 425 chromosome 2, complete sequence	1141928	1045228	1076645	1141928	tRNA,transposase,protease	Leptospira_phage(28.57%)	26	NA	NA
AVT66543.1|1045228_1047985_-|protease	protease	protease	NA	NA	NA	NA
AVT66544.1|1048180_1048426_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66545.1|1048932_1049694_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AVT66546.1|1049883_1050480_+	hypothetical protein	NA	NA	NA	NA	NA
AVT66547.1|1050530_1051451_+|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	100.0	1.7e-177
AVT66548.1|1051474_1053337_+	peptidase M9	NA	NA	NA	NA	NA
AVT66549.1|1053625_1054807_+	hypothetical protein	NA	NA	NA	NA	NA
AVT66550.1|1054990_1055914_+	enterochelin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVT66654.1|1055965_1056877_+	iron ABC transporter	NA	A0A2H4IY97	uncultured_Caudovirales_phage	43.0	1.1e-69
AVT66551.1|1056869_1057850_+	ABC transporter permease	NA	NA	NA	NA	NA
AVT66552.1|1057856_1058618_+	iron ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.4	6.8e-15
AVT66553.1|1058950_1060144_+	acetate kinase	NA	NA	NA	NA	NA
AVT66554.1|1060452_1061703_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2C9CX69	Yersinia_phage	43.4	4.9e-87
AVT66555.1|1061795_1062614_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AVT66556.1|1062961_1064656_+	chromosomal replication initiator DnaA	NA	NA	NA	NA	NA
AVT66557.1|1065336_1066809_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	52.6	9.1e-133
AVT66558.1|1067281_1067848_+	hypothetical protein	NA	NA	NA	NA	NA
AVT66559.1|1067878_1069288_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
AVT66560.1|1069492_1069810_+|transposase	transposase	transposase	NA	NA	NA	NA
AVT66561.1|1069806_1070160_+	hypothetical protein	NA	NA	NA	NA	NA
AVT66562.1|1070219_1071761_+|transposase	IS66 family transposase ISVa5	transposase	S5VTD3	Leptospira_phage	35.9	3.4e-74
AVT66563.1|1072403_1072688_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66564.1|1072862_1073519_-	QnrVC family quinolone resistance pentapeptide repeat protein	NA	NA	NA	NA	NA
AVT66565.1|1074376_1075918_-|transposase	IS66 family transposase ISVa5	transposase	S5VTD3	Leptospira_phage	35.9	3.4e-74
AVT66566.1|1075977_1076331_-	hypothetical protein	NA	NA	NA	NA	NA
AVT66567.1|1076327_1076645_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
CP020532	Vibrio anguillarum strain 425 plasmid pEIB1, complete sequence	66521	0	2143	66521	transposase	Vibrio_phage(100.0%)	2	NA	NA
AVT65629.1|315_1035_-	4-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AVT65630.1|1222_2143_+|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	100.0	1.7e-177
>prophage 2
CP020532	Vibrio anguillarum strain 425 plasmid pEIB1, complete sequence	66521	8163	14042	66521		Salmonella_phage(25.0%)	7	NA	NA
AVT65640.1|8163_9708_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	37.9	7.2e-32
AVT65641.1|9908_10730_+	hypothetical protein	NA	A0A1X9IGI7	Lactococcus_phage	27.6	1.1e-13
AVT65642.1|10726_11698_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65643.1|11703_12087_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65644.1|12088_13303_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65645.1|13431_13722_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	40.9	3.8e-11
AVT65683.1|13745_14042_-	hypothetical protein	NA	A0A141GEX6	Brucella_phage	48.9	5.1e-19
>prophage 3
CP020532	Vibrio anguillarum strain 425 plasmid pEIB1, complete sequence	66521	18887	28204	66521	transposase	Leptospira_phage(16.67%)	8	NA	NA
AVT65650.1|18887_20429_-|transposase	IS66 family transposase ISVa5	transposase	S5VTD3	Leptospira_phage	35.9	3.4e-74
AVT65651.1|20488_20842_-	hypothetical protein	NA	NA	NA	NA	NA
AVT65652.1|20838_21156_-|transposase	transposase	transposase	NA	NA	NA	NA
AVT65653.1|21340_23023_-	ABC transporter	NA	W8CYL7	Bacillus_phage	30.9	9.0e-20
AVT65654.1|23019_24630_-	ABC transporter	NA	G3M9Y6	Bacillus_virus	33.0	7.1e-14
AVT65655.1|24745_25906_-	histidine decarboxylase	NA	A0A2P0VP20	Tetraselmis_virus	37.4	2.2e-65
AVT65656.1|26194_27163_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.8	6.7e-44
AVT65657.1|27283_28204_-|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	100.0	1.7e-177
>prophage 4
CP020532	Vibrio anguillarum strain 425 plasmid pEIB1, complete sequence	66521	33590	36737	66521		Tupanvirus(100.0%)	1	NA	NA
AVT65661.1|33590_36737_-	non-ribosomal peptide synthase	NA	A0A2K9KZV5	Tupanvirus	22.6	1.3e-48
>prophage 5
CP020532	Vibrio anguillarum strain 425 plasmid pEIB1, complete sequence	66521	41077	52779	66521	transposase	Vibrio_phage(40.0%)	9	NA	NA
AVT65665.1|41077_42022_-	ferric anguibactin ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	34.7	2.1e-58
AVT65666.1|42484_43393_+|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	60.1	9.6e-101
AVT65667.1|43481_45599_+	peptide synthetase	NA	NA	NA	NA	NA
AVT65668.1|45785_46283_+	hypothetical protein	NA	NA	NA	NA	NA
AVT65669.1|46279_47146_-|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	99.7	2.4e-165
AVT65670.1|47230_47665_-	RecX family transcriptional regulator	NA	NA	NA	NA	NA
AVT65671.1|47661_49056_-	transcriptional regulator	NA	NA	NA	NA	NA
AVT65672.1|49133_49718_-	resolvase	NA	A0A219YA40	Aeromonas_phage	36.1	3.6e-24
AVT65673.1|49836_52779_-|transposase	DDE transposase	transposase	A0A125RQ78	Bacillus_phage	21.7	1.4e-52
>prophage 6
CP020532	Vibrio anguillarum strain 425 plasmid pEIB1, complete sequence	66521	58271	61729	66521	transposase	Leptospira_phage(50.0%)	2	NA	NA
AVT65679.1|58271_59813_+|transposase	IS66 family transposase ISVa5	transposase	S5VTD3	Leptospira_phage	35.9	3.4e-74
AVT65680.1|60808_61729_-|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	100.0	1.7e-177
