The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025221	Listeria monocytogenes strain PIR00543 chromosome, complete genome	2987434	118347	124873	2987434	tail	Listeria_phage(33.33%)	10	NA	NA
AVV08450.1|118347_118800_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
AVV08451.1|118805_119141_-	XRE family transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
AVV08452.1|119357_119786_+	hypothetical protein	NA	NA	NA	NA	NA
AVV08453.1|119797_120214_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	39.3	1.3e-20
AVV08454.1|120492_120882_+	DUF5072 domain-containing protein	NA	NA	NA	NA	NA
AVV08455.1|120894_121407_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
AVV08456.1|121454_121757_+	segregation and condensation protein B	NA	NA	NA	NA	NA
AVV08457.1|121798_122203_+	phenylalanine racemase	NA	NA	NA	NA	NA
AVV08458.1|122189_124058_+	hypothetical protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.3	1.7e-19
AVV08459.1|124054_124873_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	4.2e-39
>prophage 2
CP025221	Listeria monocytogenes strain PIR00543 chromosome, complete genome	2987434	676742	733304	2987434	transposase,terminase,tail,capsid,integrase,holin,protease,head,portal	Listeria_phage(45.71%)	66	709342:709365	712139:712162
AVV08959.1|676742_677894_-|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	46.3	3.4e-87
AVV08960.1|677915_678629_-	hypothetical protein	NA	NA	NA	NA	NA
AVV08961.1|678683_679184_-	hypothetical protein	NA	A0A1S7FYX8	Listeria_phage	31.9	3.2e-13
AVV08962.1|679196_679523_-	XRE family transcriptional regulator	NA	Q0H244	Geobacillus_phage	47.1	1.6e-13
AVV08963.1|679697_679889_+	XRE family transcriptional regulator	NA	Q0H243	Geobacillus_phage	57.6	8.1e-10
AVV08964.1|679986_680313_+	DUF771 domain-containing protein	NA	A0A2H4J474	uncultured_Caudovirales_phage	41.1	4.9e-15
AVV08965.1|680485_681400_+	hypothetical protein	NA	A0A1W6JNI1	Staphylococcus_phage	51.9	2.3e-54
AVV08966.1|681401_681758_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AVV08967.1|681754_682171_+	hypothetical protein	NA	NA	NA	NA	NA
AVV11234.1|682428_683415_+	DNA cytosine methyltransferase	NA	H7BVD3	unidentified_phage	37.4	7.1e-49
AVV08968.1|683411_683957_+	DUF1642 domain-containing protein	NA	A0A0B5D0I5	Listeria_phage	58.6	6.5e-52
AVV08969.1|683974_684400_+	hypothetical protein	NA	A0A059T6G6	Listeria_phage	80.7	7.0e-38
AVV08970.1|684503_684887_+	preprotein translocase subunit YajC	NA	A8ATZ3	Listeria_phage	77.2	5.4e-45
AVV08971.1|684907_685156_+	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	84.0	3.8e-28
AVV08972.1|685155_685737_+	DUF3310 domain-containing protein	NA	A0A059T5J6	Listeria_phage	75.8	1.2e-75
AVV08973.1|685736_686216_+	single-stranded DNA-binding protein	NA	A8ASP5	Listeria_phage	81.9	1.5e-68
AVV08974.1|686269_686461_+	hypothetical protein	NA	NA	NA	NA	NA
AVV08975.1|686521_687040_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AVV08976.1|687036_687579_+|integrase	site-specific integrase	integrase	H0USV4	Bacillus_phage	53.3	4.3e-48
AVV08977.1|687862_688189_+	hypothetical protein	NA	NA	NA	NA	NA
AVV08978.1|688185_688548_+	HNH endonuclease	NA	A0A075M5R4	Enterococcus_phage	46.2	5.5e-15
AVV08979.1|688642_689170_+|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	46.7	6.1e-31
AVV08980.1|689138_690890_+|terminase	terminase large subunit	terminase	A0A2H4JCI4	uncultured_Caudovirales_phage	50.7	4.1e-156
AVV08981.1|690896_691097_+	DUF1056 domain-containing protein	NA	NA	NA	NA	NA
AVV08982.1|691099_692335_+|portal	phage portal protein	portal	A0A2H4JAR2	uncultured_Caudovirales_phage	42.1	3.6e-82
AVV08983.1|692331_692898_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1D6Z2A7	Staphylococcus_phage	52.2	1.0e-44
AVV08984.1|692955_694131_+|capsid	phage major capsid protein	capsid	A0A060AI54	Enterococcus_phage	38.1	2.2e-44
AVV08985.1|694179_694518_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	37.8	1.1e-12
AVV08986.1|694487_694808_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AVV08987.1|694801_695167_+	hypothetical protein	NA	NA	NA	NA	NA
AVV08988.1|695169_695568_+	hypothetical protein	NA	NA	NA	NA	NA
AVV08989.1|695589_696165_+|tail	phage tail protein	tail	M1PRQ7	Streptococcus_phage	41.8	6.0e-32
AVV08990.1|696254_696602_+	hypothetical protein	NA	NA	NA	NA	NA
AVV08991.1|696798_700998_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	33.0	1.6e-12
AVV08992.1|700990_703234_+|tail	phage tail protein	tail	A0A059T682	Listeria_phage	29.4	1.2e-56
AVV08993.1|703239_705531_+	hypothetical protein	NA	A0A059T7Y6	Listeria_phage	37.7	8.3e-133
AVV08994.1|705523_706588_+	hypothetical protein	NA	A0A059T7R4	Listeria_phage	58.5	1.7e-109
AVV08995.1|706635_707079_+	hypothetical protein	NA	A0A059T6F6	Listeria_phage	100.0	6.8e-76
AVV08996.1|707057_707474_+	hypothetical protein	NA	A0A059T5F5	Listeria_phage	100.0	1.1e-43
AVV08997.1|707494_707761_+|holin	phage holin	holin	A0A059T684	Listeria_phage	96.6	1.0e-39
AVV08998.1|707757_708585_+	N-acetylmuramoyl-L-alanine amidase	NA	Q8W5Y8	Listeria_phage	77.8	1.7e-75
AVV08999.1|708658_709105_-	hypothetical protein	NA	Q9T196	Listeria_phage	94.2	2.4e-65
709342:709365	attL	CCTTCAGCCGGACTTGGGTATTTC	NA	NA	NA	NA
AVV09000.1|709812_710094_-|integrase	integrase	integrase	NA	NA	NA	NA
AVV09001.1|710443_711358_+	peptidase	NA	NA	NA	NA	NA
AVV09002.1|711357_711717_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
AVV09003.1|712248_712782_+	transcriptional regulator	NA	NA	NA	NA	NA
712139:712162	attR	CCTTCAGCCGGACTTGGGTATTTC	NA	NA	NA	NA
AVV09004.1|712845_713763_+	aldo/keto reductase	NA	NA	NA	NA	NA
AVV09005.1|714028_715909_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.4	4.9e-107
AVV09006.1|716004_716733_+	hypothetical protein	NA	NA	NA	NA	NA
AVV09007.1|716874_717525_+	transaldolase	NA	A0A0E3HJ81	Synechococcus_phage	27.6	1.5e-15
AVV09008.1|717564_719385_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	28.4	2.2e-48
AVV09009.1|719619_721011_+	amino acid transporter	NA	NA	NA	NA	NA
AVV09010.1|721100_721940_+	glyoxalase	NA	NA	NA	NA	NA
AVV09011.1|722022_722307_-	hypothetical protein	NA	NA	NA	NA	NA
AVV09012.1|722404_723355_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
AVV09013.1|723378_724020_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVV09014.1|724062_726753_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
AVV09015.1|726798_727446_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVV09016.1|727454_727991_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVV09017.1|729088_729298_+	hypothetical protein	NA	NA	NA	NA	NA
AVV09018.1|729365_730073_+	serine/threonine protein phosphatase	NA	A0A249Y183	Enterococcus_phage	28.2	3.8e-20
AVV09019.1|730116_730680_-	DUF420 domain-containing protein	NA	NA	NA	NA	NA
AVV09020.1|730799_731216_+	hypothetical protein	NA	NA	NA	NA	NA
AVV09021.1|731267_731903_+	endonuclease III domain-containing protein	NA	NA	NA	NA	NA
AVV09022.1|731892_732789_-	Rgg family transcriptional regulator	NA	NA	NA	NA	NA
AVV09023.1|733019_733304_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
CP025221	Listeria monocytogenes strain PIR00543 chromosome, complete genome	2987434	1158245	1165668	2987434		Hokovirus(33.33%)	8	NA	NA
AVV09455.1|1158245_1158629_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
AVV09456.1|1158650_1159634_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.6	4.1e-12
AVV09457.1|1159648_1160662_+	glycosyl transferase	NA	A0A1V0SAH6	Catovirus	32.0	7.9e-11
AVV09458.1|1160870_1162361_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
AVV09459.1|1162372_1163197_+	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	9.7e-68
AVV09460.1|1163209_1163518_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AVV09461.1|1163578_1163983_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AVV09462.1|1164111_1165668_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	2.3e-17
>prophage 4
CP025221	Listeria monocytogenes strain PIR00543 chromosome, complete genome	2987434	1277721	1358488	2987434	terminase,tail,capsid,tRNA,integrase,holin,protease,head,portal	Listeria_phage(82.26%)	102	1277605:1277621	1320843:1320859
1277605:1277621	attL	AATCCCTCTCAGGACGT	NA	NA	NA	NA
AVV09585.1|1277721_1278876_-|integrase	site-specific integrase	integrase	A8ATC7	Listeria_phage	92.4	3.4e-204
AVV09586.1|1279010_1279445_-	hypothetical protein	NA	Q8W5Y2	Listeria_phage	81.2	6.5e-55
AVV09587.1|1279460_1280030_-	DUF4352 domain-containing protein	NA	R4IBV3	Listeria_phage	92.3	9.8e-11
AVV09588.1|1280080_1280533_-	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	90.7	1.1e-78
AVV09589.1|1280549_1280873_-	XRE family transcriptional regulator	NA	A0A059T6G1	Listeria_phage	69.2	4.7e-34
AVV09590.1|1281502_1281706_-	hypothetical protein	NA	NA	NA	NA	NA
AVV09591.1|1281772_1281964_+	XRE family transcriptional regulator	NA	A0A059T5F8	Listeria_phage	87.1	5.4e-22
AVV09592.1|1281985_1282228_+	hypothetical protein	NA	A8ATD2	Listeria_phage	93.8	3.9e-41
AVV09593.1|1282230_1282416_+	hypothetical protein	NA	A8ATD3	Listeria_phage	95.1	1.1e-27
AVV09594.1|1282936_1283119_+	hypothetical protein	NA	NA	NA	NA	NA
AVV09595.1|1283115_1283571_+	class I SAM-dependent methyltransferase	NA	A8ATY8	Listeria_phage	90.7	1.5e-81
AVV09596.1|1283758_1284043_+	hypothetical protein	NA	A0A059T7N1	Listeria_phage	94.7	2.3e-45
AVV09597.1|1284039_1284249_+	hypothetical protein	NA	A8ASN7	Listeria_phage	89.9	5.7e-25
AVV09598.1|1284245_1284845_+	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	60.5	1.7e-58
AVV09599.1|1284847_1285042_+	hypothetical protein	NA	A0A0B5CU49	Listeria_phage	93.5	2.4e-25
AVV09600.1|1285044_1285488_+	hypothetical protein	NA	NA	NA	NA	NA
AVV09601.1|1285484_1285664_+	hypothetical protein	NA	A0A059T5G0	Listeria_phage	89.8	1.7e-22
AVV09602.1|1285722_1286316_+	hypothetical protein	NA	A0A060AFJ6	Listeria_phage	76.0	2.5e-41
AVV09603.1|1286419_1286635_+	hypothetical protein	NA	NA	NA	NA	NA
AVV09604.1|1286631_1286841_+	hypothetical protein	NA	A0A059T6C7	Listeria_phage	59.1	6.6e-13
AVV09605.1|1286841_1287171_+	hypothetical protein	NA	A8ATE1	Listeria_phage	100.0	1.1e-57
AVV09606.1|1287167_1287440_+	hypothetical protein	NA	A8ATE2	Listeria_phage	100.0	2.0e-46
AVV09607.1|1287436_1287655_+	hypothetical protein	NA	NA	NA	NA	NA
AVV09608.1|1287651_1288086_+	hypothetical protein	NA	A8ATS7	Listeria_phage	52.8	2.5e-38
AVV09609.1|1288288_1288672_+	hypothetical protein	NA	A8ATE8	Listeria_phage	92.9	5.3e-61
AVV09610.1|1288673_1289153_+	hypothetical protein	NA	R4IBM0	Listeria_phage	76.7	7.6e-57
AVV09611.1|1289172_1289862_+	DNA-binding protein	NA	R4IDY8	Listeria_phage	98.3	2.8e-129
AVV09612.1|1289925_1291182_+	ATP-dependent helicase	NA	R4IBK4	Listeria_phage	94.5	6.0e-218
AVV09613.1|1291206_1291689_+	hypothetical protein	NA	A8ATF2	Listeria_phage	98.1	2.7e-86
AVV09614.1|1291711_1294000_+	DNA primase	NA	A8ATF3	Listeria_phage	93.9	0.0e+00
AVV09615.1|1294333_1294651_+	VRR-NUC domain-containing protein	NA	A8ATF4	Listeria_phage	95.1	9.2e-51
AVV09616.1|1294652_1294865_+	hypothetical protein	NA	NA	NA	NA	NA
AVV11244.1|1295454_1295994_+	DUF3310 domain-containing protein	NA	A8ATF5	Listeria_phage	74.9	1.2e-71
AVV09617.1|1295990_1296269_+	hypothetical protein	NA	NA	NA	NA	NA
AVV09618.1|1296504_1296732_+	hypothetical protein	NA	NA	NA	NA	NA
AVV09619.1|1296744_1297170_+	hypothetical protein	NA	A0A059T6H4	Listeria_phage	100.0	8.0e-74
AVV09620.1|1297267_1298011_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
AVV09621.1|1298257_1298584_+	hypothetical protein	NA	A0A059T5G5	Listeria_phage	100.0	2.2e-55
AVV09622.1|1298583_1298898_+	HNH endonuclease	NA	A8ATF8	Listeria_phage	98.1	5.0e-57
AVV11245.1|1298947_1299304_+	hypothetical protein	NA	A8AT94	Listeria_phage	98.0	2.6e-46
AVV09623.1|1299300_1300944_+|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	98.5	0.0e+00
AVV09624.1|1300955_1302086_+|portal	phage portal protein	portal	A8AT96	Listeria_phage	92.8	3.7e-203
AVV09625.1|1302082_1302889_+|protease	Clp protease ClpP	protease	A0A059T5F2	Listeria_phage	93.3	3.8e-133
AVV09626.1|1302915_1304067_+|capsid	phage major capsid protein	capsid	A8AT98	Listeria_phage	99.5	1.6e-214
AVV09627.1|1304253_1304553_+	hypothetical protein	NA	A8ATA0	Listeria_phage	100.0	5.3e-48
AVV09628.1|1304536_1304902_+|head,tail	phage head-tail adapter protein	head,tail	A8ATA1	Listeria_phage	100.0	1.3e-64
AVV09629.1|1304898_1305300_+	hypothetical protein	NA	A8ATA2	Listeria_phage	100.0	2.1e-68
AVV09630.1|1305296_1305680_+	DUF3168 domain-containing protein	NA	A8ATA3	Listeria_phage	100.0	3.8e-67
AVV09631.1|1305701_1306289_+|tail	phage tail protein	tail	A8ATA4	Listeria_phage	99.5	5.8e-107
AVV09632.1|1306359_1306692_+	hypothetical protein	NA	A8ATA5	Listeria_phage	99.1	1.8e-52
AVV09633.1|1306907_1311719_+|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	70.3	0.0e+00
AVV09634.1|1311706_1313356_+|tail	phage tail protein	tail	A0A059T682	Listeria_phage	99.5	0.0e+00
AVV09635.1|1313368_1315663_+	hypothetical protein	NA	A0A059T7Y6	Listeria_phage	94.0	0.0e+00
AVV09636.1|1315652_1316747_+	carbohydrate-binding protein CenC	NA	A0A059T7R4	Listeria_phage	87.9	2.2e-184
AVV09637.1|1316794_1317097_+	hypothetical protein	NA	A0A059T5E6	Listeria_phage	93.0	1.7e-38
AVV09638.1|1317096_1317354_+|holin	phage holin	holin	A8ATB7	Listeria_phage	69.0	3.2e-25
AVV09639.1|1317353_1318196_+	peptidase M15	NA	A0A059T7Y8	Listeria_phage	81.6	9.5e-127
AVV09640.1|1318299_1319298_+	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	44.8	3.9e-71
AVV09641.1|1319512_1319719_-	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	82.8	1.3e-16
AVV09642.1|1320309_1320543_+	hypothetical protein	NA	R4IDW6	Listeria_phage	78.9	2.8e-28
AVV09643.1|1320539_1320731_+	hypothetical protein	NA	R4IBI5	Listeria_phage	88.9	8.9e-25
AVV09644.1|1321224_1322583_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
1320843:1320859	attR	AATCCCTCTCAGGACGT	NA	NA	NA	NA
AVV09645.1|1322624_1323218_-	hypothetical protein	NA	NA	NA	NA	NA
AVV09646.1|1323354_1323762_-	VOC family protein	NA	NA	NA	NA	NA
AVV09647.1|1323926_1324526_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.5	2.9e-29
AVV09648.1|1324558_1324819_-	hypothetical protein	NA	NA	NA	NA	NA
AVV09649.1|1324942_1326355_+	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.1	4.9e-51
AVV09650.1|1326379_1326643_+	DUF3116 domain-containing protein	NA	NA	NA	NA	NA
AVV09651.1|1326810_1327287_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
AVV09652.1|1327324_1327570_-	hypothetical protein	NA	NA	NA	NA	NA
AVV09653.1|1327566_1328772_-	MFS transporter	NA	NA	NA	NA	NA
AVV09654.1|1328768_1328978_-	hypothetical protein	NA	NA	NA	NA	NA
AVV09655.1|1328976_1329636_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AVV09656.1|1329677_1329872_-	hypothetical protein	NA	NA	NA	NA	NA
AVV09657.1|1329938_1330787_-	YitT family protein	NA	NA	NA	NA	NA
AVV09658.1|1331405_1332119_+	trehalose operon repressor	NA	NA	NA	NA	NA
AVV09659.1|1332138_1333797_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
AVV09660.1|1333815_1335300_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AVV09661.1|1335415_1335868_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AVV09662.1|1335914_1336379_-	hypothetical protein	NA	NA	NA	NA	NA
AVV09663.1|1336567_1337446_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVV09664.1|1337465_1338713_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	51.8	1.2e-106
AVV09665.1|1338696_1339527_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	4.3e-47
AVV09666.1|1339662_1340802_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVV09667.1|1340882_1341278_-	XRE family transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
AVV09668.1|1341428_1341644_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVV09669.1|1341762_1342296_+	hypothetical protein	NA	NA	NA	NA	NA
AVV09670.1|1342313_1342979_+	hypothetical protein	NA	NA	NA	NA	NA
AVV09671.1|1343240_1344179_+	hypothetical protein	NA	NA	NA	NA	NA
AVV09672.1|1344293_1345577_+	trigger factor	NA	NA	NA	NA	NA
AVV09673.1|1345762_1347022_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
AVV09674.1|1347140_1347707_+	signal peptidase I	NA	NA	NA	NA	NA
AVV09675.1|1347741_1348311_+	signal peptidase I	NA	NA	NA	NA	NA
AVV09676.1|1348412_1348955_+	signal peptidase I	NA	NA	NA	NA	NA
AVV09677.1|1348964_1349828_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
AVV09678.1|1349824_1350610_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.2	3.0e-26
AVV09679.1|1350743_1351604_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AVV09680.1|1351874_1353953_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	3.2e-107
AVV09681.1|1354015_1355320_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
AVV09682.1|1355602_1356505_+	tyrosine recombinase XerC	NA	A0A097EYL9	Mycobacterium_phage	28.6	1.2e-13
AVV09683.1|1356525_1357065_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AVV09684.1|1357078_1358488_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	28.7	3.7e-43
>prophage 5
CP025221	Listeria monocytogenes strain PIR00543 chromosome, complete genome	2987434	1915039	1923325	2987434		Synechococcus_phage(33.33%)	8	NA	NA
AVV10189.1|1915039_1915606_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.9	4.1e-25
AVV10190.1|1915602_1916652_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.5	4.6e-62
AVV10191.1|1916670_1918098_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
AVV10192.1|1918082_1920302_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.4	1.5e-160
AVV10193.1|1920294_1920978_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AVV10194.1|1920981_1921227_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AVV10195.1|1921238_1921952_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.7	2.7e-42
AVV10196.1|1922032_1923325_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 6
CP025221	Listeria monocytogenes strain PIR00543 chromosome, complete genome	2987434	2582901	2590745	2987434		Streptococcus_phage(50.0%)	7	NA	NA
AVV10818.1|2582901_2583873_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
AVV10819.1|2583880_2584849_-	gluconeogenesis factor	NA	A1IMD5	Streptococcus_phage	43.3	6.7e-68
AVV10820.1|2584850_2585726_-	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	3.2e-08
AVV10821.1|2585833_2587564_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.0	2.3e-175
AVV10822.1|2587605_2588667_-	galactose mutarotase	NA	NA	NA	NA	NA
AVV10823.1|2588683_2589667_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	37.2	2.6e-51
AVV10824.1|2589785_2590745_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 7
CP025221	Listeria monocytogenes strain PIR00543 chromosome, complete genome	2987434	2880020	2890051	2987434		Tupanvirus(33.33%)	8	NA	NA
AVV11107.1|2880020_2882174_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	34.1	4.0e-44
AVV11108.1|2882197_2883970_-	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	37.1	6.3e-80
AVV11109.1|2884130_2885597_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.0	8.0e-97
AVV11284.1|2885619_2885754_+	restriction endonuclease	NA	NA	NA	NA	NA
AVV11110.1|2885883_2886414_-	ADP-ribose-binding protein	NA	A0A0K1L687	Scale_drop_disease_virus	50.0	5.2e-30
AVV11111.1|2886471_2888082_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	2.4e-46
AVV11112.1|2888260_2888569_+	hypothetical protein	NA	NA	NA	NA	NA
AVV11113.1|2888596_2890051_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	30.3	1.9e-50
